ID: 923118994

View in Genome Browser
Species Human (GRCh38)
Location 1:230972745-230972767
Sequence CAGTATGTAGATCTTTTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 273}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923118993_923118994 -2 Left 923118993 1:230972724-230972746 CCTGAAGTTGAACAGGTTTAGCA 0: 1
1: 0
2: 0
3: 11
4: 94
Right 923118994 1:230972745-230972767 CAGTATGTAGATCTTTTAAAAGG 0: 1
1: 0
2: 1
3: 28
4: 273
923118991_923118994 6 Left 923118991 1:230972716-230972738 CCTTATCACCTGAAGTTGAACAG 0: 1
1: 0
2: 1
3: 13
4: 320
Right 923118994 1:230972745-230972767 CAGTATGTAGATCTTTTAAAAGG 0: 1
1: 0
2: 1
3: 28
4: 273
923118990_923118994 7 Left 923118990 1:230972715-230972737 CCCTTATCACCTGAAGTTGAACA 0: 1
1: 0
2: 0
3: 9
4: 138
Right 923118994 1:230972745-230972767 CAGTATGTAGATCTTTTAAAAGG 0: 1
1: 0
2: 1
3: 28
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923118994 Original CRISPR CAGTATGTAGATCTTTTAAA AGG Intronic
907073868 1:51561752-51561774 CAGACTGCTGATCTTTTAAATGG - Intergenic
908017958 1:59865641-59865663 CAGATTGTAGATATTTTTAAGGG + Intronic
908587322 1:65584419-65584441 CTGTATGTACATGTATTAAAGGG + Intronic
908642358 1:66239322-66239344 CTGTATGTAGACATTATAAAGGG - Intronic
909654068 1:78011090-78011112 CAGTATGGTGATCTTTTAAGGGG - Intronic
909856918 1:80546435-80546457 CAGAATGTATCTCTTTTAGAAGG + Intergenic
910041580 1:82858320-82858342 CACCATGTAGATCTTTTTGATGG - Intergenic
910813405 1:91261951-91261973 CAGTATGTTAATTTTGTAAAGGG - Intronic
911505131 1:98739370-98739392 CAGTTTAAAGTTCTTTTAAACGG - Intronic
912164341 1:107024420-107024442 CAATGTGTATATGTTTTAAATGG - Intergenic
916867860 1:168879591-168879613 CAGTCTGTAAATCTTCTCAAGGG + Intergenic
917998993 1:180473144-180473166 CAATATGTAAAACTTTTACACGG + Intronic
918219380 1:182422248-182422270 GTGTATGTAGATATTGTAAATGG + Intergenic
918455090 1:184703037-184703059 TAGTAGATAGATCTTTTTAATGG - Intronic
919017931 1:192064733-192064755 CAGAATTTATTTCTTTTAAAAGG - Intergenic
919114984 1:193270347-193270369 CAGTCTGTAGCACTTTTTAATGG - Intergenic
919246103 1:194986831-194986853 CCTTTTGGAGATCTTTTAAAAGG - Intergenic
919279333 1:195466929-195466951 CTGAATGTAGATCTTTTCAGTGG + Intergenic
919543809 1:198886103-198886125 AAATATTTAGGTCTTTTAAAAGG + Intergenic
923118994 1:230972745-230972767 CAGTATGTAGATCTTTTAAAAGG + Intronic
923510132 1:234643897-234643919 CAGTTTGCAGATCTGTAAAATGG - Intergenic
923868643 1:237966692-237966714 CAGTATGTACATATATTATATGG + Intergenic
1063054307 10:2486891-2486913 CAGTATATATATATTTTAATTGG - Intergenic
1063825953 10:9897530-9897552 CAGTATGGAGAGCCTTTAAGAGG - Intergenic
1064392607 10:14954589-14954611 CAGTTTGTAGATTATATAAACGG - Intergenic
1065266984 10:23986752-23986774 CAGTCTGTAGATATTTTCAAAGG - Intronic
1067150993 10:43733775-43733797 CATTTTGTAGCTCTTTTAAATGG - Intergenic
1068329512 10:55544631-55544653 CAGTATGAAGTTGTTATAAAAGG - Intronic
1068436188 10:56994117-56994139 AAGGAAGTAGATCTTTAAAAAGG + Intergenic
1069139273 10:64803389-64803411 CAGTGAGTAGATCTTTGAACAGG - Intergenic
1071583175 10:86792388-86792410 CAGTATGCAATTCATTTAAATGG - Intronic
1072337374 10:94410061-94410083 AAGTTTTTAGATCTTTTAAGTGG + Intronic
1072516619 10:96189646-96189668 GAGTATGTAGATTTCTTCAATGG + Intronic
1073695530 10:105862184-105862206 CAGAATGAAGATTTTTTTAAAGG + Intergenic
1073728579 10:106264733-106264755 CAGTATGTAGATTTTACAGATGG - Intergenic
1075272325 10:121063014-121063036 CAGTTTTTTGATCTTTAAAATGG + Intergenic
1075444384 10:122503649-122503671 CAGTATCCACATCTTTAAAATGG + Intronic
1076060747 10:127412268-127412290 TTGTATGTAGAATTTTTAAAAGG - Intronic
1076454318 10:130578839-130578861 CTGTCTGCAGCTCTTTTAAAAGG + Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1079521799 11:21336780-21336802 CAGTAATTAGAATTTTTAAAGGG - Intronic
1079656403 11:22991424-22991446 ATGTATGTAAATCTTTTTAAAGG - Intergenic
1080540632 11:33260961-33260983 CAGTGTGTTTATTTTTTAAAAGG + Intronic
1083085626 11:60141346-60141368 CAGTATTTATATTTTTTAAAAGG + Intergenic
1087127258 11:94640321-94640343 TAGTAGGTAGAATTTTTAAATGG + Intergenic
1089113528 11:116075493-116075515 TAGTATGTTAATATTTTAAATGG + Intergenic
1089807109 11:121100554-121100576 CAGTAAGTAAATAGTTTAAAAGG - Intergenic
1090165432 11:124541957-124541979 CAGAATGTAGAGCTTTTTCAAGG - Intergenic
1090648230 11:128783824-128783846 CAGTATGTAGAACATATCAAAGG - Intronic
1091967599 12:4758201-4758223 AAGTACTTAGATGTTTTAAAAGG - Intronic
1094254685 12:28409373-28409395 AAGTTTATAGATATTTTAAAAGG - Intronic
1095374741 12:41513019-41513041 TAGTAAGTAGGTCTTTAAAAAGG - Intronic
1097459010 12:59836789-59836811 CAGTATGTAGTCCTTTCAGATGG + Intergenic
1098681545 12:73362187-73362209 CAGTATCTAGATCATTAAATAGG + Intergenic
1099699945 12:86070914-86070936 GAGTATGTAATGCTTTTAAATGG + Intronic
1099707244 12:86171557-86171579 CAGTTTCTTGATCTATTAAATGG - Intronic
1099717011 12:86308620-86308642 CAGTAAATAGATTTTTAAAATGG + Intronic
1099741955 12:86649271-86649293 CTGTATATAGATCATTTCAATGG - Intronic
1101584314 12:106071221-106071243 CAGTATTCTCATCTTTTAAATGG - Intronic
1102409490 12:112704883-112704905 CAATAATTATATCTTTTAAATGG + Intronic
1105295312 13:19084105-19084127 CAGTATGTAGACTTTTCAGATGG - Intergenic
1106679576 13:31996434-31996456 CAGGAAGTATATGTTTTAAAAGG - Intergenic
1107070566 13:36263867-36263889 CAATATGAAGAGCTTTTGAAGGG + Intronic
1107075164 13:36316041-36316063 AGCTATGTAGATATTTTAAATGG + Intronic
1107756910 13:43634479-43634501 GTCTATGTAGATATTTTAAAAGG + Intronic
1108784719 13:53882309-53882331 CAGTAAGTAGATCCTCAAAAAGG + Intergenic
1108908321 13:55508263-55508285 CAGTAGTTATATCTTTTGAATGG + Intergenic
1109068224 13:57728800-57728822 CAATATCTAGATCCTTTAAAGGG - Exonic
1109142445 13:58731355-58731377 TAATATGTACATCTTTTAAGTGG - Intergenic
1110269099 13:73573132-73573154 CAGTTTTTAGATCTTTGAAATGG + Intergenic
1112291829 13:98150467-98150489 TACTATGTAGATCTTTACAAAGG - Intronic
1112936044 13:104799693-104799715 CATTTTGTAAATCTTTAAAATGG - Intergenic
1114392280 14:22322789-22322811 CAGTATCTAGGGCTTTTGAAGGG - Intergenic
1115730483 14:36263843-36263865 CACAATGTAGATTTTTTAATAGG - Intergenic
1116966899 14:51024397-51024419 CAGTGTGTAATTCTTTGAAAGGG + Intronic
1118357108 14:65023461-65023483 GAGTATGTAAATCTTGTAAGAGG - Intronic
1119143460 14:72288839-72288861 TCTTATGTAGATTTTTTAAAGGG + Intronic
1120461353 14:84800709-84800731 CAGTATGTACATCTTTAAAGAGG + Intergenic
1121200880 14:92116661-92116683 TAATATGTAAATTTTTTAAATGG - Intronic
1121387372 14:93540427-93540449 CAGTTTGTTCATCTTTGAAATGG + Intronic
1127579685 15:60326949-60326971 CAGCATGTAAATGTTTGAAAAGG + Intergenic
1128307272 15:66607509-66607531 CAGGATAAAGATTTTTTAAATGG - Intronic
1133169108 16:3969897-3969919 GAGTATGTAGTATTTTTAAATGG - Intronic
1134206847 16:12245266-12245288 CAGTATTTTCATCTGTTAAATGG + Intronic
1138356089 16:56381593-56381615 CAGTATGTAGCCTTTTTAGATGG - Intronic
1138864714 16:60802861-60802883 CAGTAAGTACAATTTTTAAACGG - Intergenic
1139069575 16:63363989-63364011 CCGTATGTGGATGTGTTAAAGGG - Intergenic
1145865020 17:28235642-28235664 CAGTATGTTGATCTTTTGCTGGG - Intergenic
1149163356 17:53721166-53721188 CAGTAGGTAGAACTTTTGTATGG - Intergenic
1149569498 17:57662498-57662520 CAGTTTTTAAATCTTTAAAATGG - Intronic
1150261822 17:63799376-63799398 CAGTTTGCATTTCTTTTAAATGG - Intronic
1153337963 18:3944031-3944053 CAGTATGTGGTACTTTTTAATGG + Intronic
1155785259 18:29889671-29889693 GGGTATGTAGATCTTTCATATGG - Intergenic
1155929195 18:31687601-31687623 CAGGATTAAGATCTTTTTAATGG - Intergenic
1156134630 18:34022853-34022875 CATTATGTATATCTAATAAATGG + Intronic
1157397951 18:47358891-47358913 CAGAATTTATTTCTTTTAAAAGG + Intergenic
1157865295 18:51178180-51178202 CAGTATCTGTTTCTTTTAAATGG - Intronic
1158029679 18:52948074-52948096 CAGTATGAAAAATTTTTAAAGGG + Intronic
1158290416 18:55934237-55934259 CAGTTTATAGATTTTTAAAATGG + Intergenic
1158481715 18:57827623-57827645 CATTATTTACATCTTTAAAAAGG + Intergenic
1166486371 19:43217043-43217065 AAATATGTATATATTTTAAATGG - Intronic
1166586854 19:43956658-43956680 CAGTTTGGAGAAATTTTAAAAGG - Intronic
925947942 2:8883410-8883432 AAGTATGCAGAAATTTTAAAGGG + Intronic
926709549 2:15867392-15867414 CAGTATGAAGACCCTTAAAAGGG - Intergenic
928018043 2:27677467-27677489 CGGTATGTTGCTCCTTTAAAAGG - Intronic
930434338 2:51321320-51321342 CAGTGTTTAGATATTTGAAAGGG + Intergenic
930487799 2:52029920-52029942 CATTATAGAGATCCTTTAAAAGG + Intergenic
931673442 2:64670629-64670651 CAGGATATAGAAATTTTAAAAGG - Intronic
931770661 2:65494493-65494515 CAGTATGTAGACTTTTCAGATGG + Intergenic
932336412 2:70933847-70933869 CTGTGTATAGATATTTTAAAGGG - Intergenic
932585287 2:73023923-73023945 CAGTATTTAGGTCATTTGAAGGG - Intronic
933084065 2:78032689-78032711 CAGTATGTAGCATTTTCAAATGG - Intergenic
934877239 2:97935275-97935297 CAGGATGTTGATCTTTTGATAGG - Intronic
935094483 2:99931390-99931412 CAATATATGGATCTTTTATAAGG + Intronic
935562287 2:104571595-104571617 AAATATGTTGATTTTTTAAAAGG - Intergenic
935834941 2:107040220-107040242 GAATATGTTGATCTTTTGAATGG - Intergenic
936715603 2:115183652-115183674 CAGTCTGTGGATCGTTTTAAAGG + Intronic
936733988 2:115418096-115418118 CAGAATGTAAATCATTTCAAAGG + Intronic
936770878 2:115911708-115911730 CATTATGTGTATCTTTCAAATGG + Intergenic
937055429 2:118931072-118931094 CAGTCTGTAAATCTTTATAATGG + Intergenic
937322351 2:120968525-120968547 CAGTTTGTTGATCTGTAAAATGG - Intronic
937739180 2:125329469-125329491 CAGCATGTTCATCTTTTAAATGG - Intergenic
937756710 2:125547948-125547970 GAGTATGTATATCTTTAGAATGG - Intergenic
938202437 2:129385556-129385578 CAGTAATTATATCTTGTAAATGG - Intergenic
939790337 2:146565283-146565305 CAGTATATAAATATTATAAAAGG - Intergenic
940338354 2:152552731-152552753 CACTATGTGGATCATTTCAAGGG - Intronic
940846720 2:158650431-158650453 AAGTTGGTAGATCTTTTCAAAGG + Intronic
942851784 2:180495575-180495597 CAGTATCTAGACCCTTGAAATGG + Intergenic
943529466 2:189061155-189061177 CAGTATGTACATTATTTAATAGG - Intronic
944090322 2:195902417-195902439 CAGTTGGTATCTCTTTTAAAGGG + Intronic
944807493 2:203297098-203297120 CAGTATATTGATCATTTTAATGG + Exonic
945036139 2:205705695-205705717 CAGTATCTACATCTGTTAAATGG - Intronic
945138432 2:206656437-206656459 CTGTATGTATATCTTTTGATTGG + Intronic
945612918 2:212028711-212028733 AGGTATGTTGAGCTTTTAAAGGG - Intronic
945768877 2:214015285-214015307 CAGTATTGAGGTCTTTTGAAAGG + Intronic
947045915 2:225983606-225983628 CAGTTTGTTGATCTTTTGAAAGG - Intergenic
948314833 2:237019747-237019769 CAGTTTGCACATCTTTAAAATGG - Intergenic
1169591499 20:7147743-7147765 CAGTTTGTAGATCCTTTGAAGGG - Intergenic
1172110123 20:32539727-32539749 CAGTCTGCATATCTTCTAAATGG + Intronic
1172437947 20:34943244-34943266 CAGTTTGCTGATCTTTAAAATGG + Intronic
1173390848 20:42631462-42631484 TAGCATGTAGATGTTTTAAGTGG + Intronic
1174644761 20:52076169-52076191 CTGTGTATAGTTCTTTTAAAAGG - Intronic
1175076446 20:56378778-56378800 CAGTATGTAGCTTTTTTAGGTGG - Intronic
1177094334 21:16812760-16812782 CAGTATGTAGACCTCAAAAAAGG - Intergenic
1177470265 21:21552396-21552418 CACTATGTATATATTTTTAAAGG + Intergenic
1177914460 21:27071425-27071447 CATGATGTAGATGTCTTAAAAGG - Intergenic
1178015974 21:28346556-28346578 CAATATTAAGATCCTTTAAAAGG + Intergenic
1182138774 22:27933528-27933550 CAGTAAGAAAATATTTTAAATGG - Intergenic
1182146470 22:27999727-27999749 CAGTATGTAGAGCTTCTTAAAGG - Intronic
1185236712 22:49717909-49717931 CAGTATGTAATTTATTTAAATGG + Intergenic
949587845 3:5460320-5460342 CAGTTTGAAGGTCTTTAAAATGG + Intergenic
949750178 3:7343201-7343223 CAGTTTACAGATCTTTTAAGAGG + Intronic
949802183 3:7915779-7915801 AACTATGTAGACCTATTAAATGG - Intergenic
950239658 3:11357461-11357483 GAGTATGTAGATATTTTTATCGG - Intronic
950996138 3:17499178-17499200 CAGTATATAGTTTTTTTAAATGG + Intronic
951079794 3:18439809-18439831 CAGTATTTTGATGTTTCAAAGGG + Intronic
951792647 3:26503314-26503336 CAGTGTGTATATGTATTAAAAGG + Intergenic
952074282 3:29676755-29676777 CATCATGTATATTTTTTAAAAGG - Intronic
952751067 3:36825345-36825367 CAGTAAGCAGACCTTTCAAAGGG - Intergenic
955012142 3:55028263-55028285 CAGTATGTAGTGTTTTTAAAGGG + Intronic
955096821 3:55806849-55806871 CAGTGTGTTTATCTGTTAAATGG + Intronic
956686163 3:71830043-71830065 GAGTATGTATATATTTAAAATGG + Intergenic
956838366 3:73114446-73114468 CTTTATTTACATCTTTTAAATGG + Intergenic
957707614 3:83809968-83809990 AAGTATGTAGATCTTTTTTGGGG + Intergenic
957913096 3:86648388-86648410 AAGAATGAAGATTTTTTAAAAGG - Intergenic
958443247 3:94181925-94181947 CAATATTTACATCTTTTATAGGG - Intergenic
959533517 3:107460244-107460266 CAGTTTTTAGATCTCTAAAATGG - Intergenic
959597719 3:108146206-108146228 CAGTATGCAGAACTTTCAAGGGG + Intergenic
959690376 3:109191593-109191615 CAGAATGTAGATTTTTAACAGGG - Intergenic
960779964 3:121309731-121309753 TAGAATAAAGATCTTTTAAAAGG - Intronic
961571873 3:127804989-127805011 CAGTATGGAGCTCTTTTTAAAGG + Intronic
961631614 3:128303684-128303706 AAGTATGTAAAACTTCTAAATGG - Intronic
961941363 3:130640366-130640388 CAGTAAGTAGATTATTTTAAAGG - Intronic
962431551 3:135325186-135325208 CAGTATTTGGTTGTTTTAAAAGG - Intergenic
963794133 3:149614657-149614679 CAATATGAACATCTTTCAAAAGG + Intronic
964928984 3:161992300-161992322 AAGTATGTAGATCTTCAGAATGG + Intergenic
967466933 3:189817916-189817938 AAGTATTTACATTTTTTAAATGG - Intronic
967490393 3:190084047-190084069 CAGTAAGAAGATGATTTAAATGG + Intronic
968247947 3:197173624-197173646 CAGTATGTATTTCTTTTTACAGG - Intronic
969415767 4:7057235-7057257 TAGTATGTATATCTTTTTGATGG + Exonic
970380071 4:15498284-15498306 CATTATGTATATATTTTTAATGG + Intronic
971032917 4:22660442-22660464 CAGTATGTGTATGTTTTGAAGGG + Intergenic
971524628 4:27601497-27601519 CATTATGTAGAACTTTAACAGGG + Intergenic
972069689 4:35001695-35001717 CAGAATGTACCTCTTATAAAAGG - Intergenic
972604694 4:40603374-40603396 CAGTATGGGGATATTTTTAATGG + Intronic
974929212 4:68342355-68342377 GAGTAGGCAGATCTTTTACATGG + Intronic
976156253 4:82147945-82147967 CACTATGCAGATCTTAAAAATGG + Intergenic
976479363 4:85521640-85521662 CAGTATGTAGAGATGCTAAAAGG - Intronic
976969785 4:91091116-91091138 CAGGATGTGGCTCTTTTAATTGG - Intronic
977130775 4:93233969-93233991 AAGTATGCAGACGTTTTAAAAGG - Intronic
978669852 4:111233624-111233646 CTGTCTGTAGATCATCTAAATGG + Intergenic
979369320 4:119864378-119864400 CAATATGCAGATCTTTAAAATGG + Intergenic
979746728 4:124224003-124224025 CACTATGTAGATATTAAAAATGG + Intergenic
980748229 4:137050687-137050709 CAGTATTGATATCTTTTCAAGGG - Intergenic
982434056 4:155361592-155361614 CTGTATGTTGATCTTTAAAATGG - Intronic
982897433 4:160950415-160950437 CAATATATAGATGCTTTAAAAGG + Intergenic
983105451 4:163681131-163681153 CAGTATCTCCATATTTTAAAGGG + Intronic
983519541 4:168692951-168692973 CAGTATGTGTATATTTGAAAAGG + Intronic
983872700 4:172840687-172840709 CAATATATAGATGTTTGAAATGG + Intronic
984045660 4:174795077-174795099 CAACATGTTGATCTTTAAAAAGG - Intronic
984289566 4:177778398-177778420 AAGTATCTAGATATTTTAAAGGG + Intronic
984417040 4:179475059-179475081 AAATATCTAGATCTTTTCAATGG - Intergenic
986856619 5:11876063-11876085 CAGGTTGAAGATCTTATAAATGG - Intronic
987915102 5:24202578-24202600 GAATATGTTGATCTTTTGAATGG - Intergenic
988626603 5:32882740-32882762 CCATCTGTATATCTTTTAAATGG + Intergenic
988905125 5:35780028-35780050 CAGTATCTAGACCTTTAAAGTGG - Intronic
989126346 5:38055882-38055904 CAATATGTGGCTTTTTTAAAGGG - Intergenic
989201799 5:38771158-38771180 CAGTATTTTGATATTTTTAATGG - Intergenic
990223516 5:53622957-53622979 TATTATGTAGAGCCTTTAAAAGG - Intronic
991726747 5:69543159-69543181 AAGTATGTTAATATTTTAAAGGG + Intronic
991868210 5:71084715-71084737 AAGTATGTTAATATTTTAAAGGG - Intergenic
991953260 5:71967379-71967401 CAGTAGTTTGCTCTTTTAAATGG - Intergenic
992021942 5:72633545-72633567 CAGTAAGTTGATTTTTCAAAAGG - Intergenic
992567615 5:78014653-78014675 CAGTGTGTAGATATTTTTAATGG + Intronic
993242842 5:85413293-85413315 AAATTTGTAGATCTTTTCAATGG + Intergenic
993440498 5:87951053-87951075 CAGCATGTAGGTCTTTCAGAAGG - Intergenic
993540529 5:89144951-89144973 CAGTATGTCCTTCTTTTTAAAGG + Intergenic
993915988 5:93742718-93742740 CAGGATGAGGATTTTTTAAAAGG - Intronic
994223644 5:97226356-97226378 CAGCATGTCAATCTTTTAAAAGG - Intergenic
995259697 5:110088497-110088519 CAGTTTTTATATCTTTAAAATGG - Intergenic
996328301 5:122301358-122301380 GTTTATGTAGATCTTTTAAAGGG + Intergenic
996619528 5:125483238-125483260 CAGTAGGTACATGTTGTAAAAGG + Intergenic
997741489 5:136258775-136258797 AAGTATGTACATTCTTTAAATGG + Intronic
1001871712 5:175161825-175161847 CAGTTTCTACATCTGTTAAATGG + Intergenic
1002805003 6:564826-564848 AAGTATGTAGACCTTTTCACAGG - Intronic
1003683832 6:8281464-8281486 CAAAATCTAGAACTTTTAAAAGG + Intergenic
1005174682 6:23031353-23031375 TAGTATGTATATCTTTTTGATGG - Intergenic
1005211286 6:23467198-23467220 CAGTATGTAGTTTTATAAAAAGG + Intergenic
1005800928 6:29423557-29423579 CAGTATGAAGATTTCTTAAAGGG - Intronic
1008163961 6:48112982-48113004 AAATATGTAGACTTTTTAAATGG + Intergenic
1008201345 6:48594299-48594321 AAATATGTCTATCTTTTAAAAGG - Intergenic
1008235334 6:49039823-49039845 CAGAATTTACATCTTTTATAAGG + Intergenic
1008685519 6:53921975-53921997 CAGCATGTACATCTTTTAAATGG - Intronic
1009459644 6:63896805-63896827 CAGTATGTAGCTTTTTGAAATGG + Intronic
1009506668 6:64491125-64491147 CAATATGAAGAGCTTTTAATGGG + Intronic
1010363378 6:75021121-75021143 TACCATGTAGATCTTTGAAAAGG - Intergenic
1011001479 6:82592614-82592636 CAGTCTGTAGTTTTTTCAAATGG - Intergenic
1012106683 6:95170124-95170146 CAGTTCGTAGATCTTTTATTGGG - Intergenic
1012332016 6:98003221-98003243 CAGTATATAAATCTTTCAAGGGG - Intergenic
1013618188 6:111864367-111864389 CAGTTTTTCCATCTTTTAAATGG + Intronic
1013662880 6:112316488-112316510 CAGTAGGTAGATCATTTTATAGG - Intergenic
1014083123 6:117311056-117311078 CTGTGTGTAGATATTTCAAAAGG - Exonic
1014896366 6:126904859-126904881 CACTAGGAATATCTTTTAAAGGG + Intergenic
1015099641 6:129461225-129461247 ACGTATGTATATCCTTTAAATGG - Intronic
1015161865 6:130161589-130161611 CAATATGTAAATCATTAAAATGG - Intronic
1015302931 6:131674845-131674867 CAGGTTGTAATTCTTTTAAAGGG + Intronic
1016078729 6:139829789-139829811 CAGGATGTGGCTCCTTTAAAAGG - Intergenic
1016235688 6:141862654-141862676 CAGAATTTACTTCTTTTAAAAGG - Intergenic
1016388352 6:143550325-143550347 CTGTATGGAGAGCTTTTAATGGG + Intronic
1017382819 6:153849901-153849923 CAGTATGTAGCTTTTTCAGATGG - Intergenic
1021012716 7:15491821-15491843 CAGTATGTAGATCTTCACAGAGG + Intronic
1025022629 7:55491632-55491654 CAGTATGTAGGAGTTTTAGATGG + Intronic
1026394394 7:69936810-69936832 TTGCATTTAGATCTTTTAAATGG - Intronic
1027334851 7:77139252-77139274 CAGTATGTAGACTTTTCAGATGG - Intronic
1029780948 7:102731859-102731881 CAGTATGTAGACTTTTCAGATGG + Intergenic
1030355077 7:108532597-108532619 CAGAATGTCTATTTTTTAAAAGG + Intronic
1030639655 7:111989695-111989717 CAGTATTTAGACTTTTAAAAAGG + Intronic
1031466777 7:122122846-122122868 CAGTATGTTCACGTTTTAAATGG - Intronic
1031883217 7:127219894-127219916 GAGTGGGTAGATCTTTTAAGAGG - Intronic
1032106581 7:129036251-129036273 CTGTGTGTATATGTTTTAAAGGG + Intronic
1035953313 8:4048477-4048499 CAGTTTGTTCATCTTTAAAATGG - Intronic
1037552665 8:19990042-19990064 CAGTATGTATGTGTTTTCAAAGG + Intergenic
1037846267 8:22285396-22285418 CAGGATGTACTTCTTTTTAAAGG + Intronic
1039094951 8:33873442-33873464 CCATATGTAGATGTTTTAAAGGG + Intergenic
1039779864 8:40773595-40773617 CAATAAGTAGAAGTTTTAAATGG + Intronic
1041150505 8:54927611-54927633 CATACTGTATATCTTTTAAATGG - Intergenic
1041304275 8:56444758-56444780 CCTTATGTAGATGTTTGAAATGG - Intronic
1041482602 8:58339714-58339736 TAGTAAGTAGATTTTTTATAAGG - Intergenic
1041695165 8:60728264-60728286 CAGTGTGCAGTTCTTTTGAATGG + Intronic
1042452484 8:68964631-68964653 AATTATGTAGATATTTCAAAAGG - Intergenic
1045159350 8:99520186-99520208 TAGGAGGTAGAACTTTTAAAGGG + Intronic
1046096449 8:109567930-109567952 GAGTTTGCAAATCTTTTAAATGG + Intergenic
1046532466 8:115465586-115465608 CAGTATATGTATCTTTTCAATGG - Intronic
1046861505 8:119097105-119097127 CAGTATGGTGATCTTTAGAAAGG + Intronic
1048160631 8:132017912-132017934 CAATATGGAGAGCTTTTTAAAGG - Intergenic
1051799198 9:20912557-20912579 TAGCAGGTAGATTTTTTAAATGG + Intronic
1052073815 9:24116363-24116385 AATGATGTAGATCTTTTATATGG - Intergenic
1052522551 9:29567215-29567237 CAGAATCTAGATATTTGAAAAGG + Intergenic
1052968176 9:34358317-34358339 CAGTATTTCCTTCTTTTAAATGG + Intergenic
1053332281 9:37224112-37224134 CAGTATATTAATTTTTTAAAAGG + Intronic
1054918735 9:70520818-70520840 CAGTTTCTCTATCTTTTAAATGG - Intergenic
1058582096 9:106469391-106469413 CATTATTTAGTTCTTTTAAATGG + Intergenic
1058599069 9:106649830-106649852 CAGAATGTAGATCTATTAGAAGG - Intergenic
1058770295 9:108224569-108224591 CAGTCTCTTGATCTTTTAAAAGG + Intergenic
1186300241 X:8192950-8192972 CAGTATTTGGATATTTTAGACGG - Intergenic
1189058493 X:37726649-37726671 CAAGATGTAGCTCATTTAAATGG - Intronic
1190068205 X:47257753-47257775 CAGAATGTGCAACTTTTAAAAGG - Intergenic
1191162986 X:57354025-57354047 CAGTATGGAGGTTTTTCAAAGGG + Intronic
1191163965 X:57367492-57367514 AAGTATGAAGAGCTTCTAAATGG - Intronic
1192789753 X:74369746-74369768 CGTTATGTAGATCTTTAACATGG - Intergenic
1194799874 X:98259597-98259619 CTGTATGTACACCTTTTACAAGG + Intergenic
1195209800 X:102643080-102643102 CAGTATGTAGCCTTTTTACAAGG + Intergenic
1196356227 X:114796553-114796575 CAGTTTATAGATGTTTTAGAAGG - Intronic
1196760138 X:119193598-119193620 CTGTTTTTACATCTTTTAAAAGG - Intergenic
1196939538 X:120761774-120761796 CAGTAGCCACATCTTTTAAAAGG - Intergenic
1197311106 X:124906807-124906829 CAGTATGTAGACTTTTTATTTGG - Intronic
1197970934 X:132114252-132114274 TAGTAAGTAGATGTTTTATAAGG - Intronic
1198137547 X:133769050-133769072 CAGGATGTTCTTCTTTTAAAAGG - Intronic
1198653448 X:138888750-138888772 CAGCAGGAAGATCTTTTAAAGGG - Intronic
1198970318 X:142271828-142271850 CAGGATGTGGCTCTTTTAATTGG + Intergenic
1199582690 X:149376216-149376238 TAGAATGTAGCTCTTGTAAAAGG - Intergenic
1200131034 X:153846098-153846120 ATGTATGTAGATGTTTTTAATGG - Intergenic
1200579099 Y:4926363-4926385 CAGTGTTTAGAACTTTTATAAGG - Intergenic