ID: 923114001

View in Genome Browser
Species Human (GRCh38)
Location 1:230917323-230917345
Sequence TGGCTGAGTCCCAGCCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 1, 2: 7, 3: 23, 4: 307}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923114001 Original CRISPR TGGCTGAGTCCCAGCCAGCA GGG Intronic
900080235 1:851341-851363 GGGCTGAGTCTCAGCCAGCAGGG + Intergenic
900295394 1:1946686-1946708 TGGCCGTGTCCCAGCCAGGGAGG + Intronic
900612226 1:3549022-3549044 AGGCGGGGTCCCAGCCAGCATGG - Intronic
900622230 1:3592716-3592738 TGGCTGGGTCCCAGCAAGTGAGG - Intronic
900986432 1:6075658-6075680 CGGCTCAGTCCGAGCCAGCAGGG + Intronic
902043801 1:13511031-13511053 TGGCTTTGTCTCAGCCAGTAGGG - Intronic
902159549 1:14519091-14519113 TCCCTGAGTCCCATTCAGCATGG + Intergenic
902660892 1:17902779-17902801 TGGCTGTCTGCAAGCCAGCAAGG + Intergenic
902870148 1:19309070-19309092 TCCCAGAGTCCCAGCCAACAAGG + Intronic
903321462 1:22545898-22545920 TGACTGAGTGCCAGCCTGTATGG + Intergenic
903552196 1:24165657-24165679 TCCCTGATTCCCAGCCAGCAGGG + Intronic
903858489 1:26351246-26351268 GGGCAGAGTCCCAGCGAGGAGGG - Intronic
904791986 1:33029536-33029558 TGCCTGAGTCCCAGCTACCTGGG - Intronic
904840530 1:33369204-33369226 TGTCTGAATCCCATCCTGCAGGG + Intronic
905163606 1:36061154-36061176 AAGCTGAGTCCCAGGAAGCAGGG + Exonic
905812803 1:40925407-40925429 TGTCTATGTTCCAGCCAGCAGGG + Intergenic
907131376 1:52100330-52100352 TGCCTGAGTCCCAGCTATTAGGG - Intergenic
907214546 1:52851167-52851189 TGCCTGAGTCCCAGCTACCTGGG - Intronic
909559404 1:76992823-76992845 CGTCTGTGGCCCAGCCAGCAAGG - Intronic
912702885 1:111891393-111891415 TGTCTGAGTGCCAGCCTGAATGG + Intronic
915062696 1:153199382-153199404 TGGCCAACACCCAGCCAGCAGGG + Intergenic
915934099 1:160080673-160080695 TGGGTGAGTCCCTGCCCACAAGG - Intergenic
916867846 1:168879462-168879484 TGGCTGGGTCACAGAGAGCAAGG - Intergenic
918382330 1:183968714-183968736 TGGATGCGTTTCAGCCAGCAAGG - Intronic
922194319 1:223346508-223346530 TGGCTGAGTGCCCCCCAGCCTGG + Intronic
923114001 1:230917323-230917345 TGGCTGAGTCCCAGCCAGCAGGG + Intronic
924878942 1:248136981-248137003 TTCCTCAGTCCCACCCAGCACGG + Intergenic
1062908845 10:1199354-1199376 TGGCTGTGTGCCAGGCAGCCCGG + Intronic
1063936363 10:11082740-11082762 TGGCTTACTCACAGACAGCATGG - Intronic
1064255237 10:13737893-13737915 TAGCTCAGGCCCAGCCACCATGG + Exonic
1064350418 10:14571094-14571116 TGGCTGTGTGCCAGTCAGGAAGG - Intronic
1065116547 10:22488709-22488731 TGCCTTAGTCCCAGCCACCTGGG - Intergenic
1067083409 10:43225981-43226003 GGGCTGGGTCCCAGCCCGGAAGG + Intronic
1067688302 10:48481088-48481110 TGCCTGAGCCCCGGCGAGCAGGG - Intronic
1067745831 10:48934961-48934983 TGCCTGAGCCCCAGTCAGGAAGG - Intronic
1068212752 10:53942619-53942641 TGGCTGACTAACAGCCAGCAAGG + Intronic
1069124701 10:64615840-64615862 TGGGAGAGTCCCACCCTGCAGGG - Intergenic
1069430818 10:68332480-68332502 TGGCGGAGGCCAAGCCAGCAGGG - Intronic
1069815454 10:71191117-71191139 ATGCTGAGTTCCATCCAGCAGGG - Intergenic
1070195363 10:74151522-74151544 TGGCTGAGTCCCCGCCTGTCTGG + Intronic
1070700819 10:78600437-78600459 TGGCTGAGTCCCAGCATGCCTGG - Intergenic
1071027658 10:81135661-81135683 AGGCTGAGGCCCACCAAGCAGGG - Intergenic
1071819466 10:89265017-89265039 TGGAGGAGGCCCAGGCAGCAGGG + Intronic
1071896833 10:90076720-90076742 TAGATGAGTCCCAGCCAGAGGGG - Intergenic
1072036272 10:91565745-91565767 TGGTGGGCTCCCAGCCAGCAGGG + Intergenic
1072445857 10:95497856-95497878 TGAATGGGTCCCAGCCATCAAGG - Intronic
1073122929 10:101133038-101133060 TGGCTGCTTCCCAGCCCGGACGG - Intronic
1074426436 10:113355622-113355644 TGACTGAGTCCCATCTTGCAAGG + Intergenic
1074603533 10:114938345-114938367 TGGCTGCGACCCCGTCAGCAAGG + Exonic
1075949322 10:126463325-126463347 GGGCTGAGGCCCAGCCGGCAAGG - Intronic
1076116504 10:127905462-127905484 TGGAGGAGTCCCAGGCAGGAAGG + Intergenic
1076163219 10:128262013-128262035 TGGCTGGGTCTCAGGAAGCAAGG + Intergenic
1077303776 11:1858825-1858847 TAGCCGTGTCCCACCCAGCACGG + Intronic
1077544325 11:3162661-3162683 TGGCCAAGACCCAGCCACCAAGG + Intronic
1077919507 11:6632149-6632171 TGGCTGAGAACCAGCCCCCAGGG - Exonic
1078106389 11:8360705-8360727 ATGCTGGGTGCCAGCCAGCAAGG - Intergenic
1079100995 11:17542398-17542420 TGGCTGTCTCCAAGGCAGCAGGG + Intronic
1082086594 11:48055331-48055353 TGGCTGAATGCCTGCAAGCATGG + Intronic
1083170755 11:60922793-60922815 TGCCTTAATCCGAGCCAGCAGGG + Exonic
1083822986 11:65182979-65183001 TAGCCGAGTCCCACCCAGGATGG - Intronic
1084383663 11:68828939-68828961 TGGCTGACTCCCAGGGTGCAGGG - Intronic
1084422673 11:69068171-69068193 TGGCTGTGGCCCAGCCACCCTGG + Intronic
1085409637 11:76283473-76283495 TGTCTGAGTGCCAGGCAGCCAGG - Intergenic
1085904802 11:80747534-80747556 TGGCAGAGGCCAAGTCAGCAAGG - Intergenic
1087325208 11:96713163-96713185 TGGCAGATGCCCAGCCATCAAGG - Intergenic
1088797217 11:113274122-113274144 AGGCTGAGTCCCTACCAGAAAGG + Intronic
1089083038 11:115793478-115793500 TTGGTGAGTCCCAGAGAGCAAGG - Intergenic
1089350558 11:117819494-117819516 TGGGTGGGTCCCTGCCTGCATGG + Intronic
1089631046 11:119784470-119784492 TGGGTGGGCCCCAGCCACCATGG - Intergenic
1089861192 11:121591252-121591274 CAGCAGAGTCCCAGACAGCAGGG - Intronic
1090201556 11:124861437-124861459 GGGCAGCGACCCAGCCAGCAGGG - Intergenic
1090852048 11:130579214-130579236 TGGCTCAATGCCAGCCTGCAGGG + Intergenic
1091019671 11:132087971-132087993 TGGCTCATTCCCATCCTGCATGG + Intronic
1091662284 12:2393352-2393374 TGGTGGAGGGCCAGCCAGCAGGG - Intronic
1091677051 12:2499156-2499178 TGCCCGTGTCCCAGCAAGCAAGG + Intronic
1094391145 12:29951456-29951478 TGGCTGAATCCCAATAAGCAGGG - Intergenic
1094663285 12:32493107-32493129 TGTCTGGGTCACAGCCAGGAAGG + Intronic
1095710918 12:45287030-45287052 TGGCTGAATCCCAACCACCTAGG - Intronic
1096618505 12:52848036-52848058 GGGTTGAGTGGCAGCCAGCAGGG - Exonic
1097167533 12:57093720-57093742 TGGCTGGGCTCCAGCCAGCCAGG + Intronic
1097719604 12:63005619-63005641 TGCCTGAGTCCCAGAAAACATGG - Intergenic
1098801231 12:74960797-74960819 TGGCTGAAGCCCAGACATCATGG - Intergenic
1099607732 12:84827016-84827038 AGGATGAGTCCCAGCCAGGGTGG - Intergenic
1101764207 12:107683258-107683280 CAGCTGAGACCCAGCCATCATGG - Intergenic
1102257462 12:111424579-111424601 TGACAGAGCCCCAGCCAGCCAGG - Intronic
1102405143 12:112666875-112666897 TGACTGATTTCCAGTCAGCAAGG + Intronic
1102947764 12:117004978-117005000 AGGCTGAGTCTTATCCAGCATGG + Intronic
1103325425 12:120116934-120116956 TGACGGAGTCCCAGCAAGCGCGG + Intronic
1103383567 12:120514091-120514113 TGGCTGAGTACCAGAGAGAAGGG + Intronic
1103437662 12:120939370-120939392 TGGCTAAGTCCCGTCCAGCTTGG + Intergenic
1103624371 12:122206944-122206966 GGGCTGGGTCCCAGCCATCCAGG - Exonic
1103955276 12:124572913-124572935 TGGGTGATTCCCACCCAACATGG + Intergenic
1104371756 12:128229620-128229642 AGGTTCAGTCCCAGGCAGCATGG + Intergenic
1104642952 12:130479088-130479110 GGGCTGAGTCAGAGCCAGCTTGG - Intronic
1104738463 12:131154575-131154597 GGGCTGAGCCACAGCCAGGAGGG - Intergenic
1105624904 13:22103277-22103299 TGGCTACTTCCCAGCCAGCACGG + Intergenic
1105810503 13:23991084-23991106 TGGCAGAGTCCCAGGCAGGGCGG + Intronic
1106184416 13:27396525-27396547 TGGCTGATTCCAAGCCACCACGG + Intergenic
1106413489 13:29526934-29526956 TGGCAGGGTCACAGTCAGCAGGG - Intronic
1107718304 13:43222163-43222185 TGACTGAATCCCATCCAGAAAGG + Intronic
1107940133 13:45375925-45375947 TGGCACCATCCCAGCCAGCATGG + Intergenic
1108925048 13:55731763-55731785 TGGCTCAGTCCTAGTCAGAAAGG - Intergenic
1110784986 13:79513127-79513149 TGGTTGGTACCCAGCCAGCATGG - Intronic
1112875621 13:104034815-104034837 TTGCTGTGTCCCAGCTAACAGGG + Intergenic
1113460699 13:110479983-110480005 TGGCGGGGTGCCAGCCAGCATGG - Intronic
1113529638 13:111012935-111012957 TAGCTGAGGCCCAGACATCATGG - Intergenic
1113788103 13:113013449-113013471 TGGCAGGGCCGCAGCCAGCACGG + Intronic
1116102907 14:40464766-40464788 TGGCTCAGTCCCACCCTGCATGG - Intergenic
1117065106 14:52005642-52005664 TGGCAGTGTCACAGGCAGCAGGG + Exonic
1117845490 14:59907143-59907165 AGACTGAGTCCTAGCCAGAAAGG - Intergenic
1118053727 14:62056821-62056843 CGGCGGAGTCCCAGCTTGCAGGG + Intronic
1118819167 14:69333928-69333950 TGGCTGCTTCCCTACCAGCAAGG + Intronic
1119136164 14:72222458-72222480 TGGCTCTGTCCCACCCTGCATGG - Intronic
1119429368 14:74555823-74555845 TGGCTGACTCCCAGACATGAAGG + Intronic
1120028102 14:79608643-79608665 TGGCTGTGGTCCAGCCAGCCTGG + Intronic
1121511146 14:94514436-94514458 TAGGTGAGTCACAGCCACCAGGG - Intronic
1122231693 14:100309263-100309285 TGCATGATTCCCAGGCAGCAGGG - Intergenic
1122604543 14:102939525-102939547 TGGGACAGTCTCAGCCAGCATGG + Intronic
1122948953 14:105030115-105030137 GGCCTGAGCCCCAGCCACCAGGG - Intergenic
1123035154 14:105468963-105468985 TGGCTGGGCCCCAGCCACCCTGG - Intronic
1123816674 15:23986734-23986756 TAGCTGAGTGTCACCCAGCATGG - Intergenic
1124239890 15:28020167-28020189 AGCCTGAGTCCCTCCCAGCAGGG - Intronic
1126386194 15:48095837-48095859 TGACTCAGCCCCACCCAGCAGGG - Intergenic
1126686114 15:51250378-51250400 TGGCTGACTACCAGCAAGCCTGG + Intronic
1126849192 15:52787279-52787301 GGGCAGAGTCTCAGCCAGCGCGG + Intronic
1126900360 15:53308425-53308447 TGGCTGAGTCAAAACAAGCAAGG + Intergenic
1128333942 15:66774130-66774152 TGGCTGAGTCCAAGGCAGTCTGG + Intronic
1129359429 15:75015390-75015412 TCACTGAGTCACGGCCAGCAGGG - Intronic
1129517707 15:76166627-76166649 TGGCTGAGTCCCACCCTGGCCGG + Intronic
1130032598 15:80329098-80329120 TGCCTTAGTCCCAGACAGTACGG - Intergenic
1130171340 15:81518092-81518114 TGGGAGAGTCCCAGACATCAGGG + Intergenic
1130541061 15:84821159-84821181 TAGCTGTGGCCCAGCCAGCAGGG + Intronic
1132022309 15:98373247-98373269 GGGCTCAGCACCAGCCAGCAAGG - Intergenic
1132208587 15:100003426-100003448 GAGCTGAGTCTCAGTCAGCAGGG + Intronic
1132602378 16:779456-779478 AGGCTGGGTCCCAGCCGGCCGGG + Intronic
1132673675 16:1112981-1113003 TGGCTGAGGCTCAGCCACCCTGG - Intergenic
1132689775 16:1177283-1177305 GGGCTGAGGCCCGGGCAGCAGGG - Intronic
1133304375 16:4800465-4800487 TGGCTGAGCACTAGCCAGGAGGG + Intronic
1134313832 16:13099994-13100016 CTGCTGAGTCCCATCCAGCCTGG - Intronic
1136289028 16:29260557-29260579 TGGATGGGCCCCAGGCAGCAGGG + Intergenic
1136666745 16:31819437-31819459 TGGGCGGGTCCCAGCCAGCGAGG + Intergenic
1137594749 16:49716196-49716218 TGGCTGAGGGGCAGGCAGCAGGG - Intronic
1140034931 16:71364623-71364645 GGGCTGAGTCCCAGGCATGAGGG - Intronic
1140475377 16:75237190-75237212 GGGCTGCTTCCCAGCCAGTATGG - Exonic
1140479189 16:75253365-75253387 TGCCTGGGGCCCTGCCAGCAGGG - Intronic
1140687115 16:77444114-77444136 TGGCTGACTTCCAGTCAGCCTGG - Intergenic
1142094760 16:88233484-88233506 TGGATGGGCCCCAGGCAGCAGGG + Intergenic
1142314352 16:89334273-89334295 GGGTTGACTCCCAGTCAGCAGGG - Intronic
1143111371 17:4554823-4554845 TGGCAGGGTCCCAGCCATCCAGG - Intronic
1143125299 17:4638107-4638129 TGGCTTGCTGCCAGCCAGCAAGG - Intronic
1143403205 17:6659002-6659024 TGGCTTGCTGCCAGCCAGCAAGG + Intergenic
1144957860 17:19028498-19028520 TTGCTGAGTCCCAGCTAGACTGG - Intronic
1144977298 17:19146022-19146044 TTGCTGAGTCCCAGCTAGACTGG + Intronic
1145275414 17:21426424-21426446 TGCCTTAGTCCCTGCCAGGAGGG - Intergenic
1145313266 17:21712318-21712340 TGCCTTAGTCCCTGCCAGGAGGG - Intergenic
1145793446 17:27642416-27642438 TGGCTTGGGCCCACCCAGCAGGG - Intronic
1146619871 17:34389025-34389047 TGGATCAGTCCCTGCCACCACGG - Intergenic
1146686912 17:34847255-34847277 AGGCTGAGCCCCAGCAAGGAAGG + Intergenic
1148536375 17:48442475-48442497 TAGCAGAGTCCCAGGCAGGATGG - Intergenic
1149401290 17:56298995-56299017 CATCTGAGTCCCAGCCAACAAGG + Intronic
1151345018 17:73496122-73496144 ACGCTGACTCCCACCCAGCAGGG - Intronic
1152557929 17:81063864-81063886 TGGCTCATTCCCAGAGAGCAGGG - Intronic
1153610248 18:6877474-6877496 TGGCTGAGCCACATCCAGAAGGG + Intronic
1154064703 18:11096154-11096176 TGGCTGAGACACCGCCAGCCTGG + Intronic
1155320869 18:24617679-24617701 TGGCTGAGACCCAGCCAGGTGGG - Intergenic
1157177632 18:45465778-45465800 TGGCTGTCTCTCAGCCAGCCAGG - Intronic
1157598365 18:48877645-48877667 TAGCTGAGTTCCTGCCATCAGGG - Intergenic
1157813776 18:50716735-50716757 AGGCTGAGGCCAAGACAGCATGG - Intronic
1159102468 18:63971132-63971154 AGACTGAGACCCAGCCATCAGGG - Intronic
1160994317 19:1875634-1875656 CGGCGGAGTCCCAGCTCGCAGGG + Intergenic
1161152049 19:2714684-2714706 GGGCGGAGTCACAGCAAGCATGG + Exonic
1162618601 19:11821702-11821724 TCACTGTGTTCCAGCCAGCACGG + Intronic
1162974008 19:14198119-14198141 TGGCTGGGGCCCTGCAAGCAAGG + Intronic
1163600066 19:18243710-18243732 TGGCTGGGTCCCAGGAATCAGGG - Intronic
1163619402 19:18349304-18349326 TAGCTGAGTCCCAGCTACCCAGG - Intronic
1167116816 19:47493255-47493277 TGGCTGTGTCCCAGGCAGGCAGG - Intronic
1167260565 19:48455569-48455591 AGCCTGAGTCGCAGCCAGCCTGG + Exonic
925178103 2:1798851-1798873 TGGCCGAGGCACAGGCAGCAAGG + Intronic
926616399 2:15001003-15001025 TGTCTGAGTCCAGGACAGCACGG + Intergenic
927216361 2:20669853-20669875 TCGCCGAGCCCCAGCCTGCATGG + Intronic
929189331 2:39124574-39124596 TGGCCGCGTCCTGGCCAGCAGGG - Intergenic
931176327 2:59858658-59858680 GGGCTGAGTCTCAGCCAACGCGG + Intergenic
932815418 2:74857197-74857219 AGGCTGAGTCCCAGAGAGTATGG - Intronic
936428358 2:112437367-112437389 TGGGCGAGTCCCAGCCAGCATGG + Intergenic
937124418 2:119464292-119464314 TGGCTGAGTCCCAGCCCCTCAGG - Intronic
937905432 2:127050670-127050692 TAGGTCACTCCCAGCCAGCAAGG - Intronic
939985740 2:148827899-148827921 TGGCTGACTACAAGCCAGGAAGG + Intergenic
941085507 2:161112724-161112746 TGGGTGACTGGCAGCCAGCATGG - Intergenic
942079298 2:172385141-172385163 TGACTGAGTCGAAGCCAGCTAGG - Intergenic
942165643 2:173238024-173238046 TGCCTGAGTCCCAGCCACCTGGG + Intronic
942827991 2:180203849-180203871 TTGCTGAGACACAGCCAGCCAGG - Intergenic
946172955 2:217906164-217906186 AGGCTGAGGCCCAGCCTGTAAGG + Intronic
946337892 2:219050493-219050515 TGGCTGAGTGCAGGCCTGCAGGG + Intergenic
947977048 2:234375821-234375843 AGGCCGAGTCCCCCCCAGCACGG - Intergenic
948244145 2:236464053-236464075 TCGCTGACTCTGAGCCAGCAAGG + Intronic
948245950 2:236486077-236486099 TGGCTTCGTCTAAGCCAGCAGGG - Intronic
948644058 2:239392828-239392850 TGGCACGGTGCCAGCCAGCAAGG + Intronic
948702858 2:239771325-239771347 TGGATGTGGCCCAGTCAGCAGGG + Intronic
1169477897 20:5949234-5949256 TGCCAGAGTCCCAGCCACTAGGG + Intronic
1170601044 20:17841888-17841910 GAGCTGAGACCCAGCCATCACGG - Intergenic
1172992888 20:39049210-39049232 TGGCAGTGTCCCAGCAAGCCAGG - Intergenic
1173170125 20:40716911-40716933 TGGTTGAGGCACAGCCACCAAGG - Intergenic
1173580987 20:44146360-44146382 TGCCTGGGTCCCAGGCAGCAAGG - Intronic
1176373891 21:6077844-6077866 TGGGCGAGTCCCAGCCAGCATGG - Intergenic
1176666166 21:9689553-9689575 TGGCTGAGGCCCAGCCACATCGG + Intergenic
1178704760 21:34864158-34864180 GGGCTGTGTCCCAGCCGCCATGG - Intronic
1179359231 21:40689957-40689979 TGGCTCAGCCCCAGCCAGTGTGG + Intronic
1179749586 21:43460399-43460421 TGGGCGAGTCCCAGCCAGCATGG + Intergenic
1180174860 21:46082557-46082579 TGGGTGGGTCCCTGCCAGGAGGG - Intergenic
1180618087 22:17141525-17141547 TGGCAGAGTCCCAGCCAGCAAGG - Intronic
1180787889 22:18557184-18557206 TGGCTCACGCCCAGCCAGGAGGG + Intergenic
1181048229 22:20226631-20226653 TGCCTGAGGCCCAGTCAGCCTGG - Intergenic
1181048245 22:20226687-20226709 AGGCTGAGGGGCAGCCAGCAGGG + Intergenic
1181233849 22:21438134-21438156 TGGCTCACGCCCAGCCAGGAGGG - Intronic
1181244801 22:21496709-21496731 TGGCTCACGCCCAGCCAGGAGGG + Intergenic
1181851155 22:25750854-25750876 TGGCGGAGTCAGAGCCAGGAAGG + Intronic
1182575160 22:31268020-31268042 ATGCTCAGTCCCACCCAGCATGG - Intronic
1183574166 22:38676448-38676470 TCCCTGATTCCCAGCCATCACGG - Intergenic
1184893392 22:47393077-47393099 TGGCTCACTCTCAGTCAGCATGG - Intergenic
1185067745 22:48640517-48640539 TGGCTTAGACACAGCCAGCTGGG + Intronic
1185207747 22:49549868-49549890 AGACTGAGTGCCAGCCAGGAAGG + Intronic
950158687 3:10742890-10742912 TGCCTGAGGACCAGACAGCAAGG - Intergenic
950796505 3:15514698-15514720 AGGCAGAGGCCAAGCCAGCAGGG + Intronic
951400764 3:22229424-22229446 TGCCTGAGTTTCAGCCAACAAGG - Intronic
952741095 3:36735796-36735818 TTGCTGTTTCCCAGGCAGCATGG + Intronic
953033134 3:39190874-39190896 AGGCTGAGGCCCAGCCAGTGGGG + Intronic
953406470 3:42662360-42662382 TGGCTGAGACCTAGGCCGCAGGG - Intronic
953415331 3:42712337-42712359 TGGCTGACTCCCAGGGAGGAAGG - Intronic
953679680 3:45029985-45030007 TGGCAGAGCCCCAGCTGGCAGGG - Intronic
954112897 3:48445465-48445487 CGGCTGGGTGCCAGCTAGCAAGG - Intergenic
954337455 3:49928078-49928100 TGGCTGAGTGGTACCCAGCACGG + Intronic
954626986 3:52027721-52027743 TGGCTGGTTCCCAGGCAGCCGGG + Intergenic
954791984 3:53140034-53140056 GGGCTGAGGCCAAGCCAGGATGG - Intergenic
956743246 3:72291387-72291409 CGGCTGAGTCAGAGCCAACACGG + Intergenic
958255649 3:91321753-91321775 TGGCTGAGGCAGAGCCAGCAGGG - Intergenic
959591863 3:108090781-108090803 GGGCTGCGCCCCAGCCAGCCCGG - Intronic
959632176 3:108519079-108519101 TGGCTGAGCTCCAGCCAGCAAGG + Intronic
959887105 3:111515699-111515721 TGTCTGAGCCCCAGCCAAGAAGG + Intronic
960577993 3:119245931-119245953 TGGCTGGCTTCCAGCCAGGAGGG - Intergenic
961649287 3:128409507-128409529 TGGCCCAGACCCAGGCAGCAGGG + Intergenic
966287567 3:178315615-178315637 TGGCTGAGTCCCAGCTACTCGGG + Intergenic
966742721 3:183249371-183249393 AGGGAGGGTCCCAGCCAGCAGGG + Intronic
967990165 3:195124743-195124765 TGACTGTGTCCCGGCCAGCGAGG - Intronic
968570449 4:1337757-1337779 AGGCTGAGTCACAGGCAGGACGG - Intronic
968673842 4:1866430-1866452 TGTCTGAGTCCCAGGAACCAGGG + Intergenic
968819240 4:2837402-2837424 GCGCTGAGCCCCAACCAGCAGGG - Exonic
969717141 4:8873173-8873195 CGGCTGAGGCCTAGCCAGCTGGG + Intergenic
970663069 4:18307859-18307881 TGACCTGGTCCCAGCCAGCAGGG - Intergenic
970959593 4:21856899-21856921 TGGAGGAGTCCAAGGCAGCAGGG - Intronic
971066057 4:23034910-23034932 TGGCTGTGGCCCAGACAGCTGGG + Intergenic
971221049 4:24706284-24706306 TGGCTGTGTCCCAGCTATGAGGG - Intergenic
971244683 4:24917282-24917304 TGGCTGATTGGCAGCCAGCGGGG - Intronic
972510513 4:39764644-39764666 TGCTTGAGTACCAGCCAGCATGG - Intronic
977301417 4:95271885-95271907 TGTCTGAGACCCAGTGAGCAAGG - Intronic
978326602 4:107564460-107564482 TTGCTGGGTACCAGCCACCATGG + Intergenic
978595144 4:110369308-110369330 AGACTGAGTTCCAGCCATCAAGG - Intronic
982361006 4:154519059-154519081 TGGCTGAATGCCTGCCACCATGG + Intergenic
985408857 4:189662783-189662805 TGGCTGAGGCCCAGCCACATCGG - Intergenic
985606992 5:863131-863153 AGTCTGCTTCCCAGCCAGCACGG + Intronic
985721318 5:1490703-1490725 TGGCTGAGCACCAGCCTTCATGG - Intronic
986721361 5:10563637-10563659 TGGGGGAGTCCCAGCCCGGAAGG - Intergenic
987133129 5:14877673-14877695 TGCTTTAGTCCCAGACAGCAGGG - Intergenic
987522057 5:18999417-18999439 TTGCTGAGTCCATGCCAACAAGG + Intergenic
990355608 5:54963304-54963326 TAGCTGAGTCCCAGAGACCATGG + Intergenic
991582699 5:68173348-68173370 TGGAAGAGTCCCAGCCAAAAAGG - Intergenic
992314364 5:75537084-75537106 TTGCTGAGCCCCATCCAGCAAGG + Intronic
992858445 5:80888160-80888182 TGCCTGAGTCCCAGCTACCGGGG + Intergenic
997438305 5:133891019-133891041 TGTCTGAGGCCCAGGCTGCAGGG - Intergenic
997467916 5:134100506-134100528 AGGCTGGGTCCCAGGCTGCAGGG - Intergenic
999255800 5:150209482-150209504 TGACTGGCTCCCAGCCAGCGTGG - Exonic
999397314 5:151238355-151238377 GGGCAGAGCCCAAGCCAGCAAGG + Intronic
1000067976 5:157712918-157712940 TGACTGAGACCTAGCCAGTAAGG - Intergenic
1002081033 5:176737585-176737607 TGGCTGAGGATAAGCCAGCATGG + Intergenic
1002433825 5:179219638-179219660 AGGTTGAGCCCAAGCCAGCAGGG + Intronic
1006192481 6:32218124-32218146 TGGCTGAGCCACAGCCCTCATGG - Intronic
1006375603 6:33670114-33670136 TGGCTGAGCCTTAGCCAGGAGGG + Intronic
1006640096 6:35485421-35485443 CGGCTGAGCCCAAGTCAGCATGG + Intronic
1007114038 6:39330682-39330704 TGGCCTCGTGCCAGCCAGCAGGG - Exonic
1008913177 6:56758560-56758582 TAGCTGAGGCCCAGACATCATGG - Intronic
1011610306 6:89144474-89144496 TGGCTGACTTTCAGCCACCATGG - Intergenic
1012113192 6:95261808-95261830 TCCCTGAGTCCCAGCCACCCCGG + Intergenic
1013192165 6:107812663-107812685 TGCCTGACTCCCTTCCAGCAGGG + Intronic
1015018530 6:128443692-128443714 TAACTGAGTCAAAGCCAGCAGGG + Intronic
1016832617 6:148448527-148448549 TGGCAAAGTCGCAGCCACCAAGG - Intronic
1018028302 6:159822539-159822561 TGGCTGGGCCCCGGGCAGCAGGG - Intergenic
1018224382 6:161614062-161614084 TGCCTGCTTCACAGCCAGCAGGG + Intronic
1019552592 7:1610585-1610607 GGGCTGAGGCCCACCCAGCGAGG + Intergenic
1019614122 7:1951208-1951230 TGGCTGAGCCTCAGGCAGGATGG - Intronic
1019760212 7:2805867-2805889 TGGCTCTGTCCCAGCCACGAGGG + Intronic
1021176884 7:17459626-17459648 AGGCTGGGTCCCAGCTAGAAAGG + Intergenic
1022528900 7:31054784-31054806 TGCCTGAGACCCACCCACCATGG + Intronic
1022888870 7:34675609-34675631 AGGCTTAGTGCCTGCCAGCATGG + Intronic
1022892301 7:34714046-34714068 TGGCTGAGTCTCAGACAGCATGG - Intronic
1022896665 7:34756874-34756896 TGGCTCAGTGCCAGCCACAAGGG - Intronic
1023140415 7:37096562-37096584 TGGCAGAGTCCCAGCTTCCAGGG - Intronic
1024753684 7:52502458-52502480 TGGCTGAGCTCCAGCCTGCCAGG - Intergenic
1025143963 7:56488893-56488915 TGGCTGAGTACCAGAAAGTAGGG - Intergenic
1026836209 7:73641166-73641188 TGCCTTAGTCCCAGCTACCAGGG + Intergenic
1026896832 7:74014181-74014203 TGGCTGGGGCCCAGCCAGGGCGG + Intergenic
1029611294 7:101627873-101627895 TGAGTGGGTCCCAGCCAGCATGG - Intronic
1029965613 7:104736706-104736728 CATCTGAGTCCCAGCCATCAGGG - Exonic
1030114287 7:106051277-106051299 TGGCTGAATCCTAGACAGCAGGG - Intergenic
1030125981 7:106152943-106152965 TAGCTGAGTCTCCGCCATCACGG - Intergenic
1033415636 7:141159059-141159081 TGGCTGAGTCCCTGGATGCATGG - Intronic
1035287642 7:157816426-157816448 TGGCAGAGGCCGAGCCAGCCTGG + Intronic
1035525278 8:307572-307594 GGGCTGAGTCTCAGCCAGCAGGG - Intergenic
1036754191 8:11461565-11461587 TGTCTGAGTTTCAGCCAGCTGGG - Intronic
1037132692 8:15425609-15425631 TGGCCGAGTCTGAGCCACCAGGG + Intronic
1037588171 8:20292358-20292380 TTGCTGGGTGCCAGTCAGCAGGG - Intronic
1037835005 8:22210561-22210583 TGGCTGTATCCCAGGCAGCCTGG + Intronic
1039957962 8:42221793-42221815 TGGCAGAGTCCCATCCAACCCGG + Intergenic
1041539109 8:58962993-58963015 TGGCTGAGGCCCACCCACCTTGG - Intronic
1041959462 8:63596109-63596131 TGGTTGCTTGCCAGCCAGCATGG + Intergenic
1042275070 8:66996173-66996195 TGCCTGAGTCCCAGCCATTCGGG - Intronic
1048255379 8:132901408-132901430 AGGCTATGTCCCAGCCTGCAGGG + Exonic
1048593002 8:135838864-135838886 TGGCTGAGGCACAGCTAGGAAGG - Intergenic
1049282094 8:141754755-141754777 GTGCTGAGTCCTAGCCTGCATGG + Intergenic
1049327896 8:142033313-142033335 TGCCTGAGTCCCTGCCCACAGGG - Intergenic
1049479722 8:142816145-142816167 TGGCTCAGCCCCAGTCTGCAGGG - Intergenic
1049789789 8:144467288-144467310 TGGCTGAGTCCCCTGGAGCAGGG - Exonic
1052988242 9:34503222-34503244 TTCCTGAGTCTCAGCCAGCCTGG - Intronic
1057139242 9:92716809-92716831 GGTCTGAGTCCCAGCCAGGGAGG + Intronic
1057457438 9:95227310-95227332 AGGCTCAGTCCCAGCCAGGTAGG + Intronic
1057962003 9:99465820-99465842 TGCCTGGGTCTCAGCCCGCAGGG - Intergenic
1058652647 9:107191011-107191033 AGGCTGAGTCCCAGAGAACAGGG + Intergenic
1059336803 9:113574293-113574315 AGGCTGAGCCAGAGCCAGCAGGG - Intronic
1059979980 9:119760929-119760951 TGGGTGAGTCCCATCCAGTAAGG - Intergenic
1060236670 9:121868516-121868538 TGGTTGAGTTCCAGGCAGAAAGG - Intronic
1060414084 9:123418626-123418648 AGGCTGGCTCCCAGGCAGCAGGG - Intronic
1061652398 9:132061312-132061334 TGTCTCAGTCTCAGCCAGCATGG + Intronic
1062295301 9:135822061-135822083 GAGCAGAGTCCGAGCCAGCATGG - Exonic
1203659932 Un_KI270753v1:32208-32230 TGGCTGAGGCCCAGCCACATCGG - Intergenic
1186797414 X:13060268-13060290 AGGCCGAGTCCCAGTCAGCTTGG - Intergenic
1186992817 X:15087853-15087875 AGGCTGAATCCAAGCAAGCAAGG + Intergenic
1189771963 X:44436226-44436248 TGGAGGAGTCCCAGCCTGCTTGG + Intergenic
1189880855 X:45490755-45490777 TGGCTGAGTCCCAGTAAGAATGG - Intergenic
1190984076 X:55484921-55484943 TCTCTGAGCCCCAGCCTGCAGGG - Exonic
1197701745 X:129605011-129605033 TTGCTGAGTCCCACCAAGAATGG + Intergenic
1199850387 X:151721727-151721749 AGGCTGACTCCCAGCCCTCAAGG + Intronic