ID: 923114167

View in Genome Browser
Species Human (GRCh38)
Location 1:230918872-230918894
Sequence TCTCATCTACTATAGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923114166_923114167 -2 Left 923114166 1:230918851-230918873 CCTAAATTTTACATGAATCAATC 0: 1
1: 0
2: 4
3: 29
4: 332
Right 923114167 1:230918872-230918894 TCTCATCTACTATAGCTGCAAGG 0: 1
1: 0
2: 1
3: 17
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923114167 Original CRISPR TCTCATCTACTATAGCTGCA AGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
902143758 1:14379309-14379331 TCTCAGCTACTATGGCTACAGGG + Intergenic
903591452 1:24459003-24459025 TGTCTTCTACTTTAGCAGCAGGG + Intronic
905598787 1:39232586-39232608 TCTCATCCATTGTAGCTGCTGGG + Intronic
908224401 1:62041372-62041394 TCTCATCTCCCACAGCTGCTAGG + Intronic
908464016 1:64373925-64373947 TCTGATCTAGTATAGCTCAAAGG + Intergenic
909627520 1:77734260-77734282 AGTCAACTACTATAGTTGCAAGG + Intronic
911538826 1:99133698-99133720 TCTCATTTCCTGTATCTGCATGG - Intergenic
913684162 1:121215655-121215677 TCTGATCTAAGACAGCTGCAAGG + Intronic
914036001 1:144003270-144003292 TCTGATCTAAGACAGCTGCAAGG + Intergenic
914153458 1:145064675-145064697 TCTGATCTAAGACAGCTGCAAGG - Intronic
916518621 1:165543716-165543738 CCTAATCTACTACAGCTCCATGG + Intergenic
919235909 1:194842324-194842346 TCTCATCTGCTGAAGCTGGAGGG + Intergenic
920165445 1:204032377-204032399 TCTCATCTTCTGTAGCTGTAGGG + Intergenic
920368497 1:205461691-205461713 TTTCATCTATTACAGCTGCAGGG - Intergenic
920471466 1:206234147-206234169 TCTGATCTAAGACAGCTGCAAGG + Intronic
921792316 1:219304271-219304293 TAGCATCTACTATAAATGCATGG - Intergenic
923114167 1:230918872-230918894 TCTCATCTACTATAGCTGCAAGG + Intronic
1067392851 10:45881081-45881103 TCACATCTACAATAAATGCATGG + Intergenic
1067861173 10:49850204-49850226 TCACATCTACAATAAATGCATGG + Intronic
1069109224 10:64424556-64424578 TCACATAGAGTATAGCTGCATGG - Intergenic
1072084247 10:92062896-92062918 TCTCATCTCCTTTGCCTGCAAGG - Intronic
1073817937 10:107228094-107228116 CCTCATCTTCTGTAGCTGAAGGG + Intergenic
1077950161 11:6948251-6948273 TCTCACCTACTATGGCATCAAGG + Intronic
1078203702 11:9209265-9209287 TCTCATCTAAAATGGCTGTAAGG + Intronic
1078294037 11:10047370-10047392 TCTTGTCTACTATAGCTTCCTGG - Intronic
1080152458 11:29069421-29069443 TCTCATTTTTTATAGCTGCATGG - Intergenic
1081725540 11:45325120-45325142 TCTCATCTAAAACAGCTGTAGGG + Intergenic
1081801508 11:45862867-45862889 TCTCTGCTCCTCTAGCTGCAGGG - Intronic
1087347321 11:96988495-96988517 TTTTATTTCCTATAGCTGCAGGG + Intergenic
1087536857 11:99458846-99458868 GCTCATCTACTAGACCTCCAAGG - Intronic
1087914766 11:103797380-103797402 TCAAGTCTACTATAGCTTCATGG + Intergenic
1090247664 11:125228343-125228365 TTTCATCCTCTATAGCTGCATGG - Intronic
1092747111 12:11683587-11683609 TCTCATTTAACATAGCTTCATGG + Intronic
1095590338 12:43896192-43896214 CCTCATACACTATTGCTGCAAGG - Intronic
1095951557 12:47784465-47784487 TCTCATCCCCTGTGGCTGCAAGG + Intronic
1098584103 12:72135951-72135973 GCTCTTCTACTTTTGCTGCATGG + Intronic
1098591141 12:72214866-72214888 TCTCCTGTGCTATAGCAGCAAGG + Intronic
1098644985 12:72887975-72887997 TCACAACTATTATAACTGCATGG - Intergenic
1100110541 12:91236455-91236477 TATCATCTACTAGAACTCCAAGG - Intergenic
1100788672 12:98106676-98106698 TCTCATCTATAACAGCTGCCTGG + Intergenic
1101853703 12:108424790-108424812 CCTCATCTTCTGTAGCTGGAAGG - Intergenic
1102212012 12:111134072-111134094 TCTAATCTCCTGTAGCTGCAGGG - Intronic
1109947687 13:69459205-69459227 TGGCATCTACTATAGCTGGAAGG - Intergenic
1111060159 13:83007425-83007447 TCACATGTCCTATAGCTACAAGG + Intergenic
1113309312 13:109114780-109114802 TCTCCTTTACTTTACCTGCATGG + Intronic
1115740197 14:36379289-36379311 TCTCATTTCCTACAGCTGGAGGG - Intergenic
1116420395 14:44725616-44725638 CCTGATCTACAATATCTGCAGGG - Intergenic
1118907938 14:70036440-70036462 CCTCCTCTCCTATAGCTGCAGGG + Intergenic
1122305798 14:100765674-100765696 TCTCATCTCCTGCAGCTGGAGGG - Intergenic
1123766503 15:23483909-23483931 TCTCATCTGCAGTAGCTACAGGG - Intergenic
1124452539 15:29809415-29809437 TCTCAACCAATAAAGCTGCAAGG + Intronic
1127450357 15:59110504-59110526 TGTCATCTGCTTTATCTGCAGGG + Intronic
1127534329 15:59875723-59875745 CATCATTTTCTATAGCTGCATGG - Intergenic
1133324515 16:4935162-4935184 TCCCATCCTTTATAGCTGCAGGG - Intronic
1135388377 16:22066076-22066098 TCACAGCTACTATAGCTGTGAGG - Intronic
1146739830 17:35274044-35274066 CCTCATCCTCTATAGATGCAGGG + Intergenic
1153262071 18:3234103-3234125 TCTCATTAACATTAGCTGCAAGG - Intergenic
1158765210 18:60442754-60442776 TCTCATTCACAATTGCTGCAAGG - Intergenic
1159729766 18:72011097-72011119 TCTCACTTACCCTAGCTGCAAGG - Intergenic
1160593552 18:79958756-79958778 TCACACCTACAAAAGCTGCATGG + Intergenic
1162849670 19:13421219-13421241 TCTCTCCTATAATAGCTGCAAGG - Intronic
1165352986 19:35286713-35286735 GCTCATCTGCTATACCTGGATGG + Intergenic
1167083197 19:47291233-47291255 TCTATTCTACTATAGCTGAGGGG - Intronic
925037310 2:698525-698547 TGTATTCTACTATTGCTGCATGG + Intergenic
926408647 2:12579502-12579524 TCTCATCTCCTTTAACAGCAGGG + Intergenic
927503826 2:23600423-23600445 ACTCAGCGACTGTAGCTGCAAGG + Intronic
928054076 2:28033381-28033403 TCTCAACTTCTATAACTGTAAGG - Intronic
931263176 2:60638014-60638036 TCTGACCTGCTATAGCTGCTTGG - Intergenic
936000984 2:108830121-108830143 TTTCATTTACAATAGCTTCAGGG - Intronic
936232742 2:110718444-110718466 TCTTATCTCCTGTAGCTGCATGG + Intergenic
936824437 2:116563957-116563979 TCTCATTTTCCTTAGCTGCAGGG + Intergenic
939271120 2:139940857-139940879 TCTCATCTATTATATCTCCCTGG + Intergenic
939293820 2:140230681-140230703 TATCATCTAAAGTAGCTGCAGGG + Intergenic
940267362 2:151852995-151853017 TTTCATCTACTATAACCACAGGG + Intronic
941386548 2:164859375-164859397 TCTCCACTACTATTGCTGCAGGG + Intergenic
943212110 2:184980193-184980215 CCTCATCTCCTGCAGCTGCAGGG + Intergenic
943718913 2:191182435-191182457 TCTTATCTACTGCAGCTGCAGGG - Intergenic
944605938 2:201351368-201351390 TCTCATCTACTGCACCTGCTGGG - Exonic
947247601 2:228066730-228066752 TCTCAGCTACTAGAGCTGTTTGG + Intronic
1170771318 20:19335297-19335319 TCTTTTCTACTTTAGCTGGATGG + Intronic
1172057621 20:32165321-32165343 TCTCCTCTACTTTGGCTACACGG + Exonic
1172792965 20:37518988-37519010 CCTTATCTGCTATAGCTGCTGGG - Exonic
1180567317 22:16683333-16683355 TCTCATTTACAATAGCAACAAGG + Intergenic
1183430074 22:37760458-37760480 TCACATCTACTGTATCCGCATGG - Intronic
1184049940 22:41997002-41997024 TCTCAGCTGTTATTGCTGCAGGG + Exonic
949500022 3:4670912-4670934 TCTCAGCTACTACAGGTGCGTGG + Exonic
952834704 3:37592906-37592928 TTTTCTCCACTATAGCTGCAAGG - Intronic
953269045 3:41422095-41422117 TCTCCTTTTCTGTAGCTGCAGGG - Intronic
955593170 3:60559722-60559744 TCTCATCTTCTAGAGCTGGGAGG - Intronic
955790258 3:62581876-62581898 TTTCATCTTTTATATCTGCATGG - Intronic
962044634 3:131742438-131742460 TCTCAGCTTCCATAGTTGCACGG + Intronic
967515713 3:190366129-190366151 TCTCATTTCCCACAGCTGCAGGG - Intronic
968391697 4:198229-198251 TCTCATCTGCCATGGCTGCCTGG + Intergenic
968403415 4:317709-317731 TCTCATCTGCAATGGCTGCCTGG - Intergenic
968405242 4:335367-335389 TCTCATCTGCAATGGCTGCCTGG + Intergenic
972651964 4:41026611-41026633 TCTCATTTACTGTATCTTCAAGG + Intronic
975244072 4:72098319-72098341 TCTCAACTAATACAGCTCCACGG - Intronic
975740993 4:77428788-77428810 CTTTATCTGCTATAGCTGCAGGG + Intronic
976854661 4:89589499-89589521 TCACATCTACCAGAGCTGTAAGG - Intergenic
978664986 4:111171995-111172017 TCTTATCTCCTATAGCCACAAGG + Intergenic
983380358 4:166983550-166983572 TCTAGTGTTCTATAGCTGCATGG + Intronic
983956234 4:173702054-173702076 TCCCATGTACTAAAGTTGCAGGG - Intergenic
985965493 5:3336269-3336291 TCTCATCTACAAAACGTGCATGG - Intergenic
990346108 5:54873328-54873350 TCTCATCTTCTATAGCAGGAGGG + Intergenic
991256689 5:64622052-64622074 CCTCATCTTCTGTAGCTGGAGGG - Intergenic
991939448 5:71836565-71836587 TCTCAGATACTATGGCTTCAGGG - Intergenic
992901531 5:81301706-81301728 TCTCAGCCACCAAAGCTGCAGGG + Exonic
994127683 5:96187371-96187393 TCTTATCTTCTATAGCTTCAGGG + Intergenic
995831074 5:116357053-116357075 TCACATCTACTCTATCTGCCTGG + Intronic
996634546 5:125674155-125674177 CCTCATCCACTATAGCTGGAGGG + Intergenic
996982868 5:129520788-129520810 TCTCATTTTCTAAATCTGCATGG + Intronic
1000435060 5:161197814-161197836 TCTCAACTTCTAAAGCTGCAGGG + Intergenic
1000910725 5:167018954-167018976 TCTAATCTAATGTAGCTTCATGG + Intergenic
1005575363 6:27184787-27184809 TGACATCTACTATAGCTACTTGG - Intergenic
1006054850 6:31376735-31376757 CCTAATCTCCTGTAGCTGCAGGG - Intergenic
1007696817 6:43739277-43739299 GCTCATTTATTATAGCTACATGG + Intergenic
1008077032 6:47155836-47155858 TCTCATCTTCTATAGCCTAAGGG - Intergenic
1011064503 6:83310824-83310846 TCTCAGCTTCTGTAGCTGCTGGG + Intronic
1012225799 6:96702051-96702073 CCTTATCTTCTGTAGCTGCAGGG + Intergenic
1018080288 6:160253780-160253802 TTACATCTACTGTATCTGCATGG + Intronic
1019934333 7:4244562-4244584 ACTCATTTTCTATCGCTGCATGG + Intronic
1022482979 7:30756078-30756100 TCGCATCTAAGATAGCTGTAAGG - Exonic
1024492239 7:49998318-49998340 TCTTATCTCCTATAGCTGCAGGG - Intronic
1024641086 7:51329217-51329239 TCTCACCAACTAGAGCTGCCAGG - Intergenic
1025809494 7:64866461-64866483 TCTCATCTGCCATGGCTGCCTGG + Intergenic
1025943554 7:66089866-66089888 TCTCATCTACTTCCACTGCATGG - Intronic
1027363091 7:77429610-77429632 GCTCATCTCCTTTAGCTTCAAGG + Intergenic
1030470507 7:109957325-109957347 TCTCATCTCCCATAACTGAAAGG + Intergenic
1030798792 7:113823676-113823698 TCTCATCTATAGAAGCTGCAGGG - Intergenic
1038114388 8:24536757-24536779 TCTAATATTCTTTAGCTGCATGG - Intergenic
1038294814 8:26281539-26281561 TCACATCTATTATATCTGTATGG - Intergenic
1041524682 8:58792055-58792077 TCTCTTCTTCTAAAGCTGCCAGG - Intergenic
1043466951 8:80518190-80518212 TTTCTTCTACTATAGTTGAATGG + Intronic
1043821345 8:84869153-84869175 TCACATCAACTGAAGCTGCATGG + Intronic
1044634303 8:94307292-94307314 TCTCATTTACTGTAGCTGAGAGG + Intergenic
1044754044 8:95443613-95443635 TCTCACCTTCTATAGAAGCAAGG + Intergenic
1047565105 8:126035384-126035406 CCTTATCTACTGTAGCTGCAGGG - Intergenic
1047892970 8:129333494-129333516 TCTCTGCTACTTTTGCTGCATGG - Intergenic
1048080430 8:131120793-131120815 ACTCATCCAATATCGCTGCAAGG - Intergenic
1048707097 8:137165983-137166005 TCTCATCTCCTGCAGCTGTATGG + Intergenic
1050487571 9:6149941-6149963 CCTCATCTCCTATAGCCACAGGG - Intergenic
1051022900 9:12567155-12567177 ACTCATCTCCTGTAGCTGAAGGG - Intergenic
1052518339 9:29511538-29511560 TTTTATTTTCTATAGCTGCAGGG + Intergenic
1053020386 9:34690223-34690245 TCTCATCAAGGATGGCTGCAGGG - Exonic
1057847670 9:98538158-98538180 TCTCATCTTCAGTACCTGCAAGG + Intronic
1058205440 9:102100325-102100347 TCTCATTTACTACAGCTGGAAGG + Intergenic
1059547866 9:115196919-115196941 TCTGATATACTATACCTGCTTGG - Intronic
1186790172 X:12989878-12989900 TTACATCTACTATATCTGTATGG + Intergenic
1187385384 X:18843895-18843917 TCTTATCTCCTATAGCCACAAGG + Intergenic
1188882701 X:35509645-35509667 TCTCATCTACTGAAGGTGAAAGG + Intergenic
1189665963 X:43355081-43355103 CCTGATCTCCTGTAGCTGCAGGG - Intergenic
1192329863 X:70166574-70166596 TCTCAGAAACTATAGCTGTAAGG + Intergenic
1193398906 X:81019305-81019327 TCTCATTTTTTATGGCTGCATGG + Intergenic
1196088866 X:111717051-111717073 TCTCAGCTACTACAGCAGGAGGG - Intronic
1199198177 X:145057015-145057037 TCTCATCTCCTGCAGCTGAAGGG + Intergenic
1199573788 X:149293206-149293228 TCTCAGTTTCTATAGCTTCAGGG + Intergenic