ID: 923116682

View in Genome Browser
Species Human (GRCh38)
Location 1:230946954-230946976
Sequence GTTTATTTCTGTGCACCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 343}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923116682_923116686 7 Left 923116682 1:230946954-230946976 CCATTAGGTGCACAGAAATAAAC 0: 1
1: 0
2: 2
3: 23
4: 343
Right 923116686 1:230946984-230947006 TGCTACCAGGAATTTCCTCTGGG 0: 1
1: 0
2: 3
3: 12
4: 166
923116682_923116685 6 Left 923116682 1:230946954-230946976 CCATTAGGTGCACAGAAATAAAC 0: 1
1: 0
2: 2
3: 23
4: 343
Right 923116685 1:230946983-230947005 ATGCTACCAGGAATTTCCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 123
923116682_923116687 8 Left 923116682 1:230946954-230946976 CCATTAGGTGCACAGAAATAAAC 0: 1
1: 0
2: 2
3: 23
4: 343
Right 923116687 1:230946985-230947007 GCTACCAGGAATTTCCTCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 157
923116682_923116683 -6 Left 923116682 1:230946954-230946976 CCATTAGGTGCACAGAAATAAAC 0: 1
1: 0
2: 2
3: 23
4: 343
Right 923116683 1:230946971-230946993 ATAAACTCCAAAATGCTACCAGG 0: 1
1: 0
2: 0
3: 12
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923116682 Original CRISPR GTTTATTTCTGTGCACCTAA TGG (reversed) Intronic
900469642 1:2847370-2847392 TTTTCTTTCTGTGCACCCAGTGG + Intergenic
901179586 1:7332079-7332101 GTTGATGTTTGTGCACCAAATGG + Intronic
903754322 1:25650256-25650278 GTTTATTTCTCTGGCTCTAAAGG + Intronic
903990002 1:27260481-27260503 GTTTAATTCTGTGAATCTACTGG + Intronic
907452752 1:54557434-54557456 GTTTTTTTCAGTGCACACAAGGG - Intronic
907616770 1:55934131-55934153 CTTGATTTCTGTGCACCCAGAGG + Intergenic
908118697 1:60965532-60965554 CTTGACTTCTGTGCACCTACAGG + Intronic
908714627 1:67056028-67056050 GTTGATTTATCTGCACCTTAGGG - Intergenic
908866503 1:68554516-68554538 ATTGACTTCTGTGCACCTACAGG - Intergenic
911407849 1:97464666-97464688 TTTGATTTCTGTGCACCTGCAGG - Intronic
912579144 1:110704602-110704624 CTTGATTTCTGTGCACCCACAGG + Intergenic
913094474 1:115503327-115503349 CTTGATTTCTGTGCACCTGCAGG - Intergenic
913242057 1:116837932-116837954 CTTGATTTCTGTGCACCTGCAGG - Intergenic
914380438 1:147111018-147111040 GTTTTTGTCTCTGAACCTAAGGG + Intergenic
916487833 1:165275177-165275199 GTTGAGTTCTGTGCACTTCAGGG - Intronic
918166040 1:181948737-181948759 GTTGACTTCTGTGCACCTGGAGG - Intergenic
919256264 1:195128694-195128716 CTTGATTTCTGTGCACCCACAGG + Intergenic
919473792 1:198010317-198010339 CTTGATTTCTGTGCACCTGCAGG + Intergenic
920594529 1:207255631-207255653 CTTGACTTCTGTGCACCTACAGG + Intergenic
920668739 1:207986540-207986562 CCCCATTTCTGTGCACCTAAAGG - Intergenic
922011086 1:221588195-221588217 CTTGATTTCTGTGCACCCACAGG - Intergenic
923116682 1:230946954-230946976 GTTTATTTCTGTGCACCTAATGG - Intronic
924036572 1:239944039-239944061 CTTGACTTCTGTGCACCGAAAGG + Intergenic
924364512 1:243277032-243277054 TTTTTTATCTGTGCACCTATGGG + Intronic
1065057708 10:21863570-21863592 GTTTATGTCTGTGTACATATTGG - Intronic
1065456325 10:25910271-25910293 CTTGACTTCTGTGCACCTACAGG - Intergenic
1066082224 10:31942713-31942735 GTTTATTTGTGTGAAGCTATGGG - Intergenic
1066554092 10:36592267-36592289 GTTTTTTTATGTGCATTTAAGGG - Intergenic
1068346432 10:55785225-55785247 GGTTATTCCTGTGCCCCAAAGGG - Intergenic
1068663192 10:59645851-59645873 GTTAATTTCTATGCATCTAGTGG + Intergenic
1069644242 10:69980568-69980590 GTTGATATCTGTGCATCTAGTGG - Intergenic
1071163223 10:82777009-82777031 GTTGATATCTGTGCATCTAGAGG + Intronic
1071747680 10:88440426-88440448 TTTTCTTTCTTTGCACCTGAAGG - Intronic
1071970924 10:90906023-90906045 GATTATTTCTGTGCACATTATGG - Intronic
1072827506 10:98622438-98622460 ATTTAATTCTCTGCACCTGAGGG + Intronic
1073643547 10:105276775-105276797 CTTTATTTATGTTCATCTAATGG + Intergenic
1074025242 10:109627239-109627261 CTTGACTTCTGTGCACCTACAGG + Intergenic
1074223626 10:111462232-111462254 TTTTATTTCTGTACACCTGCAGG - Intergenic
1076078919 10:127560246-127560268 CTTAATCTCTTTGCACCTAATGG - Intergenic
1077985039 11:7342894-7342916 CTTTACTTCTGTGCACCCACAGG + Intronic
1078365025 11:10699527-10699549 CTTGACTTCTGTGCACCCAAAGG - Intergenic
1078733901 11:14002304-14002326 ATCTGATTCTGTGCACCTAAGGG + Intronic
1079511492 11:21216178-21216200 CTTGACTTCTGTGCACCTACAGG - Intronic
1079521159 11:21328357-21328379 CTTGACTTCTGTGCACCTACAGG - Intronic
1080448445 11:32358696-32358718 GTTTATTTCTCTCCCCCAAATGG - Intergenic
1082615058 11:55349440-55349462 CTTGACTTCTGTGCACCTACAGG - Intergenic
1085215525 11:74827176-74827198 CTTCACTTCTGTGCACCTACAGG + Intronic
1086995742 11:93353661-93353683 CTTGACTTCTGTGCACCTGAAGG + Intronic
1087211327 11:95448361-95448383 GTTTATTTCCTTGCAGCTATAGG - Intergenic
1087471474 11:98581009-98581031 GTTTATTTCAGTCAACGTAACGG - Intergenic
1088004042 11:104919402-104919424 ATTTATATCTGTGTTCCTAAAGG + Intergenic
1088554669 11:111049535-111049557 GCTTATATTTGTGCAGCTAAAGG + Intergenic
1089364078 11:117910340-117910362 CTGCATTCCTGTGCACCTAATGG - Intronic
1091982731 12:4879509-4879531 CTTGATTTCTGTGCACTTACAGG + Intergenic
1093604972 12:21078306-21078328 CTTTACTTCTGTGCATCTACAGG + Intronic
1093682896 12:22023579-22023601 CTTGACTTCTGTGCACCTACAGG - Intergenic
1095650502 12:44603193-44603215 TTTTTTTTCTGTGCAAATAATGG - Intronic
1098493855 12:71112361-71112383 CTTGATTTCTGTGCACCTGCAGG + Intronic
1098592322 12:72228287-72228309 CTTTACTTCTGTGCAACTAGAGG + Intronic
1098688652 12:73458291-73458313 GGTTATTTCTGTGCACCTTACGG + Intergenic
1098713672 12:73801382-73801404 CTTAACTTCTGTGCACCTGAAGG - Intergenic
1098734217 12:74078036-74078058 CTGTATTTTTATGCACCTAATGG - Intergenic
1099075506 12:78102726-78102748 CTTAATTTCTGTGCACCTGCAGG + Intronic
1099742021 12:86650463-86650485 CTGTGTTCCTGTGCACCTAATGG - Intronic
1099771095 12:87057578-87057600 TTTTATTTCTGTGCACTGTAAGG - Intergenic
1100674885 12:96856012-96856034 CTTTAGTTCTGTGCACCCACAGG + Intronic
1100809312 12:98323022-98323044 GTTTATTTCACTTAACCTAACGG + Intergenic
1102905830 12:116674582-116674604 CTTTTTTTCTGGGCCCCTAAAGG - Intergenic
1103581600 12:121919419-121919441 GTTCATTTCTTTGCACATTAGGG + Intronic
1108099450 13:46938260-46938282 GTTTATTTCTCTGCATTTGAAGG - Intergenic
1108840593 13:54609261-54609283 TTTTATTTCTGTCCAGCTGAAGG + Intergenic
1109749579 13:66672335-66672357 TTTGATTTCTGTGCACCCACAGG - Intronic
1109936213 13:69288389-69288411 GTTTATTTCTATGCAACAAAGGG + Intergenic
1110341963 13:74402571-74402593 CTTAACTTCTGTGCACCTACAGG + Intergenic
1110568803 13:76982550-76982572 GTGTATTTCTGTTCACTGAATGG + Intergenic
1111105734 13:83642934-83642956 CTTGATTTCTGTGCACCCAAAGG + Intergenic
1111196038 13:84875209-84875231 GTTTATGTCCCTGCACATAATGG + Intergenic
1111239659 13:85457689-85457711 CTTTACTTCTGTGCACTTACTGG - Intergenic
1111505475 13:89183766-89183788 CTTGACTTCTGGGCACCTAAAGG + Intergenic
1111594118 13:90389436-90389458 TTTTACTTCTGTGCACCTGCAGG - Intergenic
1111818178 13:93181104-93181126 GTTTATTACTGTGCCCCTTGGGG + Intergenic
1112031360 13:95459468-95459490 ATTAACTTCTGTGCACCTGAAGG + Intronic
1112259320 13:97863842-97863864 CTTGACTTCTGTGCACCTACAGG + Intergenic
1112602096 13:100867414-100867436 ATTTATGTCTGTGCACCTGGTGG + Intergenic
1113645293 13:111990724-111990746 CTTGACTTCTGTGCACCTACAGG - Intergenic
1115160287 14:30386361-30386383 TTTAACTTCTGTGCTCCTAATGG + Intergenic
1115929755 14:38478019-38478041 CTTTATTTCTGTGCACCTGCAGG - Intergenic
1116258636 14:42590837-42590859 GTTTATTTCTGTGCCAATATAGG - Intergenic
1116736095 14:48693854-48693876 GATTATTTCTGTGGACCCAATGG - Intergenic
1118060832 14:62135873-62135895 GTTGACTTCTGTGCACCCACAGG + Intergenic
1118070887 14:62245730-62245752 CTTGATTTCTGTGCACCCAGAGG - Intergenic
1118573395 14:67217873-67217895 GTTGAGTTCTGTGCATCTAATGG + Intronic
1120060686 14:79978768-79978790 CTTGATTTCTGTGCACCTGCAGG - Intergenic
1120247357 14:82022889-82022911 GTATACTTCTGTGTACCTGAAGG - Intergenic
1120392815 14:83929806-83929828 CTTGATTTCTGTGCACCCACAGG - Intergenic
1120443304 14:84564371-84564393 GTTGACTTTTGTGCACCTGAAGG - Intergenic
1120707660 14:87761268-87761290 CTTGATTTCTGTGCACCCACAGG - Intergenic
1121544090 14:94750953-94750975 GTTTAATTCTGGGCACCCCATGG + Intergenic
1121988539 14:98531562-98531584 TTTTCTTTCTGTTCACCTCAGGG - Intergenic
1122765492 14:104066630-104066652 CTTGACTTCTGTGCACCTACAGG + Intergenic
1124853773 15:33367033-33367055 ATTTATTTCAGTGCTGCTAAAGG + Intronic
1126119231 15:45236570-45236592 GTTTATGTCCCTGCACATAATGG - Intergenic
1126602860 15:50446283-50446305 ATTTATCTCTGTGCTCTTAAAGG - Intronic
1126873237 15:53011404-53011426 CTTTACTTCTGTGCACCTGCGGG + Intergenic
1128005791 15:64239195-64239217 GTTGATGTTTGTGCATCTAATGG - Intronic
1128813981 15:70592328-70592350 GTTGACTTCTGTGCACCCACAGG - Intergenic
1131657745 15:94479170-94479192 GTGTATGTCTGTGCACGTGAAGG - Exonic
1137951924 16:52791928-52791950 CTTGATTTCTGTGCATCTACAGG - Intergenic
1138385039 16:56630671-56630693 ATTTATTTATTTGCACATAAAGG + Intergenic
1140452271 16:75080531-75080553 GTTGATTTCTGGGCTCCTAAAGG - Intronic
1141080677 16:81048801-81048823 GTTGATTTCTTTGCAGCTGATGG - Intergenic
1143652934 17:8275461-8275483 GTCTTTTTCTGTGCAACTGAAGG - Intergenic
1144997802 17:19282740-19282762 GTTTACTTCTTTTCTCCTAAAGG + Intronic
1149101227 17:52909265-52909287 TTTTACTTCTGTGCACCCACAGG - Intergenic
1149110224 17:53019410-53019432 GTTGACTTCTGTGCACCCACAGG + Intergenic
1150599064 17:66634582-66634604 TTTTATCACTGTGCACCAAAGGG - Intronic
1152989790 18:352536-352558 GTTTTCTTCTGTGCAGCAAAAGG + Intronic
1153117750 18:1680489-1680511 GTTTCCTTCTGTGGACCTCAAGG - Intergenic
1155544764 18:26903700-26903722 CTTGATTTCTGTGCACCCACAGG + Intergenic
1155716681 18:28952614-28952636 CTTGAATTCTGTGCACCTACAGG + Intergenic
1156065651 18:33140083-33140105 CTTGACTTCTGTGCACCCAAAGG - Intronic
1156153059 18:34266397-34266419 CTTGATTTCTGTGCACCCACAGG - Intergenic
1156809064 18:41224958-41224980 ATTGATTTCTGTGCACCTGCAGG - Intergenic
1156898246 18:42271241-42271263 CTTATTGTCTGTGCACCTAAGGG - Intergenic
1156940984 18:42766922-42766944 ATTGACTTCTGTGCACCTACAGG - Intronic
1157822268 18:50781292-50781314 GTTTAATTCTGCTCACCTCAAGG + Intergenic
1158166555 18:54547332-54547354 CTTGACTTCTGTGCACCTACAGG - Intergenic
1158207407 18:55008763-55008785 CTTTGTTTCTGTGGACTTAAAGG - Intergenic
1159178893 18:64875022-64875044 GTTGATGTCTGTGCAACTGAAGG - Intergenic
1159481459 18:68995581-68995603 CTTGACTTCTGTGCACCTACAGG - Intronic
1159508023 18:69360774-69360796 CTTTACTTCTGTGCACCCACAGG - Intergenic
1160132417 18:76238125-76238147 GTTTATGTCTGTGCAACTTTGGG - Intergenic
1160371808 18:78378297-78378319 TTTAATTTCTGTCCAACTAAGGG - Intergenic
924964289 2:60755-60777 GTTGATTTCTGTGCATCTGATGG - Intergenic
925474022 2:4192676-4192698 CTTGACTTCTGTGCACCTGAAGG + Intergenic
925590452 2:5504095-5504117 GCTTATTTCAGTGCACCTGGAGG - Intergenic
926840920 2:17079615-17079637 CTTGACTTCTGTGCACCCAAAGG - Intergenic
927127040 2:20021426-20021448 CTTGATTTCTGTGCACCTGCAGG + Intergenic
927605618 2:24483918-24483940 TTTTACTTCTGTGCACCCACAGG - Intergenic
929382506 2:41369094-41369116 CTTGATTTCTGTGCACCCAGAGG + Intergenic
930076151 2:47407255-47407277 ATTGATTTCTGTGCACCTGCAGG - Intronic
930560107 2:52950085-52950107 CTTGATTTCTGTGCACTTACAGG + Intergenic
930974795 2:57445048-57445070 GGTCAATGCTGTGCACCTAATGG + Intergenic
931041433 2:58305216-58305238 CTTGATTTCTGTGCACCTGCAGG - Intergenic
933304570 2:80581183-80581205 GTTTATTTATGAGCACATAGGGG + Intronic
934323810 2:91987582-91987604 GTTTATTCCTGTGTAATTAAGGG + Intergenic
934610583 2:95732408-95732430 CTTGATTTCTGTGCACCTACAGG + Intergenic
935139877 2:100343691-100343713 CTTGACTTCTGTGCACCTACAGG - Intergenic
936157304 2:110056704-110056726 GTTTATGTATGTGCACATCAAGG + Intergenic
936187390 2:110314740-110314762 GTTTATGTATGTGCACATCAAGG - Intergenic
936543923 2:113373990-113374012 CTTGATTTCTGTGCACCCACAGG + Intergenic
936831831 2:116656060-116656082 CTTAATTTCTGTGCACCTGCAGG + Intergenic
937031533 2:118744801-118744823 CTTGACTTCTGTGCACCTACAGG + Intergenic
937472260 2:122184274-122184296 GTTTATTTAAGGTCACCTAATGG - Intergenic
937651932 2:124328860-124328882 GTTTATTTCAGTGAACCTTCTGG - Intronic
937730162 2:125221237-125221259 GTTGATTTCTCTGCATCTAGTGG + Intergenic
938510428 2:131936628-131936650 CTTGACTTCTGTGCACCTACAGG + Intergenic
938752648 2:134348249-134348271 CTTTATTTCTGCCCACCTATCGG + Intronic
938868862 2:135453085-135453107 CTTGATTTCTGTGCACCTGCAGG + Intronic
939341697 2:140904298-140904320 CCTTATTTCTATGTACCTAATGG - Intronic
939415747 2:141894588-141894610 GTTGATTTCTGTGTTCCTCATGG - Intronic
939551060 2:143616550-143616572 TTTTATTTCTGAACATCTAATGG - Intronic
940783629 2:157959251-157959273 CTTGACTTCTGTGCACCTACAGG + Intronic
941346238 2:164372555-164372577 CTTGATTTCTGTTCACCTACAGG - Intergenic
941803602 2:169687946-169687968 CTTGACTTCTGTGCACCTACAGG + Intronic
943238029 2:185347718-185347740 GTTGACTTCTGTGCACCTGCAGG - Intergenic
943437682 2:187886306-187886328 CTTGATTTCTGTGCACCCATAGG + Intergenic
944477920 2:200125904-200125926 CTTGATTTCTGTGCACCTGCAGG + Intergenic
1168990562 20:2092150-2092172 GTTAATTTCTGTATACATAATGG - Intergenic
1169287269 20:4320026-4320048 TTTTTTTTCTGTGCACCTGTGGG + Intergenic
1170923404 20:20700704-20700726 GACTATTTCTGTGAACCAAAGGG - Intronic
1171022037 20:21593925-21593947 TTTTACGTCTGTACACCTAACGG - Intergenic
1171118713 20:22549592-22549614 CTTGATTTCTGTGCACCCACAGG + Intergenic
1173491628 20:43487323-43487345 TTTTATTTCCGTGCACCCACAGG + Intergenic
1174741911 20:53022807-53022829 GTTCCTTTGTGTGAACCTAAAGG + Intronic
1174824462 20:53756867-53756889 GTGTATTGCTCTCCACCTAATGG + Intergenic
1176783400 21:13226698-13226720 CTTGACTTCTGTGCACCTACAGG - Intergenic
1177204847 21:17998619-17998641 CTTTACTTCTGTGCACCCACAGG + Intronic
1177271088 21:18850345-18850367 CTTGACTTCTGTGCACCCAAAGG - Intergenic
1177477650 21:21644788-21644810 CTTGATTTCTGTGCACCCACAGG - Intergenic
1177532319 21:22376184-22376206 CTTTTTTTCTGTGTACCTACAGG + Intergenic
1177768034 21:25480797-25480819 GTTGATTTCTGTGCATCTGGTGG - Intergenic
1177857910 21:26420081-26420103 CTTGACTTCTGTGCACCTACAGG + Intergenic
1178101253 21:29271021-29271043 GTTTATTTCTGAGAATCTTAGGG + Intronic
1180251387 21:46592437-46592459 CTTGACTTCTGTGCACCTACAGG - Intergenic
949726764 3:7057197-7057219 GCTTGTTTCTGTGCAAATAAAGG + Intronic
951409012 3:22339588-22339610 CTTTATTTCTGAGCATCAAATGG - Intronic
951756452 3:26096460-26096482 CTTGACTTCTGTGCACCTACAGG + Intergenic
952569924 3:34701877-34701899 CTTTACTTCTGTGCACCTGCAGG + Intergenic
953095878 3:39776497-39776519 GTCTCTGTGTGTGCACCTAACGG + Intergenic
953182186 3:40606091-40606113 GTTTAGCTCATTGCACCTAATGG - Intergenic
953254369 3:41275422-41275444 TTTTGTTTCTGTGTACTTAATGG - Intronic
957615789 3:82524967-82524989 GTTTATTTCAGTTAACATAATGG + Intergenic
957625207 3:82646606-82646628 GTTGACTTCTGTGCACCTGCAGG - Intergenic
958015653 3:87937339-87937361 TTTTAGTTCTGTTTACCTAATGG - Intergenic
959228672 3:103619127-103619149 CTTTACTTCTGTGCACCCACAGG + Intergenic
959235666 3:103718681-103718703 CTTTATTTCTGTGCACCTGCAGG + Intergenic
959814766 3:110662487-110662509 CTTGTTTTCTGTGCACCTACAGG - Intergenic
959894132 3:111587740-111587762 CTTGACTTCTGTGCACCTACAGG + Intronic
962147660 3:132857338-132857360 GTTTTTTTCTGTCCAGCCAAAGG - Intergenic
962284586 3:134075458-134075480 GTTTCGTTCTGAGCACCGAAAGG - Intronic
965610481 3:170538381-170538403 ATTTATTTCATTGCACCCAAAGG + Intronic
967634387 3:191784294-191784316 CTTGATTTCTGTGCACCCACAGG + Intergenic
970049511 4:11897750-11897772 GTTGACTTCTGTGCACCTGAAGG - Intergenic
970061521 4:12039386-12039408 TTTTACTTCTGTGCACCTGTAGG - Intergenic
972063436 4:34910113-34910135 CTTGACTTCTGTGCACCTACAGG - Intergenic
973297365 4:48539823-48539845 TTTTATTTTTATGCACATAAAGG - Intronic
974101491 4:57422376-57422398 GTTGACTTCTGTGCACCCACAGG - Intergenic
974842123 4:67310487-67310509 CTTGACTTCTGTGCACCTACAGG - Intergenic
975521353 4:75304593-75304615 TTTTATTTTTCTGCACATAATGG + Intergenic
976678120 4:87725641-87725663 CTTGACTTCTGTGCACCTGAAGG - Intergenic
976680768 4:87753560-87753582 CTTTACTTCTGTGCACCTGCAGG + Intergenic
977007136 4:91582011-91582033 GTTTATGTATATGCACCTCAAGG + Intronic
977015985 4:91693707-91693729 CTTGATTTCTGTGCACCTGCAGG + Intergenic
977349814 4:95868336-95868358 GTTTATTTTGGTACACTTAATGG + Intergenic
977472699 4:97461086-97461108 GTGTATATATGTGCACCAAAAGG - Intronic
978538763 4:109792839-109792861 CTTTATTTCTTTGGACCTAAAGG + Intronic
978988788 4:115051241-115051263 GTTTATTTAAGTGCATATAAAGG + Intronic
979116088 4:116826480-116826502 TTTTATTTCTGTGCACCTGCAGG + Intergenic
979764404 4:124446820-124446842 GTTGACTTCTGTGCACCCACAGG + Intergenic
980376618 4:131957579-131957601 CTTGATTTCTGTGCACCCACAGG + Intergenic
980907415 4:138961829-138961851 GGTTATTACAGTGCACCTAAGGG + Intergenic
981800801 4:148653351-148653373 TTTTTTTTTTGTGCAACTAAAGG - Intergenic
981994192 4:150958257-150958279 CTTGACTTCTGTGCACCCAAAGG + Intronic
982529292 4:156518457-156518479 GTTTTTCTCTGTGTTCCTAAAGG - Intergenic
982645187 4:158015294-158015316 GGGTATTTCTGTGTACCGAAGGG + Intergenic
982854370 4:160362495-160362517 CTTGATTTCTGTGCACCAACAGG + Intergenic
983006745 4:162493387-162493409 CTTGACTTCTGTGCACCCAAAGG - Intergenic
983068123 4:163235764-163235786 CTTGACTTCTGTGCACCTGAAGG + Intergenic
983860940 4:172706522-172706544 GTCTATGTCTTTGCACTTAAGGG + Intronic
984056732 4:174939772-174939794 GTTTGTTTCTTTCCATCTAAAGG - Intronic
985251284 4:188026962-188026984 GTTTATTTCAGTGCTCAAAAGGG - Intergenic
985852946 5:2402081-2402103 CTTGATTTCTGTGCACCCACAGG - Intergenic
986017621 5:3771458-3771480 TTTTATTTTTGTTCACTTAAAGG - Intergenic
986539215 5:8826719-8826741 GTTTATTCATGTGTACCTAGAGG + Intergenic
986601553 5:9478144-9478166 CTTGTTTTCTGTGCACCTGAAGG - Intronic
988557326 5:32248674-32248696 GTCTATTTCTGTTTACCTACTGG - Intronic
990100933 5:52185911-52185933 ATTTATCTGTGTGCATCTAATGG - Intergenic
990218942 5:53565435-53565457 GTTTATTTGTGTGTACTTCATGG + Intronic
990789985 5:59466582-59466604 GTTTTTTTCTGTCCAGATAAGGG + Intronic
991700091 5:69309483-69309505 CTTTACTTCTGTGCACCTGCAGG - Intronic
992662446 5:78974934-78974956 CTTTATTTCTGTGCTCCTTTAGG - Intronic
992874346 5:81038375-81038397 TTTAATTTCTGTCCATCTAATGG + Intronic
993089269 5:83403978-83404000 TCTTATTTCTGGGCACTTAAAGG - Intergenic
994234250 5:97342861-97342883 CTTGACTTCTGTGCACCCAAAGG + Intergenic
994764535 5:103900109-103900131 CTTGGTTTCTGTGCACCTATAGG - Intergenic
995113508 5:108453935-108453957 CTTGACTTCTGTGCACTTAAAGG - Intergenic
996000165 5:118351453-118351475 GATTATTTCTGTGCACTGATAGG - Intergenic
997775431 5:136600400-136600422 CTTAATTTCTGTGCACCCATAGG - Intergenic
998011721 5:138700479-138700501 GTTTTTTTCTGTGAATGTAAAGG + Intronic
1000380808 5:160627847-160627869 GTCTGTTTCTGTGCACCTTTGGG + Intronic
1000676333 5:164126924-164126946 CTTGATTTCTGTGCACCCACAGG + Intergenic
1000983950 5:167846775-167846797 GTTTATTTATGTGAACCAAAAGG - Intronic
1001684925 5:173586160-173586182 CTTGACTTCTGTGCACCTACAGG + Intergenic
1004805723 6:19201810-19201832 CTTGATTTCTGTGCACCCACAGG + Intergenic
1005088030 6:22027069-22027091 GTATATTTCTGGGGAGCTAAAGG - Intergenic
1005116968 6:22349507-22349529 GATTATTTCTGTCCACCTTCTGG - Intergenic
1005601575 6:27431468-27431490 TTTTATTTCTGTCCAACTGATGG - Intergenic
1007249834 6:40488169-40488191 GTTTATTTCTGTTCACAGAGTGG - Intronic
1008650096 6:53552897-53552919 CTTGATTTCTGTGCACCTATAGG - Intronic
1009309641 6:62134334-62134356 CTTGACTTCTGTGCACCTACAGG - Intronic
1009383612 6:63063116-63063138 CTTGACTTCTGTGCACCAAAAGG - Intergenic
1009831699 6:68945571-68945593 GTCTATTTCTTTGCACTTCATGG - Intronic
1010461875 6:76123010-76123032 ATATATTTATGTGGACCTAAAGG - Intergenic
1011264078 6:85497389-85497411 CTTGATTTCTGTGCACCTGCAGG + Intergenic
1012070224 6:94604731-94604753 CTTGACTTCTGTGCACCTGAAGG + Intergenic
1012125988 6:95428582-95428604 ATTGATTTCTGTGCACCTGCAGG - Intergenic
1012202534 6:96424208-96424230 CTTGATTTCTGTGCACCTGCAGG + Intergenic
1013935366 6:115587414-115587436 CTTGATTTCTGTGCACCTTCAGG - Intergenic
1014133981 6:117866583-117866605 CTTGATTTCTGTGCACCTGCAGG + Intergenic
1014406995 6:121064689-121064711 CTTGATTTCTGTGCACCCACAGG - Intergenic
1014714563 6:124849128-124849150 CTTAATTTCTGTGCACCCACAGG - Intergenic
1014951199 6:127558194-127558216 GTTGACTTCTGTGCACCCACAGG - Intronic
1015699730 6:136022773-136022795 GTTTGTGTCTGTGCACAAAATGG + Intronic
1016177584 6:141099223-141099245 CTTCATTTCTGTGCACCTGCAGG - Intergenic
1016470561 6:144370409-144370431 CTTGACTTCTGTGCACCTACAGG - Intronic
1016613743 6:146024078-146024100 TTTGACTTCTGTGCACCTATAGG - Intergenic
1016877943 6:148882157-148882179 GCTTCTTTCTGTGCACATAAAGG - Intronic
1017834040 6:158160412-158160434 ATTCATTTGTGTGCACCTGATGG - Intronic
1018514300 6:164562008-164562030 ATTGACTTCTGTGCACCTACAGG - Intergenic
1020534229 7:9373900-9373922 TTTTATATCTTTCCACCTAAAGG + Intergenic
1022821917 7:33970513-33970535 CTTTACATCTGTGTACCTAATGG + Intronic
1022862511 7:34382877-34382899 CTTGATTTCTGTGCACCTGCAGG - Intergenic
1023046061 7:36211184-36211206 GTATAGTTCTGGGCACCGAAGGG - Intronic
1026646571 7:72175933-72175955 TTTTATTTTAGTGCACTTAAAGG - Intronic
1027681135 7:81223053-81223075 CTTGACTTCTGTGCACCTACTGG - Intergenic
1027937833 7:84632288-84632310 CTTGATTTCTGTGCACCCATGGG - Intergenic
1027999564 7:85475390-85475412 GTTTATTTCTGTTTTCCGAATGG - Intergenic
1028020177 7:85761149-85761171 GTTTATTTTTGTCTAACTAATGG + Intergenic
1028296423 7:89138041-89138063 TTTTACTTCTGTGCACCTGAAGG - Intronic
1028404870 7:90464359-90464381 CTTGATTTCTGTGCACCTACAGG - Intronic
1031232063 7:119120526-119120548 GTCTATTTCTGTACAGATAAGGG - Intergenic
1032752276 7:134853293-134853315 TTTTATTTATCTGCACCTAGGGG + Intronic
1033580312 7:142726728-142726750 CTTGACTTCTGTGCACCTACAGG + Intergenic
1033833062 7:145276475-145276497 CTTGACTTCTGTGCACCTACAGG - Intergenic
1034367385 7:150563096-150563118 GTTTATGTCCCTGCACATAATGG - Intergenic
1037399971 8:18485887-18485909 ATTTATTTCTGTGCTTCTATAGG + Intergenic
1039293723 8:36126967-36126989 GTTCAGTTCTGTGCCCTTAATGG + Intergenic
1040570257 8:48602326-48602348 GTTTATTTCTCAGCCGCTAATGG - Intergenic
1041430668 8:57777741-57777763 CTTAATTTCTGTGCACCCATAGG - Intergenic
1041434192 8:57819670-57819692 TTTTACTTCTGTGCACCTGCAGG + Intergenic
1041793103 8:61717225-61717247 CTTGACTTCTGTGCACCTATAGG + Intergenic
1042169768 8:65980156-65980178 CTTGACTTCTGTGCACCTACAGG - Intergenic
1042953599 8:74225476-74225498 CTTGATTTCTGTGCACCTGCAGG + Intergenic
1043266071 8:78268629-78268651 ATTTATTTCTGTGCAAGTATAGG + Intergenic
1043297475 8:78683388-78683410 CTTGATTTCTGTGCACCTGTGGG + Intronic
1044125303 8:88452250-88452272 CTTGACTTCTGTGCACCTACAGG + Intergenic
1044743953 8:95354374-95354396 GTTTATTTCTCTGCACTGTAGGG + Intergenic
1045422156 8:102026884-102026906 CTTGACTTCTGTGCACCCAAAGG + Intronic
1046052895 8:109044700-109044722 CTTGACTTCTGTGCACCTACAGG + Intergenic
1046146825 8:110171799-110171821 GTTGACTTCTGTGCACCCACAGG - Intergenic
1046226339 8:111285531-111285553 CTTGATTTCTGTGCACCTGTAGG + Intergenic
1046433133 8:114153876-114153898 CTTTATTTCTGTGCACCCACAGG + Intergenic
1047918053 8:129603894-129603916 CTTTACTTCTGTGCACCCACAGG + Intergenic
1048137408 8:131759739-131759761 CTTGATTTCTGTGCACCCACAGG - Intergenic
1048912530 8:139149727-139149749 GTCTTATTCTGTGCATCTAATGG - Intergenic
1050890547 9:10819261-10819283 CTTTACTTCTGTGCACCCACAGG + Intergenic
1050909946 9:11055846-11055868 CTTGACTTCTGTGCACCTGAAGG - Intergenic
1052531863 9:29695397-29695419 GTTTAAATTTGTGGACCTAATGG - Intergenic
1052688265 9:31781077-31781099 CTTGACTTCTGTGCACCTATAGG + Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1055794065 9:79955297-79955319 CTTGACTTCTGTGCACCCAAAGG - Intergenic
1056087052 9:83160935-83160957 CTTGACTTCTGTGCACCTACAGG - Intergenic
1056195703 9:84226464-84226486 GTTCAATTCTGTGCACCTGAGGG - Intergenic
1056416789 9:86385045-86385067 GTTGATTTCTATGCATCTTAAGG + Intergenic
1056532629 9:87499832-87499854 GTTTCTTTCGGGGCATCTAAGGG + Intronic
1058082241 9:100712526-100712548 CTTGATTTCTGTGCACCTGCAGG + Intergenic
1058240197 9:102548292-102548314 GTTTACTTCCGTGCACTTGAAGG - Intergenic
1058544665 9:106048194-106048216 TTTTATTCATGTGCACATAAGGG + Intergenic
1058586638 9:106514060-106514082 ATTAATTTCTGTGAACCTCAAGG - Intergenic
1058810014 9:108630398-108630420 ATTGACTTCTGTGCACCTACAGG - Intergenic
1059886451 9:118749726-118749748 GTTTATGTTTGTGCATTTAATGG - Intergenic
1059923979 9:119187611-119187633 GTTTATATCTGTGCATTTAGTGG - Intronic
1060080067 9:120635906-120635928 GTTGATGTCTGTGCACCTGGTGG + Intronic
1186034266 X:5403899-5403921 GCTTATTTTTGTGAACCCAAAGG + Intergenic
1186679317 X:11855068-11855090 CTTGATTTCTGTGCACCCACAGG + Intergenic
1188181853 X:27066111-27066133 GTTTTTTTCTATTCACCTAAAGG + Intergenic
1188598497 X:31931030-31931052 GTTTATTTCTGTGAAACAAGAGG - Intronic
1188731176 X:33648025-33648047 CTTGATTTCTGTGCACCTGCAGG + Intergenic
1188746123 X:33846845-33846867 GTTGATATCTGTGCATCTGATGG + Intergenic
1191052297 X:56206947-56206969 CTTGATTTCTGTGCACCCACCGG + Intergenic
1193068326 X:77281082-77281104 GTTGACTTCTGTGCACCTGCGGG - Intergenic
1193151302 X:78127491-78127513 GTTTATTTCTTTGTCCCTAAAGG - Exonic
1194145317 X:90254887-90254909 CTTGATTTCTGTGCACCTGCAGG + Intergenic
1194463059 X:94196796-94196818 ATTCACTTCTGTGCACCTACAGG - Intergenic
1194507067 X:94745919-94745941 CTTGATTTCTGTGCACCTGCAGG - Intergenic
1194673598 X:96766468-96766490 GTTTTTTTTTCTGCAACTAAAGG + Intronic
1195402743 X:104478955-104478977 GTTTTTCTCTGTGAAGCTAATGG - Intergenic
1195784397 X:108502804-108502826 GTTTATTTCTGTGGAGCAACTGG - Intronic
1196285195 X:113871590-113871612 CTTAATTTCTGTGCACCCACAGG - Intergenic
1197451883 X:126629288-126629310 CTTAACTTCTGTGCACCTACAGG + Intergenic
1197511121 X:127370879-127370901 CTTTATTTCTGTGTACCCATAGG + Intergenic
1198953946 X:142106329-142106351 ATGTATTACTGTGCACCAAATGG - Intergenic
1198991026 X:142515025-142515047 ATTGACTTCTGTGCACCTACAGG + Intergenic
1199325490 X:146493637-146493659 ATTGACTTCTGTGCACCTGAAGG - Intergenic
1199346500 X:146746945-146746967 ATTTACTTCTGTGCACCCAGAGG + Intergenic
1199357172 X:146875789-146875811 CTTGATTTCTGTGCACCCACAGG - Intergenic
1199423619 X:147676191-147676213 CTTATATTCTGTGCACCTAAAGG - Intergenic
1200491079 Y:3824185-3824207 CTTGATTTCTGTGCACCTGCAGG + Intergenic
1200826889 Y:7655298-7655320 CTTTATTTCTGTGAACCTTTAGG + Intergenic
1200873033 Y:8123893-8123915 GTTTATGTCCCTGCACATAATGG - Intergenic
1200883874 Y:8249877-8249899 CTTTATTTCTGTGAACCTTTAGG + Intergenic
1200958717 Y:8976078-8976100 CTTTATTTCTGTGAACCTTTTGG - Intergenic
1200961326 Y:8998675-8998697 GTTTATGTCCCTGCACATAATGG + Intergenic
1201540254 Y:15098492-15098514 GTTTATTTCTGTGGACCTATGGG + Intergenic
1202151445 Y:21847556-21847578 GTTTATGTCCCTGCACATAATGG - Intergenic
1202232993 Y:22674501-22674523 CTTTATTTCTGTGAACCTTTAGG - Intergenic
1202310163 Y:23521657-23521679 CTTTATTTCTGTGAACCTTTAGG + Intergenic
1202560638 Y:26148936-26148958 CTTTATTTCTGTGAACCTTTAGG - Intergenic