ID: 923104379

View in Genome Browser
Species Human (GRCh38)
Location 1:230843263-230843285
Sequence CTGTGGCCTGCCTGCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 259}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923104372_923104379 24 Left 923104372 1:230843216-230843238 CCTCTGAGGAAGAGGCAGGGGAA 0: 1
1: 1
2: 9
3: 62
4: 864
Right 923104379 1:230843263-230843285 CTGTGGCCTGCCTGCTTTGTGGG 0: 1
1: 0
2: 0
3: 22
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923104379 Original CRISPR CTGTGGCCTGCCTGCTTTGT GGG Intronic
901092895 1:6654188-6654210 CTGTGACATTCATGCTTTGTGGG - Intronic
901130874 1:6962190-6962212 CTGAGACCTGCGTGCCTTGTCGG - Intronic
902241246 1:15090797-15090819 CTGCTGCCTGCCTCCTCTGTGGG - Intronic
902282409 1:15384172-15384194 CTGTGGTCTGCAAGGTTTGTGGG - Intronic
902382802 1:16060504-16060526 CTGTGGCCTGCCAGCTCTGCTGG + Intronic
904438489 1:30514735-30514757 CTCTAACCTGCCTGCTGTGTAGG - Intergenic
904595713 1:31644161-31644183 CTGTGGCCAGAATTCTTTGTTGG - Intronic
905858058 1:41327973-41327995 TTATGTCCTTCCTGCTTTGTTGG + Intergenic
905903456 1:41597644-41597666 GTGTGGCCTGGCTGCCTTGAGGG - Intronic
906227848 1:44136701-44136723 CTGTGCACTGGCTGCTTTCTGGG - Intergenic
907488743 1:54795233-54795255 ATGTGGCCTGCCTGCATCATAGG + Intronic
907514143 1:54982511-54982533 ATGTGCCCTGCCTGCTGTGGGGG + Intronic
907755829 1:57309822-57309844 CTTTGTCCTTCCTTCTTTGTGGG - Intronic
908711446 1:67019996-67020018 CTGAGGTCTGGCTGTTTTGTAGG - Intronic
915178168 1:154034617-154034639 CTGTGCCCAGACTGCTTTGCTGG + Intronic
916340495 1:163728262-163728284 CTTTGTCCTGCCTGCTGGGTGGG - Intergenic
916661164 1:166923350-166923372 CTGTGGACTTCCTGCTCTGTGGG - Intronic
920436482 1:205950178-205950200 CTAGGGCCTGCCTGCTGTGCCGG - Intergenic
922957399 1:229614901-229614923 CTGCCTCCTGCCTGCTTTTTTGG - Intronic
923104379 1:230843263-230843285 CTGTGGCCTGCCTGCTTTGTGGG + Intronic
924562447 1:245168227-245168249 CTGTGGGCTGCCATGTTTGTGGG + Intronic
1063032369 10:2248154-2248176 CTGTGGCCTTCCTGACTTTTGGG + Intergenic
1063083446 10:2790590-2790612 CTCTGGCTTGTCTGTTTTGTGGG - Intergenic
1064351975 10:14584843-14584865 CTGTGACCAGCCTGATTGGTTGG - Intronic
1069937840 10:71930901-71930923 TTCTGGCATGCTTGCTTTGTAGG + Intergenic
1071836338 10:89421821-89421843 CTTGGGCCTGCCTGTGTTGTAGG - Intergenic
1073666392 10:105539007-105539029 CCGGGGGCTGCCTGCTGTGTAGG + Intergenic
1075733747 10:124651688-124651710 CTGGGGCCTGCCTGCTCTGGAGG + Intronic
1076151077 10:128162329-128162351 CTGCGGCCAGGCTGCTTTTTGGG + Intergenic
1077252762 11:1567850-1567872 CTGCTGCCTGCCTGCTGTGGAGG + Intronic
1081227507 11:40542403-40542425 CTGTGGCCCAGCTGCCTTGTGGG + Intronic
1085278571 11:75315458-75315480 CTGTGGACTGGAGGCTTTGTTGG - Intronic
1087796009 11:102455159-102455181 GTGTGGCCTTCCTGCTCTCTTGG + Intronic
1088658739 11:112026219-112026241 ATGGTGCCTGCCTGCATTGTGGG - Exonic
1088728703 11:112661774-112661796 CTCAGGCCTGCCTTCTTTGAGGG - Intergenic
1090418646 11:126558245-126558267 CTGTGGCCTGCCAGCTTTTCTGG + Intronic
1091265808 11:134270230-134270252 CTGGGTCCTGCCTGCAGTGTGGG - Intergenic
1091298621 11:134490415-134490437 CTGGGACCTTCCTGCTTTGCAGG + Intergenic
1091846457 12:3659821-3659843 CTGTGGTCTGCATCCCTTGTCGG - Intronic
1092191206 12:6522334-6522356 CTTTGGCCTCCCAGTTTTGTAGG - Intronic
1092524688 12:9302480-9302502 CCGTGGCCAGCCTGCTCTCTGGG + Intergenic
1092542575 12:9429332-9429354 CCGTGGCCAGCCTGCTCTCTGGG - Intergenic
1093052728 12:14521282-14521304 GTGTGGCCTTCCTGCTGGGTAGG - Intronic
1093938320 12:25025359-25025381 CTGCAGCCTGCCTGCTATTTTGG + Intronic
1094510440 12:31093102-31093124 CCGTGGCCAGCCTGCTCTCTGGG + Intronic
1094661016 12:32470742-32470764 CTGCGCCCGGCCTGCTTTGAAGG + Intronic
1095616652 12:44198388-44198410 CTGTGGTGGCCCTGCTTTGTTGG - Intronic
1097802159 12:63926483-63926505 CTGTGCTCTGCCTGCCTTCTGGG + Intronic
1098797816 12:74914672-74914694 CTGTGGCTTGCCTGGGCTGTGGG - Intergenic
1100209848 12:92389321-92389343 CTGTCACCTGCCTCCTTTGAGGG + Intergenic
1101549521 12:105749025-105749047 CTGAGGCCTGCCAGCTTCGGAGG - Intergenic
1102278466 12:111599765-111599787 CTGGGGCCTGCCTGGTGTGGAGG + Intergenic
1102744841 12:115241606-115241628 CTGTGGCCTGCCACCCCTGTTGG + Intergenic
1103489761 12:121308036-121308058 CTGAGGCCTCCCTGCCTTGTTGG - Intergenic
1104109062 12:125688761-125688783 ATGTGGGGTGCCTGCTTTCTGGG + Intergenic
1104385690 12:128349669-128349691 CTTTGTCCAGCCTGCTTTGATGG - Intronic
1106924194 13:34596085-34596107 CTGTGGACTACCTGCTTCATGGG + Intergenic
1107420542 13:40242217-40242239 CTGAAGCCTACCTACTTTGTGGG - Intergenic
1110171365 13:72504565-72504587 CAGTTGCATGCCAGCTTTGTGGG + Intergenic
1112814148 13:103252247-103252269 CAGTGGCCTGCTGGCTCTGTTGG + Intergenic
1113460429 13:110478616-110478638 CTGTGCCCTGCCTGCCTTCTGGG - Intronic
1113647959 13:112012221-112012243 CTGGGGCCTGGCTGCTTCGCAGG - Intergenic
1113652591 13:112046359-112046381 CTGTGGCTTGACAGGTTTGTGGG + Intergenic
1115624727 14:35179279-35179301 TGGTGGCCTGCCTGCTAGGTTGG + Intronic
1116962911 14:50985422-50985444 CTCTGGATTGCCTGCTTTATAGG + Intronic
1118118301 14:62806551-62806573 CTGCGGTCTGCTTCCTTTGTAGG - Intronic
1118326554 14:64785456-64785478 CTGTGGACTTCCTGCCTTGAGGG + Intronic
1118905626 14:70021224-70021246 CTGTGTCCTCCCTGCTGTTTGGG + Intronic
1119293598 14:73515804-73515826 CTGAGGCCTCCCTCCTTTCTGGG + Intronic
1119293662 14:73516279-73516301 CTGAGGCCTCCCTCCTTTCTGGG + Intronic
1119502379 14:75140767-75140789 CTGTGCCCTGCCTGCAGTGAAGG - Intronic
1119732447 14:76959396-76959418 CTGTGGCCTTCCTGATTCATAGG + Intergenic
1121048242 14:90803391-90803413 CTGAGGCCAGCCTGCTTGGTTGG - Intronic
1122134294 14:99624049-99624071 GTCTGGCCTGGCTGCCTTGTGGG - Intergenic
1122340106 14:101022433-101022455 CAGTAGCCTGCCAGCTTTGGAGG + Intergenic
1122792121 14:104188431-104188453 CTGTGCCCAGGCTGATTTGTGGG + Intergenic
1123984421 15:25632590-25632612 CTGTGCCCTGCCTGCCTAGGTGG - Intergenic
1124001886 15:25766988-25767010 CTTTGCCCTGCCTGGTTTCTTGG + Intronic
1124641973 15:31401455-31401477 TAGTGGGCTGCCTGCTTTGAGGG + Intronic
1126783674 15:52159503-52159525 CTGTGGCCTCCCTGCTCAGTTGG + Intronic
1128061017 15:64736165-64736187 CTGCTGCCTGCCTGCCCTGTGGG + Intergenic
1128361459 15:66964686-66964708 CTGGGGTCTGTCTGCTCTGTGGG - Intergenic
1129460639 15:75698515-75698537 CCATGCCCTGCCTGCTTGGTTGG - Intronic
1129832779 15:78681606-78681628 CTGTGGCCTCACTGCTGTGGTGG - Intronic
1130322114 15:82850163-82850185 CTGCGTTCTGCCTGCTTTGTTGG - Intronic
1131620198 15:94060244-94060266 CTGTCACCTGGGTGCTTTGTTGG + Intergenic
1131907657 15:97161475-97161497 CCCTGGCCTGGCTGCTTTTTTGG + Intergenic
1132574542 16:658449-658471 CTGGGGCCTCCCTTCGTTGTGGG - Intronic
1132604944 16:789724-789746 CTGTGGCCTTCCTGCACGGTGGG + Intronic
1132659747 16:1056000-1056022 CTGAGGGTTGCCTGCTTTGGGGG + Intergenic
1133072557 16:3256255-3256277 CTGAGTGCTGGCTGCTTTGTGGG - Intronic
1133510631 16:6453992-6454014 CTGAGGCTTTCCTGCTTGGTTGG + Intronic
1133522394 16:6571583-6571605 CTGTTGCTTGCCTGTTTTCTAGG + Intronic
1137738180 16:50740669-50740691 CTGAGTCCTACCAGCTTTGTTGG + Intergenic
1139491394 16:67288010-67288032 CTGTAGCCTGCCTGCTACCTCGG - Exonic
1139960351 16:70714077-70714099 CTGTGGCCTGCTTGCTTACCAGG + Intronic
1140730219 16:77849634-77849656 CTCAGACCTGCCTTCTTTGTAGG - Intronic
1141611259 16:85182322-85182344 CTGGAGCCTGCCTGGTTTCTTGG - Intronic
1142340799 16:89521122-89521144 CTGTGTCCTGGGTGCTCTGTTGG + Intronic
1142696587 17:1637210-1637232 CTGTGGCAGGCCTGAATTGTGGG - Intronic
1142713479 17:1735940-1735962 CTCAGGCCTTCCTGCTGTGTGGG + Intronic
1142866965 17:2797141-2797163 CTCTGGGCTGCCTGCTGTCTTGG + Intronic
1143353556 17:6307549-6307571 CTTTGTCCTGCCTGCTCTGGGGG - Intergenic
1143904730 17:10199048-10199070 CTGTTCTGTGCCTGCTTTGTAGG + Intergenic
1144794439 17:17881514-17881536 CTGTGCCCTTCCTGCTCTGAGGG - Intronic
1144848359 17:18231620-18231642 TTGTTGGCTGCCTGCTTTGGAGG + Intronic
1145242568 17:21248439-21248461 CTCTGGCCTCCCTGCCTTGGTGG + Intronic
1147213226 17:38884292-38884314 GGGTGGCCTTCCTGCTTGGTGGG - Intronic
1148460622 17:47837356-47837378 CTGAGGCATGCCTGCCCTGTGGG - Exonic
1153733391 18:8038680-8038702 CTGTGCCTTGCCAGCTTTTTAGG + Intronic
1157949177 18:52015377-52015399 CTGTGGCCTTCCTTCTTTGGAGG + Intergenic
1158679527 18:59554578-59554600 CTCTGGCCTCCCTGCTTCTTGGG - Intronic
1158862463 18:61606289-61606311 GGGTGGCCTGCCTGCTCTTTGGG - Intergenic
1159910186 18:74138481-74138503 CTCTTCCCTGCCTGCTTGGTTGG + Intronic
1160339419 18:78075066-78075088 CTGTTGTCTGTCTGCTTTCTAGG - Intergenic
1160570988 18:79817769-79817791 CTGTGGCCTCACAGCTTTGGTGG + Intergenic
1164456668 19:28413321-28413343 ATGATGACTGCCTGCTTTGTAGG + Intergenic
1166234464 19:41445723-41445745 CTGCCGCTTGCATGCTTTGTGGG - Intergenic
1167026173 19:46920335-46920357 CTGGGGCATGTCTCCTTTGTTGG - Exonic
1167124259 19:47538562-47538584 GTGTGGCCAGCCTCCTTTGCCGG - Intronic
1167409368 19:49335874-49335896 CTGTAGCCTGCCTGCAGAGTAGG - Intronic
926252024 2:11160112-11160134 TTCTGGCCTGCCTGCCATGTTGG - Intronic
927857176 2:26535071-26535093 GGGTGGCCTTCCTGCTTTGTGGG + Intronic
927982926 2:27386197-27386219 CTGTAGCTTGCCTTCCTTGTAGG + Exonic
928181514 2:29071696-29071718 CTGTGGACTTGCTGCTTTCTGGG + Exonic
929754921 2:44756449-44756471 CTGTGCCCGGCCATCTTTGTGGG - Intronic
929917333 2:46146975-46146997 CTGTGGCCTTCCTTCTTCCTGGG - Intronic
933582462 2:84142935-84142957 CTACGGCCTGCCTGCTTTGCTGG + Intergenic
936288197 2:111197920-111197942 CTGTGGGTTGACTGCTTGGTAGG - Intergenic
936985304 2:118306433-118306455 CTGTGGCCCGGCTGCTTGGGTGG - Intergenic
936993883 2:118393677-118393699 CTGTGGCCAGCTTGCAGTGTGGG - Intergenic
939956747 2:148533777-148533799 CTGTGGCCTGCCTCTCTTCTTGG + Intergenic
940604446 2:155902305-155902327 CAGGGGCCTGCAGGCTTTGTGGG + Intergenic
946016986 2:216611794-216611816 GCATGGCCTGCCTGCTTTGTTGG + Intergenic
947107401 2:226681785-226681807 CTATGCCCTGCCTCCTCTGTTGG - Intergenic
947659459 2:231855771-231855793 CTGTGGCCTCCCTGCTCCATGGG - Intergenic
948348674 2:237320768-237320790 CTGGGGTCTTCCTGCTTTCTTGG - Intergenic
1169904780 20:10591422-10591444 CTGTGGCCTCCCTGTCTTGCAGG - Intronic
1170680700 20:18522733-18522755 CTCTGGGCTGCCTCCTTTTTTGG - Intronic
1171135434 20:22690867-22690889 CCCTGGCATGCCTGCTTTCTGGG - Intergenic
1171459670 20:25291499-25291521 CTGTGGCCTGGCTGCTGCCTTGG + Intronic
1172968776 20:38858394-38858416 CCGTGGCCTGGCTGCATTGAAGG + Intronic
1173226402 20:41164791-41164813 CTATGGCCTGCCTCTTTTCTGGG + Intronic
1173241716 20:41302714-41302736 CAGTGGCCTGCCAGCAGTGTTGG - Intronic
1173685618 20:44921487-44921509 GTGTGGCCAGCCTGGTTTGCAGG + Intronic
1175262543 20:57683907-57683929 CTGTGGGCTGTCTGTTTTGGGGG + Intronic
1175482946 20:59324345-59324367 CTAAAGCCTGCTTGCTTTGTTGG - Exonic
1175775029 20:61647721-61647743 CTGTGGGGTGCTTGCTCTGTAGG + Intronic
1178058676 21:28828174-28828196 CTGTAGTCTGCAGGCTTTGTGGG - Intergenic
1180831695 22:18910072-18910094 CTTTGGCCTGGCTGCTCTGCTGG + Intronic
1181068155 22:20316297-20316319 CTTTGGCCTGGCTGCTCTGCTGG - Intronic
1181630551 22:24148900-24148922 CAGTGGCCAGCCTCCTTTCTGGG + Intronic
1182127255 22:27825117-27825139 CTCTGGCCTGCCTTCTTTCCAGG - Intergenic
1182234666 22:28865900-28865922 CTGTGGTATCCCTGTTTTGTAGG - Intergenic
1183295287 22:37025567-37025589 CACTGACCAGCCTGCTTTGTGGG - Intronic
1183410179 22:37650380-37650402 GGATGGTCTGCCTGCTTTGTGGG + Intronic
1184417978 22:44363274-44363296 GGGTGGACTGCCGGCTTTGTGGG + Intergenic
1184419136 22:44369426-44369448 CAGTGGTCTGCCTGCTCTGCCGG + Intergenic
1184605822 22:45574344-45574366 CTGCAGCCTGGCTGCTCTGTGGG - Intronic
1203281775 22_KI270734v1_random:135343-135365 CTTTGGCCTGGCTGCTCTGCTGG + Intergenic
950289177 3:11769863-11769885 AGGTGTTCTGCCTGCTTTGTAGG - Intergenic
951202597 3:19891600-19891622 CTGTGGCCTACCTATTTGGTTGG + Intronic
951919783 3:27841760-27841782 CTGTGGCCTGACTTCTCGGTGGG - Intergenic
955502618 3:59599957-59599979 CTGAGGCCTGGCTGCATTCTTGG + Intergenic
957826613 3:85454392-85454414 TTGTGGTCTGCTTGCTTGGTGGG - Intronic
958827830 3:99053181-99053203 CTGTGGCATTTCTCCTTTGTTGG + Intergenic
959593196 3:108101607-108101629 CTGTATCCTGCCTGCCTTTTTGG + Intergenic
960074548 3:113469891-113469913 CTGTGGACAGGCTCCTTTGTAGG - Intronic
960464649 3:117982451-117982473 ATGTTGCCTGCCTTGTTTGTGGG + Intergenic
960747037 3:120901810-120901832 AGGAGGCCTGCCTGCCTTGTGGG - Intergenic
961038278 3:123658734-123658756 CTTTGGCCTTCCTGCCTTGCTGG - Intronic
962347161 3:134626522-134626544 ATGTGGCCTCCCTGCCTGGTGGG + Intronic
965933238 3:174072641-174072663 CTCTGGACTGCAAGCTTTGTGGG - Intronic
966376038 3:179296833-179296855 TTCTGGCTTTCCTGCTTTGTTGG + Intergenic
966626060 3:182018375-182018397 CTGTGGCCTGCTTGGTTCCTAGG + Intergenic
969067718 4:4501335-4501357 GTGTGGCCTGCCTGCCTAGGAGG - Intronic
969494598 4:7519361-7519383 CTGTGGGCTTCCAGCTCTGTGGG - Intronic
971134387 4:23852116-23852138 TTGTGGTCTGCCTCCTTAGTGGG - Intronic
972423210 4:38909614-38909636 CTGGGGCATGCCTGGATTGTGGG - Intronic
972505103 4:39713446-39713468 CTGTGCCCAGCCAGATTTGTAGG + Intronic
973785292 4:54326888-54326910 CTGTGGCCTTACTGCCATGTGGG + Intergenic
974360549 4:60872842-60872864 CTGTGGTCTGGGTGATTTGTTGG + Intergenic
975261210 4:72301934-72301956 CTGTGGACTGCCTGGTGTCTTGG - Intronic
975343146 4:73263576-73263598 CTTTGGCTAGCCTGATTTGTGGG - Intergenic
975913478 4:79297137-79297159 CTGTCGCCTGCCACCGTTGTGGG + Intronic
978318572 4:107467501-107467523 CTGTGGCCTGCCTTGTGTTTGGG - Intergenic
978978744 4:114915206-114915228 CTGTGGCCTCTCTGGTCTGTAGG + Intronic
983063629 4:163185835-163185857 TTGTTCCCTGCTTGCTTTGTTGG + Intergenic
983273107 4:165586583-165586605 CTATGCACTGCATGCTTTGTGGG - Intergenic
984442879 4:179794829-179794851 GTGTGGCCTGTCCACTTTGTGGG - Intergenic
984636800 4:182119572-182119594 CTGTGACCTCCCTTCTTTGAGGG + Intergenic
985161696 4:187051049-187051071 CTGTGGCCTGCCTGCAAAGGTGG - Intergenic
987167852 5:15219768-15219790 CTGAGGCCAGCATTCTTTGTTGG + Intergenic
989268323 5:39503316-39503338 CTGTGGGCTCCCTGCTTGGGAGG + Intergenic
991976545 5:72188884-72188906 CTGTGGCATCCTTTCTTTGTGGG - Intronic
992445811 5:76832476-76832498 CTGTGGCCTGGCTGTTTAGGAGG + Intronic
992459936 5:76951533-76951555 CTGTGGCATGCCTGGTGAGTGGG + Intergenic
992856957 5:80871670-80871692 TTGTTGCCTGCCTGCTCTGAGGG - Intronic
993811621 5:92485940-92485962 CTGTGTCTTTCCTACTTTGTGGG - Intergenic
997435979 5:133875953-133875975 CTCTGGCCTGCCTGGGTTCTAGG + Intergenic
997844926 5:137277747-137277769 GGGTGTCCTGCCTGCTTTCTTGG - Intronic
998006603 5:138661375-138661397 CTGTGGCCTCCCAGCTTCCTAGG - Intronic
998378283 5:141705945-141705967 CTCTGCCCTGCCTACTTTCTGGG + Intergenic
999364844 5:151015983-151016005 CCATGGCCTGCCTGCTATATTGG + Intergenic
1000364211 5:160476222-160476244 TTTTGGCCTGGCTGCTTTGGCGG + Intergenic
1000848340 5:166309373-166309395 CTGTGGCCTGGCTGATTTCTAGG - Intergenic
1001333576 5:170779520-170779542 CTGTGGCCTGGATCCTATGTGGG - Intronic
1001783360 5:174390168-174390190 ATGTGGTCTGCCTGCTTTAAAGG - Intergenic
1002445659 5:179288465-179288487 CTGTGGCCAGGCTGCTCTGCAGG + Intronic
1002788680 6:423436-423458 TTGTGGCCTGCCTGCCTGGACGG + Intergenic
1003506425 6:6744054-6744076 CTGTGCCCTGCCTGTTTCGATGG - Intergenic
1004797462 6:19103548-19103570 CAGAGTCCAGCCTGCTTTGTGGG + Intergenic
1005303649 6:24494412-24494434 CTGCTGCCTGGCTGCTTTTTTGG - Intronic
1006294408 6:33163682-33163704 CTGGGGCCTGTCTGCTTCATGGG - Exonic
1007061277 6:38942841-38942863 CTCTGGTCTGCCTGGTTGGTAGG - Intronic
1016984507 6:149885009-149885031 CTGCCTCCAGCCTGCTTTGTTGG + Intronic
1018447160 6:163868112-163868134 CCGTGGCCTCCCTGCTCTGGGGG - Intergenic
1019197888 6:170292493-170292515 CTGTGGCCAGGCTGCTTCCTTGG - Intergenic
1019201026 6:170315373-170315395 CTGTCCCCTGCCTACTCTGTTGG + Intronic
1019621255 7:1993280-1993302 CTGTGCCCTCCCTGCACTGTGGG - Intronic
1024504829 7:50153570-50153592 CTGTTGGCTGAGTGCTTTGTGGG + Intronic
1026923826 7:74174856-74174878 CTGTTGCCTGCCCGCCTTGCAGG + Intronic
1028893632 7:96016068-96016090 CTTTGGCCTCATTGCTTTGTTGG + Intronic
1032803065 7:135331946-135331968 CTGTGGCTTGGGTGGTTTGTTGG - Intergenic
1033223499 7:139543870-139543892 CAGTCCCCTGCCTGCTCTGTGGG - Intronic
1033647031 7:143313074-143313096 CTCTACCCTGCCTGCTGTGTGGG - Intergenic
1035020661 7:155798164-155798186 GTGGGGCCTGCCTGCTAGGTGGG + Intergenic
1035453837 7:158996621-158996643 CTGGGGTCTCCCTCCTTTGTTGG + Intergenic
1036501307 8:9316997-9317019 CTGTTACCTGCCTGCTGTATAGG + Intergenic
1038185492 8:25270287-25270309 CTCTGGCATGCCTGCTGTCTTGG - Intronic
1038275622 8:26118405-26118427 CTGTCTCCTGCCTGTGTTGTGGG - Intergenic
1038585094 8:28781091-28781113 CCGTGGCTTGTCTTCTTTGTTGG - Intronic
1040894232 8:52349249-52349271 CTGTGTCCTGAAGGCTTTGTGGG + Intronic
1041755998 8:61313671-61313693 CTGTTGGCTGCCTGACTTGTGGG + Intronic
1041850775 8:62389514-62389536 CTCTGGGCTTCCTGCTTTTTAGG + Intronic
1043999724 8:86865127-86865149 CTGTGGTTTGCCTGCTTGGTTGG + Intergenic
1044926899 8:97217034-97217056 CTGTGGCCTGTCTGCCTCTTTGG - Intergenic
1046102977 8:109635749-109635771 CTGGAGTCTGCCTGCTTTGAAGG - Intronic
1047035068 8:120928641-120928663 CTGATGCCTGCCAGCTTTCTTGG - Intergenic
1047332577 8:123905240-123905262 CTGTGGCCTGCCAGGGGTGTTGG - Intronic
1048408792 8:134150492-134150514 GTTTTGCCAGCCTGCTTTGTTGG - Intergenic
1048799847 8:138185560-138185582 CTGTGGGCAGCCTGTTTTGTTGG - Intronic
1050037097 9:1448379-1448401 CTGTTGCCTTCCTGATTTGGGGG - Intergenic
1050797239 9:9560199-9560221 CTGTGTCCTGGCTGAGTTGTGGG - Intronic
1051412334 9:16803166-16803188 GTGGTGCCTTCCTGCTTTGTTGG - Intronic
1051613097 9:18980627-18980649 CTGGGCCCTGCCTGCCTTCTGGG + Intronic
1051696350 9:19772025-19772047 CTGTGGCCTAACTGCTTTGCTGG + Intronic
1052041556 9:23744917-23744939 CTGTGCCCAGCCTGTTTTTTTGG - Intronic
1052949660 9:34198383-34198405 CTGTGGCCGGGCTGCCTGGTTGG + Intronic
1055648750 9:78386491-78386513 CTGGGTGCTCCCTGCTTTGTTGG + Intergenic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1057030839 9:91774055-91774077 CTGTGGTCTGTCTGCACTGTGGG + Intronic
1057195592 9:93114371-93114393 CTGTGCCCTGCCTGCCTCGGAGG - Intergenic
1057437425 9:95055273-95055295 CTGTGGCCTGGCTAGTGTGTGGG + Intronic
1057849088 9:98550727-98550749 CTCTGCCCTGCCTGCTTTGGAGG + Intronic
1057940082 9:99274252-99274274 CTGTTGCCTGCCTGAGCTGTGGG + Intergenic
1058843595 9:108934185-108934207 CGGCGGCCGGCCTTCTTTGTAGG + Exonic
1059847667 9:118299035-118299057 CTGTCTCCTGCCTGCCTTGCTGG - Intergenic
1059964416 9:119599733-119599755 CTGGGGCCTGCATGATGTGTGGG + Intergenic
1061996136 9:134187029-134187051 CCCTGGCTTGCCTGCTTTTTTGG - Intergenic
1062160890 9:135079121-135079143 CTGGGGCCGGCTTGCTTTGAGGG + Intronic
1062277019 9:135736081-135736103 CTGTGCCCTGACAGCTTTGGAGG + Intronic
1187035784 X:15537907-15537929 CTGTGGCCTCCTTGCCCTGTGGG + Intronic
1187199772 X:17123780-17123802 CTGTGGATAGCCTGCTTTGTGGG + Intronic
1187496431 X:19799557-19799579 CTGTTGCCCGACTACTTTGTAGG - Intronic
1191189502 X:57651280-57651302 CTCTGGCCAGCCTGCCATGTAGG - Intergenic
1195501743 X:105609768-105609790 TTGTTGCCTGCCTGATCTGTTGG - Intronic
1196324610 X:114388729-114388751 CTGTGGCCTGCCTGGTGTGGTGG - Intergenic
1198030809 X:132751774-132751796 AGGAGGCCTGCCAGCTTTGTTGG - Intronic
1198307661 X:135398941-135398963 CTGTGGCATGGCTGCTGTGTAGG - Intergenic
1199952250 X:152715630-152715652 CTGTGGCATCCCTTCTTTCTGGG - Intronic
1199954885 X:152734821-152734843 CTGTGGCATCCCTTCTTTCTGGG - Intronic
1199957433 X:152752818-152752840 CTGTGGCATCCCTTCTTTCTGGG + Intronic
1200687802 Y:6273069-6273091 CAGTGGCCTGCCTGTTTGGGGGG + Intergenic
1200706300 Y:6445594-6445616 CTGTTGCCTGTCTTCTCTGTGGG - Intergenic
1200914320 Y:8557913-8557935 CTGTTGCCTGTCTTCTTTGTGGG + Intergenic
1200915958 Y:8571412-8571434 CTGTAGCCTGTCTTCTCTGTGGG + Intergenic
1200936348 Y:8741747-8741769 CTTTCGCCTGTCTTCTTTGTGGG - Intergenic
1201027811 Y:9719114-9719136 CTGTTGCCTGTCTTCTCTGTGGG + Intergenic
1202268497 Y:23045720-23045742 CTGTGGCCTGCCTGCTCCTATGG - Intergenic
1202421489 Y:24679464-24679486 CTGTGGCCTGCCTGCTCCTATGG - Intergenic
1202449297 Y:24990618-24990640 CTGTGGCCTGCCTGCTCCTATGG + Intergenic