ID: 923108225

View in Genome Browser
Species Human (GRCh38)
Location 1:230870314-230870336
Sequence CATATATCTTTATCTACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923108225 Original CRISPR CATATATCTTTATCTACTCC TGG Intergenic
904914251 1:33958450-33958472 CATATAACTTTACCTAGTCATGG - Intronic
905938800 1:41846193-41846215 CATATTTCACTATCTAATCCAGG - Intronic
906549320 1:46649342-46649364 CATATATGTTTGTCTATTTCAGG + Intronic
907666654 1:56438994-56439016 CATAGATGGTTATCTTCTCCTGG + Intergenic
908957223 1:69647634-69647656 CTTATATTTTTATTTACTTCTGG + Intronic
910610038 1:89131233-89131255 CATATATTATTATCTCCTTCTGG - Intronic
910933533 1:92466123-92466145 CATCTGTCTTTGTCTTCTCCTGG + Intergenic
910955016 1:92693552-92693574 CATATATGTATATCCATTCCAGG + Intronic
912577022 1:110681721-110681743 CCTATATCTGCATCTACTTCTGG - Intergenic
912721132 1:112020975-112020997 CAAATAGCTTTCTCTACTCTGGG - Intergenic
913398627 1:118402638-118402660 CATATATTTTTATTTTCTCTGGG - Intergenic
914432846 1:147635214-147635236 CTTAACTTTTTATCTACTCCAGG + Intronic
914993450 1:152517994-152518016 CATACAGCTTTACCTACTGCTGG - Intronic
915853913 1:159360388-159360410 CATATATATTTGTGTACTTCTGG - Intergenic
916015838 1:160749288-160749310 CATTTACCTTTCTCTACTCATGG - Intronic
917070329 1:171143299-171143321 CATATGTCTTTATATATTCCTGG - Exonic
917096088 1:171400227-171400249 CATAAATCTTGAACTAATCCTGG - Intergenic
917688362 1:177441793-177441815 CATATATTGTTATATACTCAGGG - Intergenic
917756755 1:178109101-178109123 GACATAGCTTTATTTACTCCAGG + Intronic
918899785 1:190399841-190399863 CATCTAAATTTAGCTACTCCTGG + Intronic
923108225 1:230870314-230870336 CATATATCTTTATCTACTCCTGG + Intergenic
1063026275 10:2181946-2181968 CATCTGTCTATATCTATTCCTGG + Intergenic
1066586952 10:36945940-36945962 GTTATATATTTATCTACTCTTGG - Intergenic
1068343204 10:55736106-55736128 CATATATCTTAATCAAGACCTGG + Intergenic
1069220771 10:65880390-65880412 CATTTATTTTTATCCTCTCCTGG - Intergenic
1070652031 10:78244411-78244433 CATATATCTATATATACACAAGG + Intergenic
1071033734 10:81216885-81216907 CTTATATCTTCATCTAATCTTGG + Intergenic
1071176117 10:82928580-82928602 CATTTATTTTTATCTATTTCAGG + Intronic
1073550146 10:104392211-104392233 CATATATGTCTTTCTCCTCCAGG + Exonic
1073611071 10:104943885-104943907 TATATATATGGATCTACTCCTGG - Intronic
1075620224 10:123922014-123922036 AATGTATCTTGTTCTACTCCAGG + Intronic
1077397975 11:2335515-2335537 CATATTTCTTTCTGTACACCTGG + Intergenic
1078918303 11:15801679-15801701 CATCCATCTTTATATACTCAAGG - Intergenic
1079245312 11:18748008-18748030 CATATATATTTATCTATTAGAGG - Intronic
1079583846 11:22100333-22100355 CCTATATCTTTATCTTTTCCAGG - Intergenic
1080039170 11:27740695-27740717 CAAAAATCTTTATCTACTGAGGG - Intergenic
1081905509 11:46667063-46667085 CCTCTGTCTTTAGCTACTCCTGG - Intronic
1085137353 11:74104279-74104301 CAAATATTTTTTTCTAGTCCAGG - Intronic
1087104788 11:94398606-94398628 CATCTATCTTTATCTACCATGGG + Intronic
1087717446 11:101625106-101625128 CTTTTATCTCTATGTACTCCAGG - Intronic
1087891705 11:103543749-103543771 CATATGTCTTTGGCTACCCCTGG - Intergenic
1087896972 11:103597016-103597038 CATAGACCTATATCTAATCCTGG + Intergenic
1088016378 11:105065546-105065568 AATATATCTTTACCAACTCTGGG - Intronic
1088018928 11:105095520-105095542 AATATATCTTTACCAACTCCGGG - Intronic
1089704655 11:120269188-120269210 CATATATTTTTATCTTTTCTAGG + Exonic
1090098414 11:123767946-123767968 CATATATCTTGATGTAGTTCAGG + Intergenic
1092078011 12:5689354-5689376 CATCTCTCCTTGTCTACTCCTGG - Intronic
1095299149 12:40561957-40561979 CTCATATCTTTATCTTTTCCAGG - Intronic
1095569574 12:43668859-43668881 CATCTATCTTTATATACAGCAGG - Intergenic
1099061225 12:77911859-77911881 CATATATTTTTTTTAACTCCAGG + Intronic
1099771958 12:87071688-87071710 CATATATGTATATGTATTCCAGG - Intergenic
1101070463 12:101069748-101069770 CATTTGTCTTTATGTACTCTTGG + Intronic
1101167109 12:102049800-102049822 CTTATATCTTTAACCACTGCTGG - Intronic
1104080191 12:125423188-125423210 TAAATATCTTTATCTTCTCCTGG - Intronic
1106905690 13:34406938-34406960 CCTATATCTTTCTCTAGTGCTGG + Intergenic
1107963955 13:45582754-45582776 AATATATCTCTATCTTGTCCAGG + Intronic
1110171407 13:72505199-72505221 CATATATCTATATCTCCACATGG - Intergenic
1111054386 13:82928931-82928953 CTTATATCTTTAACTACTTTAGG - Intergenic
1111148446 13:84216076-84216098 CATATGTGTTAATATACTCCAGG + Intergenic
1113610676 13:111642724-111642746 AATATTTCTTTTTCTAATCCAGG + Intronic
1114002357 14:18271446-18271468 CATATTTCTTTTTCTACTGTAGG + Intergenic
1114892955 14:26948753-26948775 CATATGTATTTATCTATTTCTGG - Intergenic
1115048866 14:29031020-29031042 CATATATCTCTATCCTATCCAGG - Intergenic
1115396659 14:32917036-32917058 CAAAAATCTAGATCTACTCCAGG - Intergenic
1118027214 14:61781583-61781605 CAGATATCTTTAGCCAATCCTGG - Intronic
1118085707 14:62413954-62413976 CATATGTCTTTTACTACTCTAGG - Intergenic
1118956387 14:70486264-70486286 CATGTATCATGATCTCCTCCAGG - Intergenic
1119177965 14:72583322-72583344 CATATATCTATATCTAGATCTGG + Intergenic
1119220434 14:72901951-72901973 CCTCTATCTTTATTTACTTCGGG - Intergenic
1119687056 14:76641424-76641446 CATATCTCTTTGTCCACGCCAGG + Intergenic
1120071833 14:80112328-80112350 CATGTATCTTCATCTTCTACTGG + Intergenic
1121700613 14:95951276-95951298 CCTCTCTCTTTATCTTCTCCCGG + Intergenic
1124196462 15:27635124-27635146 AATATATCTTTATATATTCTTGG + Intergenic
1125140257 15:36397918-36397940 CATGTATCTTTATCTAAACTTGG - Intergenic
1127085434 15:55420156-55420178 GATTTAGCTTTATCTTCTCCAGG - Intronic
1127215767 15:56821744-56821766 CAAATATATTTATCAATTCCTGG - Intronic
1127645060 15:60949759-60949781 CTTATATCTTTATCTGCACTTGG + Intronic
1129090036 15:73139575-73139597 CAGAGATCTTTATCTAGACCCGG + Intronic
1130783619 15:87071950-87071972 CATAAATCGTTCTCTACGCCAGG - Intergenic
1131998809 15:98159682-98159704 CATGTATCTATATCTCCTACTGG - Intergenic
1135088854 16:19496282-19496304 CATGTATCTTTATATTCTCTTGG - Intronic
1135876863 16:26209722-26209744 CTTATATTTTAATCTACTGCAGG - Intergenic
1139041410 16:63003322-63003344 CATACATCTTGATTTACTCAGGG + Intergenic
1139079222 16:63494349-63494371 CATATATATTTGTCAACTGCAGG - Intergenic
1140809079 16:78559639-78559661 CATATATTTTTGTGTATTCCGGG + Intronic
1141465113 16:84200404-84200426 CATTTATCTCCATCTCCTCCTGG + Intergenic
1143042693 17:4050944-4050966 CATATATCCATAACTACTCCTGG - Exonic
1143988382 17:10935270-10935292 CATATTATTTTACCTACTCCAGG + Intergenic
1147351388 17:39848661-39848683 AATAAATCTTTACCTACTCCAGG - Intronic
1148955733 17:51352173-51352195 CATATATTTTTGTGTATTCCTGG + Intergenic
1155192220 18:23440249-23440271 CATATGTCTTTACCTCCTGCTGG + Intergenic
1155368933 18:25078000-25078022 CATCTATCTTTTAGTACTCCGGG + Intronic
1156977126 18:43236959-43236981 TATAGATGTTTATCTACTTCTGG + Intergenic
1158142896 18:54275344-54275366 CATATGTCTTTATGTACTTGTGG - Intronic
1159580279 18:70227777-70227799 AATAAATCTTTCTCTACTGCTGG - Intergenic
1162610980 19:11752342-11752364 GATATAAGTATATCTACTCCTGG + Intergenic
927231794 2:20831150-20831172 GATACATCCTTACCTACTCCAGG + Intergenic
928206030 2:29284239-29284261 CAAATATCTTTATGTCCACCTGG - Intronic
929975947 2:46634699-46634721 TATATGTAGTTATCTACTCCTGG - Intergenic
930953071 2:57167751-57167773 CATATATCTCAGTTTACTCCAGG - Intergenic
933857595 2:86431193-86431215 GATATATGTATAGCTACTCCTGG - Intergenic
934217215 2:90044027-90044049 TATTTATCTTTATTTATTCCAGG + Intergenic
936620392 2:114090413-114090435 CAGATAACAGTATCTACTCCTGG - Intergenic
938034591 2:128026298-128026320 CATATAACTGTATGTACTACAGG - Exonic
942793190 2:179784539-179784561 CAAATATCTTTTTCCACTCTGGG - Intronic
943468274 2:188258176-188258198 CAAATATCTTTCTCTCTTCCAGG - Intergenic
944560811 2:200935534-200935556 CATATATTTGTTTCTACTTCTGG - Intronic
945693580 2:213073862-213073884 AATTTATCTTTTTCTACTTCTGG - Intronic
1168932408 20:1634746-1634768 AATATATATTTATGTACGCCAGG + Intronic
1170834282 20:19870271-19870293 CATGTTTCTTTCTCTAGTCCAGG + Intergenic
1176856387 21:13977804-13977826 CATGTATCTTTATTTACTAAGGG + Intergenic
1178230089 21:30772942-30772964 CATATATCTTTTTTTTTTCCAGG + Intergenic
1179206312 21:39283077-39283099 CTTATATCTTCATCTATTCATGG + Intronic
1182878541 22:33713283-33713305 CATTTTTCTTTATCTGATCCTGG - Intronic
1183138235 22:35911178-35911200 CATTTATCTTTATCTCCCCCAGG + Intronic
949226813 3:1704888-1704910 CAAATATCTTGATTTTCTCCAGG - Intergenic
950288703 3:11765999-11766021 CAAAAATCTTTATTGACTCCAGG - Intergenic
950804902 3:15592315-15592337 CATATATGTATATATACTCTGGG + Intronic
951443345 3:22747952-22747974 AATATCTCTTTGTCTAGTCCTGG + Intergenic
951924715 3:27896296-27896318 CCTATACCTGTATCTACTACTGG + Intergenic
951956387 3:28259351-28259373 CATATATGTTTATGCACTGCGGG - Intronic
951959588 3:28301792-28301814 CATATTTTTTTCTCTTCTCCTGG - Intronic
953836401 3:46349564-46349586 CATACATTCTTGTCTACTCCTGG + Intergenic
954915412 3:54145268-54145290 CAAATATCTCCATTTACTCCGGG - Intronic
955624779 3:60906584-60906606 GATACATCTTTTTTTACTCCAGG + Intronic
956225145 3:66949027-66949049 CATCAATCTTTATCTTCTACGGG + Intergenic
957151331 3:76489754-76489776 CATATATCTTTATGTACTTTTGG - Intronic
958666229 3:97141015-97141037 GATATATGTATAGCTACTCCTGG - Intronic
959583351 3:108003970-108003992 CATATATTTTTATTTGATCCTGG + Intergenic
961127523 3:124433638-124433660 CATATATATGTATCTCCTCAAGG + Intronic
961681146 3:128601004-128601026 CATACACCTTTATATACTCCAGG + Intergenic
962447306 3:135478623-135478645 CATATGTCTTTATTTCCTTCAGG + Intergenic
965277999 3:166712746-166712768 CATATAACTGAATCTATTCCAGG - Intergenic
966511151 3:180765200-180765222 CATATATTTATGTCTACTTCTGG - Intronic
971107045 4:23537822-23537844 CCTAGATCTTTTTCTACTCTTGG - Intergenic
974296667 4:60008912-60008934 AATATACCTTTATTTACTTCTGG + Intergenic
974387912 4:61226851-61226873 TATATAGCTTTATTTACTCTGGG - Intronic
974743065 4:66032731-66032753 CACATTGCTTTATCTACTCTTGG - Intergenic
981353798 4:143764040-143764062 CTTATATCCTTTTCTATTCCAGG + Intergenic
981684970 4:147443773-147443795 CTTATATTTTTTTCTACTCCAGG - Intergenic
982152938 4:152482702-152482724 GATATTTCTTTATTTACTCATGG + Intronic
983426147 4:167585890-167585912 CATACATATATAGCTACTCCAGG + Intergenic
984827227 4:183937066-183937088 CATATATTTTTATGCACTCAGGG + Intronic
985160769 4:187042051-187042073 TATATATCTATATATACTGCCGG + Intergenic
987138827 5:14924804-14924826 CAAATATGTTTTTCTATTCCAGG + Intergenic
987565110 5:19574289-19574311 AATATATATTTTACTACTCCAGG + Intronic
987630418 5:20463172-20463194 GATGTATTTTTCTCTACTCCTGG + Intronic
987836744 5:23172111-23172133 AATAAATCTTTATCTTCTACTGG + Intergenic
988836350 5:35036261-35036283 CATGTTTCTTTATCTATTCTAGG + Intronic
989740364 5:44763640-44763662 CATATATATTTATCAACTGAGGG + Intergenic
993385380 5:87256387-87256409 CATATAGCTTTATTTTCACCAGG - Intergenic
993469592 5:88290890-88290912 CATATATATATATATATTCCAGG - Intergenic
994694900 5:103061941-103061963 CACAAATCTATCTCTACTCCAGG - Intergenic
995027444 5:107440125-107440147 CATATATCTTTCTGTGGTCCAGG - Intronic
995540614 5:113182740-113182762 CTTCTATATTTATCTACTTCCGG + Intronic
996205558 5:120731182-120731204 CATATATCTCTATTTTTTCCAGG - Intergenic
996972729 5:129392282-129392304 CATATATCTTTCTGTACACATGG - Intergenic
997179952 5:131817636-131817658 CATATATCTCTATCTCCTTTAGG + Intronic
999521859 5:152359045-152359067 CATATATCATCAACTACTGCAGG - Intergenic
1001607023 5:172968503-172968525 CATATTTCTTTCTGTACACCTGG - Exonic
1003369848 6:5513589-5513611 CCTCTACCTTTTTCTACTCCTGG + Intronic
1003450306 6:6224898-6224920 CATTTAGGTTTGTCTACTCCAGG + Intronic
1004774842 6:18832292-18832314 CAGATATTTTTTTCTACTCCTGG + Intergenic
1005534330 6:26739306-26739328 CATATATTTATATGCACTCCAGG - Intergenic
1010079980 6:71849716-71849738 CATTTATCTTTAGTTTCTCCAGG - Intergenic
1011437800 6:87357509-87357531 CATTTATCTGTACCTCCTCCAGG - Intronic
1017332851 6:153219752-153219774 CATATATTTATATCTACTGTTGG - Intergenic
1025315121 7:58013647-58013669 CATATTTCTTTTTCTACCCTAGG - Intergenic
1027805394 7:82815237-82815259 CAATTATCATTATTTACTCCGGG - Intronic
1028021547 7:85781652-85781674 AATATATCTTTATATTCCCCAGG - Intergenic
1030486765 7:110178549-110178571 CATATTTCTTTATGTAATGCAGG + Intergenic
1031293028 7:119963706-119963728 CATTTATATTTATCTATTCTTGG + Intergenic
1032353263 7:131185610-131185632 CATAAATCCATTTCTACTCCTGG - Intronic
1032970163 7:137151982-137152004 AATATATTCTTATCTACACCAGG + Intergenic
1033132450 7:138756396-138756418 CACATCTCTTTATCTAATCCTGG + Intronic
1033773216 7:144577472-144577494 CATATGGCTTTCTCTGCTCCTGG + Intronic
1034856602 7:154554528-154554550 CATATGTATTTATCTACTACAGG + Intronic
1043235660 8:77862329-77862351 CATATGTCTTTATCTGGTTCTGG - Intergenic
1043420578 8:80094103-80094125 CATATAATTTTATTTATTCCAGG + Intronic
1043605618 8:81995099-81995121 CATTTATTTTTATGTACTACAGG - Intergenic
1044556997 8:93573779-93573801 TATATATCTTTATCTAATTTGGG - Intergenic
1044813484 8:96087468-96087490 CATATATCTTAATTTTTTCCTGG + Intergenic
1046653517 8:116867669-116867691 CATATATCATTTTCTAGTCGTGG - Intronic
1047180848 8:122586323-122586345 CATCCATCTCTATCTGCTCCTGG + Intergenic
1047768234 8:128007579-128007601 CATACATATTTATCTACACATGG + Intergenic
1050092600 9:2030180-2030202 CATATATCTCTATCTCCTATTGG - Intronic
1051088428 9:13378969-13378991 TATATATCTATATATGCTCCAGG + Intergenic
1051681288 9:19610598-19610620 AATATATCTCTCTCTAGTCCTGG - Intronic
1053162090 9:35820116-35820138 CAGGTATCTTTATCTCCACCTGG + Intronic
1053453383 9:38212017-38212039 CATATATTTTAATCCTCTCCTGG - Intergenic
1055274103 9:74594875-74594897 CATTCATCTTTCTCTACACCAGG + Intronic
1059938758 9:119337412-119337434 CATATACCTGTATTTCCTCCTGG - Intronic
1185907402 X:3948487-3948509 TATATAACTTTATCTTCCCCAGG - Intergenic
1186318220 X:8394329-8394351 CATGTAACTTAATATACTCCTGG + Intergenic
1187261744 X:17691104-17691126 CATATATCTTTCTTTGCTCTAGG - Intronic
1189352777 X:40289204-40289226 CATTTACCTTTATCTTCTCCAGG + Intergenic
1193248666 X:79262083-79262105 CATATATATTTTTCTAATCAGGG + Intergenic
1195157355 X:102137484-102137506 CATATACTTTAATCTACTACTGG + Intergenic
1196896147 X:120338211-120338233 CATATATATTAATCTGCTTCAGG - Intergenic
1197594650 X:128451037-128451059 CAGATAGCTTTCTCTAATCCTGG + Intergenic
1201893938 Y:18973548-18973570 CATATAACTCTATCTTCCCCAGG + Intergenic