ID: 923109025

View in Genome Browser
Species Human (GRCh38)
Location 1:230876371-230876393
Sequence CATTGAGCCCACTGCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923109023_923109025 22 Left 923109023 1:230876326-230876348 CCGGAATGAGGGGTGGGAAGTAG No data
Right 923109025 1:230876371-230876393 CATTGAGCCCACTGCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923109025 Original CRISPR CATTGAGCCCACTGCTCCTG TGG Intergenic
No off target data available for this crispr