ID: 923111840

View in Genome Browser
Species Human (GRCh38)
Location 1:230897179-230897201
Sequence CAGTGGAATAATACAGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923111840_923111844 4 Left 923111840 1:230897179-230897201 CCAGAAACTGTATTATTCCACTG No data
Right 923111844 1:230897206-230897228 GTTTTTATGTGTTTGTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923111840 Original CRISPR CAGTGGAATAATACAGTTTC TGG (reversed) Intergenic
No off target data available for this crispr