ID: 923119794

View in Genome Browser
Species Human (GRCh38)
Location 1:230979136-230979158
Sequence CAGGGGAAGGGGAACGTGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1223
Summary {0: 1, 1: 0, 2: 4, 3: 72, 4: 1146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923119794 Original CRISPR CAGGGGAAGGGGAACGTGGA TGG Exonic
900116521 1:1031543-1031565 CAGGGGAAGGGGAACCAGGCAGG - Intronic
900197033 1:1381697-1381719 CAGGCTAGGGGGAACGTGGCGGG - Intergenic
900369916 1:2327690-2327712 CAGGGGGAGGGCCACGAGGAGGG + Intronic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900508940 1:3049062-3049084 CAGGGGAAGGAGACGCTGGATGG + Intergenic
900522294 1:3111515-3111537 GAGGGGAAGGGGAGAGCGGAGGG + Intronic
900557833 1:3289005-3289027 TAGGGGCAGGGGAACTTGGCTGG + Intronic
900663040 1:3795661-3795683 CAGGAGAAGGGGGAGTTGGAAGG + Intronic
900761939 1:4478577-4478599 CAGTTGGAGGGGAACGTGGGAGG - Intergenic
900804296 1:4757208-4757230 CAGGGGAGGCGGAAAGGGGAGGG - Intronic
900884756 1:5407147-5407169 CAGAGGCATGGGAACGTAGAAGG - Intergenic
901325598 1:8363460-8363482 AAGGGGCAGAGGAAAGTGGATGG + Intronic
901395901 1:8981397-8981419 AAGGGGAAGGGGAAAGGGAAGGG - Intergenic
901395904 1:8981403-8981425 AAGGGGAAGGGGAAGGGGAAAGG - Intergenic
901441790 1:9282518-9282540 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
901883089 1:12205303-12205325 CAGGGGGTGGGGAATGTGGCTGG + Intronic
901891843 1:12273561-12273583 CAGGGGATGGGGAGCGAGAAGGG - Intronic
902385155 1:16072222-16072244 CTGGGGAAGGGGAAGGTACAGGG - Intronic
902517633 1:16997875-16997897 AAGGGGAGGGGGAAGGAGGAGGG + Intronic
902525266 1:17053432-17053454 CAGGGGAAGGGAGAGATGGAGGG - Intronic
902536749 1:17123367-17123389 CAGGGGAAAGGGAATGTGACGGG - Intergenic
902570208 1:17342273-17342295 CAGGGGAGGGGGTAAGGGGAAGG - Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902905965 1:19557747-19557769 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
902906004 1:19557855-19557877 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
903015044 1:20356093-20356115 CAGGGGATGGGGAGTGTGCAGGG - Intergenic
903213720 1:21831955-21831977 CAGGGGATGGGTCACGGGGAGGG - Intronic
903362929 1:22788299-22788321 CAGGGGAAGATGAGAGTGGAAGG - Intronic
903420372 1:23214734-23214756 CAGGGCATGGGGCAGGTGGAGGG - Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904044881 1:27603167-27603189 AAGGGGGAGGGGGAGGTGGACGG - Intronic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904401844 1:30262091-30262113 CTGGGGAGGGGGAACAAGGAGGG - Intergenic
904431733 1:30468753-30468775 CAGGGGAAGGGGAGAGAGGGTGG - Intergenic
904599115 1:31664159-31664181 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
904599118 1:31664165-31664187 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
904599121 1:31664171-31664193 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
904599124 1:31664177-31664199 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
904652019 1:32013286-32013308 TTGGGGAAGGGAAACCTGGAGGG - Intergenic
904698106 1:32341846-32341868 CAGGGGAAGGGGGAGGGGAAGGG - Intergenic
904713260 1:32447765-32447787 TAGGGGAAGGGGAAGGAGGGGGG - Intergenic
904897585 1:33828528-33828550 TAGAGGAAGGGGAATGAGGAAGG + Intronic
904921152 1:34009348-34009370 CGGGGGTGGGGGAAGGTGGAAGG + Intronic
904989417 1:34579611-34579633 TAGGGGTAGGGAAATGTGGAGGG - Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905746866 1:40425473-40425495 CAGGGGTAGGGGAGAATGGAGGG + Intergenic
905906634 1:41622778-41622800 CAGGGGAAAGGGAAGGTGGCTGG + Intronic
906090250 1:43172561-43172583 CCGGGGGAGGGGAAAGGGGAGGG + Exonic
906090261 1:43172585-43172607 CAAGGGGAGGGGAAAGGGGAGGG + Intronic
906938272 1:50233787-50233809 CAGGGGAAGGGAAAAGTTGGAGG - Intergenic
907379777 1:54076927-54076949 AGGGGGATGGGGAACGTGGATGG + Intronic
907621291 1:55983455-55983477 AAGGGGAAGGGGAAGGGGCAGGG + Intergenic
907766117 1:57412212-57412234 CAGAGGAAGGGGAAAGTAGACGG - Intronic
908252476 1:62275894-62275916 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
908528243 1:65008616-65008638 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
908528246 1:65008622-65008644 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
909172517 1:72314809-72314831 CTGGGGAAGAGGTATGTGGATGG - Intergenic
909492645 1:76242596-76242618 CAGGGTGAGGGGAAAGGGGAGGG - Intronic
909506095 1:76391582-76391604 AAGGGGAAGGGGAAGGTGAAAGG - Intronic
911069084 1:93817878-93817900 TAGGGGAAGGTGAACTGGGAGGG - Intronic
911094381 1:94043999-94044021 AAAGGGAAGGGGAAGGAGGAAGG - Intronic
911569610 1:99507582-99507604 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
912212338 1:107569516-107569538 CTGGGGAAGAGGTATGTGGATGG + Intergenic
912530453 1:110317237-110317259 CCGGGGAAGGGGCCCGGGGAAGG + Intergenic
912757863 1:112339619-112339641 AAGGGGAAAGGGAACGCAGAGGG + Intergenic
913069268 1:115284742-115284764 CAGGGGAAGGGGGTCGTGTGAGG + Intergenic
913452471 1:119001397-119001419 CAGGGGAGGGGGAACAGGGCTGG + Intergenic
914677159 1:149914091-149914113 CAGGGGAATGGGAAGGGGAAGGG + Exonic
914965417 1:152253248-152253270 CTGGGGAAGAGGTATGTGGATGG - Intergenic
915161291 1:153922609-153922631 TGGGGGAAGGGAAAGGTGGAGGG - Intronic
915165061 1:153943956-153943978 CAAGGGAAGGGCAATGGGGATGG - Intronic
915168470 1:153962029-153962051 CAGGGAATGGGGAAGGGGGAGGG + Intronic
915393123 1:155562313-155562335 GAGGAGAAGGGAAAGGTGGAAGG + Exonic
915409278 1:155688219-155688241 GAGGAGAAGGGAAAGGTGGAGGG + Exonic
915555342 1:156657970-156657992 CCGGGGAAGGGGAAAGGAGAGGG - Intronic
915595441 1:156894007-156894029 GAGGGGAAGGGGACAGTGGAGGG + Intronic
915878797 1:159643419-159643441 GAGGGGGAGGGGAAGGGGGAGGG + Intergenic
916554814 1:165885105-165885127 CAGGGGAAGGGAGACAGGGAGGG - Intronic
916713316 1:167431108-167431130 CAGGGGCATGGGAAGGTGGGCGG - Exonic
916863971 1:168836742-168836764 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
917057101 1:170995084-170995106 CATAGGAAGGGGACCTTGGAAGG + Intronic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917764620 1:178202667-178202689 CTGGGGAAGAGGTATGTGGATGG + Intronic
917954897 1:180085097-180085119 AAGGGAAAGGGGAAAGGGGAAGG - Intronic
917954907 1:180085122-180085144 GAAGGGAAGGGGAAAGGGGAAGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918328999 1:183438198-183438220 AAGGGGAAGGGGAAAGGGAAGGG + Intergenic
918465432 1:184817017-184817039 CAGGGTGAGGGGCAGGTGGAGGG - Intronic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919090748 1:192976685-192976707 CTGGGGAAGGGGAATGTCAAAGG - Intergenic
919920991 1:202166294-202166316 GAGGGGCAGGGGAACCAGGATGG + Intergenic
919992241 1:202716163-202716185 CAGGGAGCGGGCAACGTGGAGGG + Intergenic
920013309 1:202886225-202886247 ACGGGGAACGGGAACGGGGAGGG + Intronic
920086469 1:203421307-203421329 GAGGGGAGGGGGAAAGGGGAGGG + Intergenic
920230577 1:204467132-204467154 CAGGGGATGGGGAAGGGTGAGGG + Intronic
920297341 1:204967118-204967140 CAGGACAAGGGAAAGGTGGAGGG - Intronic
920330256 1:205202131-205202153 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
920398187 1:205661286-205661308 AAGGGGAAGGGGAAGGAGAAAGG + Intronic
920441111 1:205980865-205980887 GAGGTGAAGGGGAAGGGGGAGGG - Intronic
921023791 1:211259531-211259553 CAGGGGAGGGGGAAAGGTGAGGG - Exonic
921160184 1:212466918-212466940 CAGGGGAAGTGGAACAAGGGTGG + Intergenic
922344086 1:224681637-224681659 CAGGGGAAGGGCAGCATGTAGGG - Intronic
922504020 1:226115948-226115970 GAGGGGGAGGGGGAGGTGGAGGG + Intergenic
922586257 1:226736914-226736936 CTGCGGAAGGGGCACGGGGAGGG + Exonic
922597341 1:226824127-226824149 AAGGGGAAGGTGAGAGTGGAGGG + Intergenic
922597420 1:226824582-226824604 CAGGAGATGAGGAATGTGGATGG - Intergenic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
923072427 1:230577865-230577887 AAGGGGAAGGGGAAGAAGGAGGG - Intergenic
923119794 1:230979136-230979158 CAGGGGAAGGGGAACGTGGATGG + Exonic
923373896 1:233340591-233340613 CAGGGGAAGGGGGAGGCAGATGG + Intronic
923534495 1:234838314-234838336 CAGGGGGAGGGGAAAGAAGAAGG + Intergenic
924190441 1:241546143-241546165 CAGGAGAAGGGCAAACTGGAAGG - Intronic
924262902 1:242250392-242250414 AAGGTGAAGGGGAATGGGGAAGG + Intronic
924286578 1:242493746-242493768 CAGGGGATGCTGAACATGGATGG - Intronic
924589758 1:245392619-245392641 CAGGGAAAGGGGAAGGGAGAGGG - Intronic
1062947375 10:1471888-1471910 CATAGGAAGGGGGATGTGGAGGG - Intronic
1063084835 10:2806965-2806987 CCGTGGAAGGAGACCGTGGAGGG + Intergenic
1063207576 10:3849122-3849144 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1063286249 10:4692074-4692096 AAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1063286254 10:4692086-4692108 AAGGAGAAGGGGAACGGGAAGGG + Intergenic
1063403944 10:5774886-5774908 CAGGGGAAGGGGAAGGGCAAGGG + Intronic
1063790978 10:9447521-9447543 GAGAGGAAGGGGAAGGGGGAAGG - Intergenic
1064364977 10:14699481-14699503 CAAGGGCAGGTGAAAGTGGATGG + Intronic
1064595739 10:16942896-16942918 AAGGGGAAGGGGAAGGGGAAAGG + Intronic
1064715667 10:18174213-18174235 AAGGGGAAGGGGAAGGAGAAAGG - Intronic
1065031379 10:21589903-21589925 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1065796370 10:29311960-29311982 AAAGGGAAGGGGAAGGGGGAGGG + Intronic
1066334636 10:34463219-34463241 AAGGGGAAGGGGAAGGGGAAAGG + Intronic
1066334650 10:34463259-34463281 AAGGGGAAGGGGGAAGAGGAAGG + Intronic
1066440215 10:35431364-35431386 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1066721884 10:38348062-38348084 AAGGTGAAGGGGAATGGGGAAGG - Intergenic
1067286310 10:44909995-44910017 AAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1067984865 10:51131623-51131645 CAGTGGAAGATGAATGTGGAAGG + Intronic
1068269172 10:54697658-54697680 AAGGGGAAGGGGGAAGGGGAAGG + Intronic
1069385921 10:67883641-67883663 CAGGGAGAGAGGAAAGTGGAAGG + Intergenic
1069622999 10:69849329-69849351 CAGGGGATGGGGAGCGGGGGTGG + Intronic
1069728036 10:70593807-70593829 CAGGTGATGGAGAACGTGAATGG + Intergenic
1069973967 10:72198062-72198084 GGGGGGAGGGGGAACGAGGAAGG + Intronic
1070025286 10:72626177-72626199 CAGAGGAAAAGGAACGGGGAGGG + Intronic
1070532837 10:77352369-77352391 AAGGGGAAAGGGAACGGGAATGG - Intronic
1070721349 10:78759417-78759439 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1070721352 10:78759423-78759445 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1070721355 10:78759429-78759451 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1070721358 10:78759435-78759457 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1070838495 10:79467043-79467065 CAGGGGCTGGGGAGGGTGGAGGG + Intergenic
1071093241 10:81944966-81944988 CAGGGGCAGTGGAATCTGGATGG - Intronic
1071316734 10:84408460-84408482 AAGGGGAAGAGGAACACGGAAGG - Intronic
1071807683 10:89142542-89142564 GAGGGGAAGGGGGAGGGGGAGGG + Intergenic
1071921781 10:90358441-90358463 GAGATGAAGGGGAGCGTGGATGG - Intergenic
1072564992 10:96609969-96609991 CATGGGAAGGGGAAGGGGAAGGG + Intronic
1072718562 10:97767228-97767250 GAGGGTAAGGGAAAGGTGGAGGG - Exonic
1073111193 10:101063868-101063890 AAGGGGAAGGGGGATCTGGAAGG + Intronic
1073930044 10:108565530-108565552 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1073930047 10:108565536-108565558 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1074289390 10:112127025-112127047 CAGAGGAAGGTGGACATGGAAGG + Intergenic
1074318006 10:112376445-112376467 CAGGGTAAGGGGACCATCGAGGG + Exonic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074813600 10:117127968-117127990 CTGAGGAAGGGGAACGTGATTGG - Intergenic
1074844881 10:117388981-117389003 CGGGGAAAGGGGAAAGTGAAGGG - Intergenic
1074924444 10:118053178-118053200 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1075065836 10:119288299-119288321 CAGGGGGAGGAGAAAGTGGAGGG + Intronic
1075108731 10:119560506-119560528 GAGGGGGAGGGGGAGGTGGAGGG + Intergenic
1075284509 10:121171851-121171873 AAGGGGAAGGGGAAAGGGAAGGG + Intergenic
1075724585 10:124604881-124604903 CAGGGGCAGGGGAAGGGGCAGGG - Intronic
1075785020 10:125043242-125043264 CAAGGGCAGGGGAAAGGGGAGGG + Intronic
1076574849 10:131457760-131457782 CAGTGGAAGATGAAAGTGGATGG + Intergenic
1076666801 10:132097888-132097910 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1076666804 10:132097894-132097916 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1076666807 10:132097900-132097922 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1076666837 10:132097978-132098000 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1076666840 10:132097984-132098006 GAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1076736245 10:132460448-132460470 GAGGGGAGGGGCCACGTGGAAGG - Intergenic
1076790687 10:132775212-132775234 CAGGGGGAGGGGCAGGGGGAGGG + Intronic
1076859414 10:133133568-133133590 CAGGGGACGGGGTAGGGGGAGGG + Intergenic
1077046990 11:551105-551127 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
1077091265 11:779399-779421 GAGGGGAAGAGGAATGGGGAGGG - Intronic
1077294250 11:1817156-1817178 CAGGGGCTGGGGGAGGTGGAGGG + Intergenic
1077299986 11:1842319-1842341 CTGGGCACGGGGAGCGTGGAGGG + Intergenic
1077364096 11:2154610-2154632 CAGGGGCAGGGGTGAGTGGAAGG - Intronic
1077378294 11:2215768-2215790 TAGGGGAAGGGGGACCAGGACGG + Intergenic
1077398201 11:2336992-2337014 TAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1077555481 11:3224021-3224043 GAGGGGAGGGGGAATGTGGATGG + Intergenic
1077874677 11:6294111-6294133 CAGGGGCAGGGGAAGGGGCAGGG + Intergenic
1078066092 11:8080666-8080688 CAAGGGAAGGGGAACATTTACGG - Intronic
1078179583 11:8999887-8999909 CAGGGTAAGGGGAATAGGGAAGG - Intronic
1078362569 11:10680537-10680559 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1078362572 11:10680543-10680565 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1078362575 11:10680549-10680571 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1078459116 11:11499833-11499855 CAGGTGATGGGTAATGTGGATGG + Intronic
1079206142 11:18416683-18416705 GAAGGGAAGGGGAAGATGGAAGG - Intronic
1079360311 11:19765445-19765467 GAGGGGAAGGGGAAGGGGAAGGG - Intronic
1080438543 11:32268928-32268950 AAGGGGAAGGGGAATGGGAAGGG + Intergenic
1080438550 11:32268940-32268962 AATGGGAAGGGGAAGGGGGAGGG + Intergenic
1080597975 11:33792486-33792508 CAGAGGAAAGAGAACGTGAAAGG + Intergenic
1080775109 11:35378869-35378891 AAGGGGAAGGAGAAGATGGAGGG + Intronic
1081862856 11:46343872-46343894 CAGGGGGAGGGGATCAGGGAGGG - Intronic
1082196800 11:49316257-49316279 AAGGGGAAGGGGTAAGGGGAAGG + Intergenic
1082217733 11:49595192-49595214 CATGGGAAGGAGAACAAGGAGGG + Intergenic
1083022550 11:59521698-59521720 AAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1083399685 11:62415004-62415026 GAGGGGAGAGGGCACGTGGAGGG - Intronic
1083593746 11:63909479-63909501 CAAAGGAAGGGGAGGGTGGATGG + Exonic
1083687247 11:64383881-64383903 CAGGGTAAGGGGAGGCTGGATGG + Intergenic
1083738013 11:64692747-64692769 GAGGGGAAGGGGACAGGGGAAGG + Intronic
1084308025 11:68299222-68299244 GGAGGGAAGGGGCACGTGGAAGG + Intergenic
1084398625 11:68931090-68931112 GAGTGGAAGGGGACAGTGGAAGG - Intronic
1084423720 11:69073041-69073063 CAAGGGCAGGGGAAACTGGAAGG - Intronic
1084432234 11:69117514-69117536 CTGGGGAAGGGGAGCGAGAAGGG + Intergenic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1084792505 11:71483469-71483491 CAGGGGAAGAGAAAGGAGGAGGG - Intronic
1084971379 11:72774094-72774116 CAGGGGCAGGAGATGGTGGAGGG + Intronic
1085112240 11:73898200-73898222 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085389157 11:76173522-76173544 CAGGGGGAGTGGCACCTGGACGG + Intergenic
1085445385 11:76597703-76597725 CAGTGGCAGGGGAGCGGGGACGG + Intergenic
1085759978 11:79233445-79233467 CAGGGGGACGGGAAGGAGGAGGG + Intronic
1086278698 11:85161084-85161106 CTGGGGAAGGGGTATGTGGATGG + Intronic
1086490657 11:87355122-87355144 CATGAGACGGGGAAGGTGGATGG - Intergenic
1086595904 11:88570047-88570069 AAGGGGAAGGGGAAAGGGAAGGG + Intronic
1086631840 11:89028958-89028980 CATGGGAAGGAGAACAGGGAGGG - Intronic
1086659021 11:89391922-89391944 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1086659024 11:89391928-89391950 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1087293484 11:96343334-96343356 CGGGGAAAGGGGAACGCAGAGGG + Intergenic
1087487174 11:98770785-98770807 GAGGGGAAGGGGGAGGGGGAGGG + Intergenic
1088746278 11:112807642-112807664 CAGGGGAAGTGGAAGTTAGAGGG + Intergenic
1088833304 11:113556641-113556663 CCAGGGAAGGGGCACATGGATGG - Intergenic
1088899978 11:114108548-114108570 GCAGGGAAGGGGAATGTGGAGGG - Intronic
1089064275 11:115650580-115650602 AAGGGGAGGGGGACGGTGGATGG - Intergenic
1089602985 11:119626565-119626587 CAGGGGAAGGGGGAGATGAAAGG + Intronic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1089786129 11:120908588-120908610 GAGGGAAAGGGGAAGGTGGCAGG + Intronic
1089865275 11:121626276-121626298 AAGGGGAAGGTGAACGTGAAGGG - Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090333918 11:125950478-125950500 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1090408133 11:126489646-126489668 GAGGGGAAGGGGCACGTCCAAGG - Intronic
1090505377 11:127306899-127306921 AAGGGGAAGGGGAAAGGGAAGGG - Intergenic
1090505388 11:127306923-127306945 AAGGGGAAGGGGAAAGGGAAAGG - Intergenic
1090601872 11:128380645-128380667 GAGGGGAAGGGGAAGAGGGAAGG - Intergenic
1090703226 11:129314789-129314811 GAGGGGAAGGGGGAAGGGGAAGG - Intergenic
1091129115 11:133129073-133129095 CAGGGGAAGGGGAAACAGGTGGG + Intronic
1091178705 11:133583843-133583865 CAGGGGTAAGGGAACCTGGTGGG + Intergenic
1091184905 11:133638374-133638396 GAAGGGAAGGGGAAGGTGGTGGG - Intergenic
1091319385 11:134639262-134639284 GAGGGGAAGGAGGACTTGGAGGG + Intergenic
1091698214 12:2642204-2642226 GAGGGCAAGGGGAGCCTGGATGG - Intronic
1091710148 12:2734121-2734143 CAGGGGAAGGGGAAGGGAAAGGG + Intergenic
1092140787 12:6182095-6182117 CAGGGGATGGGGACAGGGGATGG + Intergenic
1092514532 12:9195396-9195418 AAGGGGAAGGGGAAAGGGAAGGG - Intronic
1092817240 12:12322940-12322962 GAGGGGAAGGGGAAGGGAGAAGG + Intergenic
1093017644 12:14170961-14170983 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1093036431 12:14336312-14336334 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1093459225 12:19393271-19393293 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1093459228 12:19393277-19393299 AAGGGGAAGGGGAAGGGGGAAGG + Intergenic
1093591523 12:20907461-20907483 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1094003455 12:25721792-25721814 CAGGGGAAGGGAAATGAGGGTGG + Intergenic
1094023179 12:25935762-25935784 CAGAGGAAGGACAACGTTGAGGG + Intergenic
1094047377 12:26182558-26182580 AAGGGGAAGGGGAAGGGAGACGG - Intronic
1094047378 12:26182564-26182586 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1094103080 12:26784361-26784383 CCGTGGAAGGAGACCGTGGAGGG - Intronic
1094380758 12:29840663-29840685 AAGGGGAAGGGAAAAGTGAAGGG - Intergenic
1094843627 12:34352097-34352119 AAGGGGCAGGGAAACGTGAAAGG - Intergenic
1095844299 12:46729342-46729364 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1096183939 12:49566278-49566300 CAGGGGAAGGGGGCTGGGGAGGG - Intronic
1096220476 12:49825847-49825869 CAGGTGAAGGGGAATGTTGAAGG - Intronic
1096618449 12:52847759-52847781 CTGGGGAATGGGGACGCGGAGGG + Intronic
1096745588 12:53724864-53724886 CAAGAGAAAGGGAAAGTGGAGGG + Intronic
1096877904 12:54644843-54644865 TAGGGGAAGGGGAAGGGGAAGGG + Intronic
1097658286 12:62396649-62396671 AAGGGGAAGGAGAACGTGGAGGG - Intronic
1097911751 12:64977927-64977949 CAGGGGAGGGGGAATGGGGGAGG - Intergenic
1099212416 12:79808248-79808270 CAGAGTAAGGGGAAAGTGGGAGG - Intronic
1099776492 12:87138183-87138205 CAGGGGTTGGGGTACTTGGAGGG - Intergenic
1100206326 12:92354190-92354212 CACAGGATGGGGAACGTGGCTGG - Intergenic
1100250370 12:92815365-92815387 AAGGGGGAGGGGAATGAGGAGGG - Intronic
1100256334 12:92886626-92886648 GAGGGGAGGGGGAAGGGGGAAGG + Intronic
1100874291 12:98945976-98945998 AAGGGGATGGAGAAGGTGGATGG - Intronic
1101909508 12:108850759-108850781 TCGGGGGAGGGGAACCTGGAGGG + Intronic
1102175195 12:110868743-110868765 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1102175199 12:110868749-110868771 GAGGGGAAGGGGGAGGGGGAGGG + Intronic
1102408773 12:112698861-112698883 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1102511083 12:113415985-113416007 CAGGGGCTGGAGAAAGTGGAGGG - Intronic
1102545545 12:113652417-113652439 CAGGGGAAGTGGAACGAGGTGGG - Intergenic
1102681181 12:114691800-114691822 TAGAGGAAGGGGAATGAGGAAGG + Intergenic
1102884114 12:116508737-116508759 CAGGGCAGGGGGAACGGGGAAGG - Intergenic
1103003757 12:117405937-117405959 CAGGAGAATGGGGACATGGAAGG - Intronic
1103371566 12:120423311-120423333 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1103371569 12:120423317-120423339 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1103567256 12:121822997-121823019 CAGGGGAAGGGGCAGAGGGAGGG - Exonic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103873863 12:124112118-124112140 CAGGTGAAGGGGTGCATGGATGG - Intronic
1103970390 12:124667175-124667197 CCTGGAAAGGGGAACATGGAAGG + Intergenic
1104622973 12:130332167-130332189 CTGGGGGAGGGGAACGGGGTTGG - Intergenic
1104748037 12:131221992-131222014 CAGGGCTGGGGGAAGGTGGAGGG + Intergenic
1104842706 12:131832304-131832326 CGGGGGGACGGGAACGGGGAAGG + Intronic
1104854392 12:131895141-131895163 CAGGGGCAGGGGATCCTGGGCGG - Intronic
1104914234 12:132256587-132256609 CAGTGGAGGGGGACAGTGGAGGG + Intronic
1104957729 12:132474630-132474652 GAGGGGAAGGGCACCGCGGAGGG - Intergenic
1104983012 12:132582407-132582429 TGGGGGAGGGGGAACGGGGAAGG - Intronic
1105069200 12:133224183-133224205 GAGGGGAAAGGGAAAATGGAGGG + Intronic
1106102642 13:26708046-26708068 CAGGGGCAGGGGAATGAGGTGGG - Intergenic
1106413448 13:29526607-29526629 CAGGGCAAGTGGAAAGTGCAGGG + Intronic
1106597879 13:31161998-31162020 AAGCGGAAGTGGCACGTGGAGGG - Intronic
1106771506 13:32965266-32965288 AAGGGGAAGGGGAAAGGGAAGGG - Intergenic
1106771509 13:32965272-32965294 AAGGGGAAGGGGAAGGGGAAAGG - Intergenic
1107795448 13:44046891-44046913 AAGGGGAAGGGGAAAGGGAAGGG - Intergenic
1107795456 13:44046909-44046931 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1107817737 13:44259263-44259285 CAGGGGTGGGGGAAAGTGGTGGG - Intergenic
1108550879 13:51542609-51542631 CAGGGGTCGGGGGAAGTGGAGGG - Intergenic
1109833677 13:67827153-67827175 CAGGGGATGGGGGAAGTGAAAGG + Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110450692 13:75635793-75635815 CAGGGGGCGGGGAGCGTGGGAGG + Intronic
1110788358 13:79560185-79560207 AGGGGGAAGGGGGAAGTGGAGGG - Intergenic
1111057711 13:82972392-82972414 TTGGGGAAGGGGTATGTGGATGG - Intergenic
1111399970 13:87721391-87721413 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1111624672 13:90769381-90769403 CAGGGGAAGCTGAAAGTGAAGGG + Intergenic
1111995109 13:95158125-95158147 AAGGGGAAGGTAAACCTGGAAGG - Intronic
1112015736 13:95330045-95330067 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1112177105 13:97036586-97036608 GAGGGGAAGGGGAATGGGAAGGG + Intergenic
1112199284 13:97259524-97259546 CGGGGGAAGGGGGACATGCATGG - Intronic
1113613288 13:111663305-111663327 GAGGGGAAGGGGAATGGGAAGGG - Intronic
1113749168 13:112766615-112766637 TAAGGGAAGGGGAAGGGGGAGGG + Intronic
1114054434 14:18954596-18954618 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1114070110 14:19099026-19099048 CCGGGGCAGGGAAGCGTGGACGG + Intergenic
1114092153 14:19300976-19300998 CCGGGGCAGGGAAGCGTGGACGG - Intergenic
1114108120 14:19447336-19447358 CAGGGGAAGGAGGAGATGGAAGG + Intergenic
1114198930 14:20505324-20505346 CCGTGGAAGGAGACCGTGGAGGG - Intergenic
1114224587 14:20725962-20725984 AAGGGGAAGGGGAAGGGGAACGG + Intergenic
1114224590 14:20725968-20725990 AAGGGGAAGGGGAACGGGAAGGG + Intergenic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114880279 14:26776407-26776429 TAGGGGAAGGGGGACTTGGCAGG + Intergenic
1115120317 14:29929088-29929110 CAGAGGAAGGGGAAAGTCTAGGG - Intronic
1115529356 14:34312790-34312812 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1115657990 14:35462538-35462560 GAGGGGAAGGGGAGGGAGGAAGG - Intergenic
1116501940 14:45634477-45634499 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1117611043 14:57483834-57483856 CATGCAATGGGGAACGTGGAGGG + Intronic
1117667851 14:58076094-58076116 GAGGGGAAGGGGGAGGGGGAAGG + Intronic
1117993033 14:61453629-61453651 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1118251929 14:64170295-64170317 CAGAGGAAGGGTGACGTTGATGG + Exonic
1118706225 14:68483014-68483036 TAGGGGAAGGGAAAGGTGGATGG + Intronic
1118775662 14:68972364-68972386 CAGGGGAAGAGGGACAAGGATGG + Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1118973146 14:70654224-70654246 GAGGGGAAGAGGAACTTGGGAGG - Intronic
1119023305 14:71133333-71133355 CAGGGGTAGAGGCACATGGACGG - Intergenic
1119559135 14:75576433-75576455 CATGGGAAAGGCCACGTGGAAGG + Intergenic
1119655429 14:76413886-76413908 CAGGGGCAGGGGACGGTGCAGGG - Intronic
1119655480 14:76414028-76414050 CAGGGGCAGGGGACGGTGCAGGG - Intronic
1119751368 14:77080202-77080224 CAAGGGAAGGGGAAAGAGTAAGG - Intergenic
1119862830 14:77948878-77948900 TAGGGGAAGGGGGAGGGGGAAGG - Intergenic
1119862833 14:77948884-77948906 GAGGGGTAGGGGAAGGGGGAGGG - Intergenic
1119932008 14:78556901-78556923 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1120281447 14:82443651-82443673 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1120281450 14:82443657-82443679 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1120395877 14:83966365-83966387 TTTGGGAAGGGGAACGTAGAGGG - Intergenic
1120498327 14:85262952-85262974 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1120923170 14:89773204-89773226 AAGGGGAAAGAGCACGTGGAGGG + Intergenic
1121121844 14:91380904-91380926 AAGGAGAATGGGAACTTGGAAGG + Intronic
1121506146 14:94479077-94479099 CATGGGAAGGAGAAAGTGGGAGG + Intronic
1121769877 14:96524481-96524503 AAGGGGAAGGGGAACGGGAAGGG - Intronic
1121928710 14:97952522-97952544 GAGGGAAAGGGGAAAGGGGAGGG - Intronic
1122058837 14:99123282-99123304 CAGGGGAAGAGGGAAGGGGAAGG - Intergenic
1122300405 14:100728063-100728085 GCGGGGACGGGGACCGTGGAGGG - Intronic
1122545042 14:102517324-102517346 CTGGGGGAGGGGAACCCGGAAGG - Intergenic
1122640096 14:103154788-103154810 AAGGGGAAGGGGAAGGTGGCAGG + Intergenic
1122782633 14:104150128-104150150 GAGGGGGAGGGGGACGGGGAGGG - Intronic
1122802885 14:104240510-104240532 CAGGGGGAGGGGAATGAGGCTGG - Intergenic
1122980466 14:105189989-105190011 CAGGGGCTGGGGAGCATGGACGG + Intergenic
1123053731 14:105559792-105559814 CAGGGGCAGGGGCACGGGCAGGG - Intergenic
1123078311 14:105680203-105680225 CAGGGGCAGGGGCACGGGCAGGG - Intergenic
1123645297 15:22433505-22433527 CAGGGGACGGGGCAGGTGGTTGG + Intergenic
1123666565 15:22613146-22613168 CAGGGGATGGGGCAGGTGGTTGG + Intergenic
1123733014 15:23161839-23161861 CAGGGGACGGGGCAGGTGGTTGG - Intergenic
1123751143 15:23359216-23359238 CAGGGGACGGGGCAGGTGGTTGG - Intronic
1123784271 15:23653630-23653652 CAGGGGTAGGGGGACAGGGATGG - Intergenic
1124013886 15:25860663-25860685 GAAGGGGAGGGGAACGTAGATGG + Intronic
1124283518 15:28383134-28383156 CAGGGGACGGGGCAGGTGGTTGG - Intronic
1124299180 15:28528479-28528501 CAGGGGACGGGGCAGGTGGTTGG + Intronic
1124320408 15:28707719-28707741 CAGGGGATGGGGCAGGTGGTTGG + Intronic
1124482106 15:30087691-30087713 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124488564 15:30139791-30139813 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124521482 15:30409512-30409534 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124537179 15:30556707-30556729 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1124543650 15:30608763-30608785 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124612235 15:31216219-31216241 GAGGGGAAGGGGGAGGCGGAGGG + Intergenic
1124754964 15:32398531-32398553 CAGGGGATGGGGCAGGTGGTTGG + Intronic
1124761474 15:32450884-32450906 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124777158 15:32598184-32598206 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1125539341 15:40460758-40460780 CAGGGGAAGGGAGATCTGGAAGG - Intronic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126142501 15:45449771-45449793 GAGGGGAAGGGGAGGGAGGAGGG + Intergenic
1126380649 15:48043331-48043353 GAGGTGAAGGGGAACAAGGAGGG - Intergenic
1127122224 15:55781551-55781573 CAGGAGAATGGGAACCTGGGAGG - Intergenic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128647185 15:69386614-69386636 CAGGGGAGGGGGGACATGGAGGG - Intronic
1129044877 15:72725761-72725783 AAGGGGAAGAGGAAGGGGGAAGG - Intronic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129189722 15:73930311-73930333 TAGGGGAAGGGGCACCTGGATGG - Intronic
1129778941 15:78256518-78256540 CAGGGTAGAGTGAACGTGGAAGG - Intergenic
1130171632 15:81520571-81520593 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1130171635 15:81520577-81520599 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1130552627 15:84900835-84900857 AAGGGGAAGGGGAAAGGGAAGGG + Intronic
1130555612 15:84920464-84920486 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1130555615 15:84920470-84920492 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1130702994 15:86204487-86204509 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1130702997 15:86204493-86204515 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1130703000 15:86204499-86204521 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1130869265 15:87957425-87957447 CAGGGGCAGTGGAACCTGGGTGG - Intronic
1130991264 15:88877410-88877432 GAGGGGAAGGGGAACGGGGAGGG + Exonic
1131117857 15:89805540-89805562 CAGGGAAAGGGGTACATGGAAGG + Intronic
1131641573 15:94299029-94299051 AAGGGGAAGGGGGAGGGGGAGGG - Intronic
1131641577 15:94299035-94299057 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1131797550 15:96034922-96034944 CAGAGCAAAGGGAACGTGCAAGG - Intergenic
1131948402 15:97652858-97652880 CAGGTGAACGGGGAAGTGGAAGG + Intergenic
1132240399 15:100253367-100253389 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240407 15:100253385-100253407 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240415 15:100253403-100253425 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240423 15:100253421-100253443 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240431 15:100253439-100253461 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240439 15:100253457-100253479 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240446 15:100253475-100253497 GAGGGGGAGGGGAACGTAGAGGG + Intronic
1132240454 15:100253493-100253515 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132296176 15:100736387-100736409 CTGGGGACGGGGAATGGGGATGG - Intergenic
1132325765 15:100968792-100968814 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1132406290 15:101543381-101543403 CAAGGGAAGCGGAAGGAGGAAGG - Intergenic
1132570512 16:642055-642077 CCGGGGAACGGGAACGGGGACGG + Intronic
1132854388 16:2038413-2038435 AAGGGGGAGGGGAAGGGGGAGGG - Exonic
1133039434 16:3052541-3052563 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133043277 16:3072174-3072196 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133231010 16:4366453-4366475 GAGGGGAATGGGGACCTGGAAGG + Intronic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1133344034 16:5058442-5058464 CAGGGGAAGGGGAAGGAAAAAGG - Intronic
1133578943 16:7124492-7124514 GAGGGGAGGGGGAGCGAGGAAGG - Intronic
1133706574 16:8360326-8360348 CAGAGGAAGGTGAACCTGGGAGG - Intergenic
1133786963 16:8981462-8981484 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1133964242 16:10519413-10519435 AAGGGGAAGGGGAACGGGAAGGG - Intergenic
1133964245 16:10519419-10519441 GAGGGGAAGGGGAAGGGGAACGG - Intergenic
1134295235 16:12939686-12939708 CAGGTGATGGGGAAAGAGGAAGG - Intronic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1134770608 16:16806056-16806078 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1134770624 16:16806093-16806115 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1134770627 16:16806099-16806121 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1134770630 16:16806105-16806127 GAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1135186103 16:20317050-20317072 AAGGGGAAGGGGAAAGAGAACGG - Intronic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135624309 16:23981841-23981863 GAGGGGAAGGGGAAGGGGAAGGG - Intronic
1135624387 16:23982032-23982054 AAAGGGAAGGGGAAGGTGAAGGG - Intronic
1135667939 16:24351589-24351611 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1135667942 16:24351595-24351617 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1135667955 16:24351622-24351644 GAGGGGAAGGGGAAGGGGAAGGG + Intronic
1135669550 16:24363384-24363406 TGGGGGAATGGGAAGGTGGATGG + Intergenic
1136455098 16:30375919-30375941 GAGGGGACGGGGAAACTGGAAGG + Intronic
1136478665 16:30527740-30527762 CAGGCGCTGGGGAAGGTGGAGGG - Intronic
1136544404 16:30947587-30947609 CAGGGGCTGGGGGAGGTGGAAGG + Exonic
1136571957 16:31103641-31103663 CCGTGGAAGGAGACCGTGGAGGG - Intergenic
1136598422 16:31267397-31267419 TAAGAGAAGGGGAAAGTGGAGGG - Intronic
1137232376 16:46578230-46578252 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1137232398 16:46578284-46578306 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1137232401 16:46578290-46578312 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1137577244 16:49608307-49608329 GAGGGGAGGGGGAAGGAGGAGGG + Intronic
1137689704 16:50414402-50414424 AAGGGGAAGGGGAAGGGGAAAGG - Intergenic
1137689706 16:50414408-50414430 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1137942491 16:52702603-52702625 CAGGGGAGGAGGAGGGTGGATGG - Intergenic
1138009186 16:53361988-53362010 CAGGGGATGGGGCAGGTGGTTGG + Intergenic
1138227296 16:55307634-55307656 CATGGGAAGGGGAATGGGAAAGG + Intergenic
1138458804 16:57135954-57135976 AAGGGGAAGGGGAAGGGAGAAGG + Intronic
1139060948 16:63250702-63250724 GAGGGGAAGGGGAAGGAGGAGGG + Intergenic
1141896052 16:86959365-86959387 AAGGGGAAGGGGAAGATGGATGG + Intergenic
1141961421 16:87411839-87411861 AAGGGGAAGGTGAACACGGACGG + Exonic
1142251721 16:88994963-88994985 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1142259318 16:89035219-89035241 GAGGGGGAGGGGGACGAGGAAGG - Intergenic
1142388823 16:89784713-89784735 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1142818393 17:2446620-2446642 CCGTGGAAGGAGACCGTGGAGGG - Intronic
1143090815 17:4448236-4448258 CAGGGGGAGGGGGCCGTGGGAGG + Exonic
1143374468 17:6459074-6459096 CAGGTGAATGAGAAGGTGGAAGG - Intronic
1143595547 17:7911665-7911687 CAAGGGGTGGGGAAGGTGGAGGG - Exonic
1143632293 17:8146209-8146231 AAGGGGAAGGGGATGGTGGTAGG + Intronic
1143690261 17:8556601-8556623 CAGGGGCAGGGGCAGGAGGAGGG + Intronic
1144560965 17:16320124-16320146 AAGGGGAAGGGGAAAGGGAAGGG + Intronic
1144649614 17:16999037-16999059 CAGGGGCTGGGGAAGGGGGAAGG - Intergenic
1144650541 17:17004357-17004379 CAGGGGCAGGGGCAGGAGGACGG - Intergenic
1144675327 17:17158205-17158227 GAGGGGGAGGGGGACGGGGAGGG - Intronic
1144746812 17:17621466-17621488 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1145042876 17:19589900-19589922 CGGGGGAAGGGGCATGTGCAGGG - Intergenic
1145875791 17:28317650-28317672 CAAGGGAAGGGGAAGCTGGGCGG + Intergenic
1146263127 17:31434383-31434405 CAGGGAAAGTGGCAAGTGGAGGG + Intronic
1146514132 17:33475798-33475820 CAGGGGATGGGGATGGGGGAGGG - Intronic
1146803660 17:35847866-35847888 TAGGGAAAGGCGAATGTGGAGGG + Intronic
1146930095 17:36770873-36770895 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1146930098 17:36770879-36770901 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1147565609 17:41534832-41534854 CAGGGGTGGGGGCACGAGGATGG - Intergenic
1147599782 17:41738666-41738688 CAGGGGAGGGGGCAGGAGGAGGG - Intergenic
1147754180 17:42757355-42757377 AAGGGGAAGGGGAAAAAGGAAGG - Intergenic
1147782361 17:42952758-42952780 CAGAGGAAGAGGAAAATGGACGG + Intronic
1147932926 17:43994365-43994387 CAGGGGAAGGGTAAAGCCGACGG - Intronic
1148079623 17:44960492-44960514 CGGGGGAGGGGGAGCGTGGCAGG - Intronic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148767160 17:50046130-50046152 AAGGGGAAGGGGAACGGGAAGGG + Intergenic
1148875459 17:50684351-50684373 CGGGGGAAGGGGTTCTTGGAGGG - Intronic
1149040411 17:52181832-52181854 CAGAGGAAGGGAAAGGTGGTGGG - Intergenic
1149315138 17:55431869-55431891 CAGGGGGAGGGGGAGGGGGAGGG + Intergenic
1149835208 17:59906353-59906375 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1150606402 17:66694999-66695021 TAGGGGAAGGGGAAAGGTGAGGG + Intronic
1150685317 17:67316068-67316090 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1150760854 17:67959660-67959682 GAGGGGGAGGTGAAGGTGGAGGG - Exonic
1151039157 17:70838694-70838716 CAGGGGATGGGTAAAGTGGCGGG - Intergenic
1151327683 17:73388974-73388996 GAGGGGAAGGGGAAGGGGAAGGG - Intronic
1151716372 17:75833092-75833114 CAGGGGAAGGGGATGGGGGTGGG - Intronic
1152417336 17:80171146-80171168 GAGGGGAAGGGGAAGGTGAATGG - Intronic
1152521028 17:80857157-80857179 CAGGGGAGGGAGGGCGTGGAGGG - Intronic
1152609217 17:81307443-81307465 AAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1152609221 17:81307449-81307471 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1152609255 17:81307532-81307554 AAGGGGAAGGGGAAGGGGGACGG - Intergenic
1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG + Intronic
1152720185 17:81919770-81919792 CAGGGGAAGGGGAAGAGGGGTGG + Exonic
1152960026 18:74031-74053 AAGGGGAAGGGGAAGGGAGAAGG + Intergenic
1153708472 18:7772426-7772448 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1154111936 18:11577692-11577714 AAGGGGAAGGGGAAGGTGGGAGG + Intergenic
1155960839 18:31993501-31993523 AAGGGGAAGGGGCATGTGTAAGG + Intergenic
1156700494 18:39819065-39819087 GAGGGGAAGGGAAGCGGGGAAGG + Intergenic
1157331909 18:46710467-46710489 AAGGGGAAGGGGAAGGGAGAAGG - Intronic
1157331910 18:46710473-46710495 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1157422681 18:47559574-47559596 AAGGGGAAGGAGAAAGGGGAAGG - Intergenic
1157422691 18:47559604-47559626 CAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1157468830 18:47971895-47971917 CAGGGGATGGGGTAGGGGGAAGG - Intergenic
1158178384 18:54683802-54683824 TGGTGGAAGGGGAACGTGAAGGG + Intergenic
1158259708 18:55592958-55592980 CTGGGGAAGGGGAACATTGCAGG - Intronic
1158423107 18:57313436-57313458 AAGGGGAGGGGGAAGGGGGAAGG + Intergenic
1158859699 18:61580434-61580456 CAGGGGAAGGGGAAAGGAGAAGG - Intergenic
1159420330 18:68210605-68210627 GAGGTGAAGGGGAAAGTGGCAGG + Intergenic
1160248221 18:77178047-77178069 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
1161366955 19:3885602-3885624 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1161632399 19:5364813-5364835 CAGGGGATGTGGAACGAGGATGG + Intergenic
1161797191 19:6393845-6393867 CAGGAGAAGGGTAACGTCGCGGG + Intronic
1161821607 19:6533711-6533733 GAGGGGAAGGGGACTCTGGAGGG - Intronic
1161932367 19:7349447-7349469 CAGGGGACGGGGATCCTTGAGGG + Intronic
1161942028 19:7411256-7411278 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1162119159 19:8451530-8451552 CAAGGGAAGGGGAAGGGGAAGGG - Intronic
1162145537 19:8610740-8610762 CAGGGGAGGGGGCGCGGGGAAGG + Intergenic
1162686198 19:12386509-12386531 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1162686201 19:12386515-12386537 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1162686204 19:12386521-12386543 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1162704243 19:12543333-12543355 GAGGGGAAGGGGAAGGGGAAGGG + Intronic
1162704246 19:12543339-12543361 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1162704248 19:12543345-12543367 AAGGGGAAGGGGAAGGGGAAAGG + Intronic
1162704251 19:12543351-12543373 AAGGGGAAGGGGAAAGGGAAGGG + Intronic
1162828599 19:13269993-13270015 CAGGGGAAGGGAATAGGGGAAGG - Intronic
1162850030 19:13423964-13423986 CAGGGCAAGGGGGCTGTGGAGGG - Intronic
1162876782 19:13626590-13626612 AAGGGGAAAGGGAAGGGGGAAGG + Intergenic
1163004561 19:14389259-14389281 GAGGGGGAGGGGAAGGGGGAAGG + Intronic
1163004565 19:14389265-14389287 GAGGGGAAGGGGGAAGGGGAGGG + Intronic
1163004581 19:14389294-14389316 GAGGGGAAGGGGGAAGGGGAGGG + Intronic
1163101402 19:15099200-15099222 AAGGGGAAGGGGAAGGGGAAAGG + Intergenic
1163101404 19:15099206-15099228 AAGGGGAAGGGGAAAGGGAAAGG + Intergenic
1163211682 19:15845483-15845505 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1163370959 19:16901049-16901071 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1163445248 19:17342081-17342103 AAGGGGAAGGGGAAAGGGAAAGG - Intronic
1163445250 19:17342087-17342109 AAGGGGAAGGGGAAGGGGAAAGG - Intronic
1163445252 19:17342093-17342115 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1163445255 19:17342099-17342121 TAGGGGAAGGGGAAGGGGAAGGG - Intronic
1163744065 19:19034348-19034370 GCGGGGAAGAGGAACTTGGAAGG + Intronic
1163804883 19:19389669-19389691 CAGGGGAAGGGAAAGTTGGAGGG + Intronic
1164680556 19:30131195-30131217 AAGGGGAAGGGGAAGGGAGAAGG - Intergenic
1164680557 19:30131201-30131223 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1164680560 19:30131207-30131229 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1164976522 19:32576998-32577020 AAGGGGAAGGGGAATGGGAAAGG - Intergenic
1164976524 19:32577004-32577026 AAGGGGAAGGGGAAGGGGAATGG - Intergenic
1165077274 19:33286844-33286866 CAGGGGTAAGGGAATGAGGATGG + Intergenic
1165477861 19:36042074-36042096 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1166561337 19:43734205-43734227 CAGGGCAGTGGGAACTTGGAAGG + Intronic
1166674935 19:44734633-44734655 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1166674938 19:44734639-44734661 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1166674941 19:44734645-44734667 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1167140105 19:47644470-47644492 TAGGGGAAGGGGAAGGGGTAGGG - Intronic
1167246434 19:48375892-48375914 CAGAGGAAGCGGCACCTGGAAGG - Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167331023 19:48856254-48856276 GAGGGGAAGGGGAAGGGGAAGGG + Intronic
1167410351 19:49340427-49340449 CAGGGGAATGTGAAGGCGGAGGG - Exonic
1167440683 19:49507036-49507058 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1168296659 19:55380329-55380351 GAGGGGAGGGGGAAGGGGGAAGG - Intronic
1168301647 19:55408039-55408061 GAGAGGAAGGGGGACGGGGAAGG + Intergenic
1168350292 19:55671664-55671686 CAAGGGAAGGGGACTCTGGAGGG - Intronic
1168509263 19:56961527-56961549 GAGGGGAGGGGGAAAGAGGAGGG - Intergenic
1168509788 19:56965378-56965400 CAGGGGCTGGGGAAGGGGGACGG - Intergenic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
925038319 2:709287-709309 CCGGGGAAGAAGAAGGTGGAAGG - Intergenic
925283439 2:2700941-2700963 GAGGGGAAGGGGAGGATGGAGGG - Intergenic
925548309 2:5041803-5041825 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
925548322 2:5041832-5041854 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
925573395 2:5334869-5334891 AAGGGGAAGGGGAAAGGGAAGGG + Intergenic
925573403 2:5334887-5334909 AAGGGGAAGGGGAAAGGGAAGGG + Intergenic
925573411 2:5334905-5334927 AAGGGGAAGGGGAAAGGGAAGGG + Intergenic
925601928 2:5616967-5616989 CATGGGAAGGGGAATGTATATGG + Intergenic
925683987 2:6453058-6453080 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
925683990 2:6453064-6453086 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
925683993 2:6453070-6453092 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
925684057 2:6453212-6453234 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
925684068 2:6453235-6453257 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
925755313 2:7127941-7127963 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755418 2:7128135-7128157 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755441 2:7128176-7128198 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755464 2:7128217-7128239 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755471 2:7128230-7128252 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755494 2:7128271-7128293 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925927587 2:8681672-8681694 AAGGGGGAGGGGAAGGAGGAGGG - Intronic
925927592 2:8681684-8681706 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
925946611 2:8870004-8870026 GGGGGGCAGGGGAACATGGAAGG - Intronic
926305807 2:11636771-11636793 CAGGGGCAGGGGCACGGGCATGG + Intronic
927000631 2:18791039-18791061 AAGGGGAAGGGGAAAGGGAAGGG - Intergenic
927343558 2:22010226-22010248 GAGGGGAAAGGGAAGGGGGAGGG - Intergenic
927708832 2:25312962-25312984 CAGGGGAAGGGGAGCAGGCAGGG + Intronic
927861854 2:26565064-26565086 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
927861857 2:26565070-26565092 TAGGGGAAGGGGAAGGGGAAGGG - Intronic
928268305 2:29831177-29831199 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
928268308 2:29831183-29831205 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
928836377 2:35551724-35551746 CAGGGGAAGGGCATGGTGGGAGG - Intergenic
929248960 2:39732010-39732032 CTCGGGAAGAGGAATGTGGATGG - Intergenic
929385702 2:41403699-41403721 GAGAGGAAGGGGAAAGAGGATGG + Intergenic
929481232 2:42310329-42310351 AAGGGGAAGGGGAAGGAGAAGGG - Intronic
929692644 2:44087302-44087324 CAGGGGAAGCGGACCTGGGACGG - Intergenic
929739336 2:44587438-44587460 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
930084096 2:47480306-47480328 GAGGGGGAGGGGAAAGGGGAAGG - Intronic
930288558 2:49465440-49465462 AAGGGGAAAGGGAAAGGGGAAGG - Intergenic
930327073 2:49933427-49933449 CAGGTGAAGAGGAATGTGGCTGG - Intronic
931826297 2:66004184-66004206 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
932075800 2:68661622-68661644 CAGGGGACTGTGAACTTGGATGG - Intergenic
932622992 2:73277109-73277131 CAGGGGAAGGGGAAAGTCTGGGG + Intronic
932744889 2:74325862-74325884 GAGGGGAGGGGGAAAGGGGAAGG + Intronic
932744896 2:74325875-74325897 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
932921648 2:75921541-75921563 CTGGGGAAGGGAAAAGGGGAGGG + Intergenic
933226196 2:79752051-79752073 CAGGGGCAGGGGAGAGTGTACGG + Intronic
933383475 2:81581434-81581456 GAGGAGAAGGGGAACATGAAGGG + Intergenic
934750703 2:96792440-96792462 GAGGGGAAGGGGAGCGGGGAAGG - Intronic
935308416 2:101759672-101759694 GAGGGGGAGGGGAATGGGGAGGG - Intronic
935564219 2:104589620-104589642 CTGGGGAAGAGGTATGTGGATGG - Intergenic
936536508 2:113315791-113315813 GAGGGGAAGGGTAAAGTGAAAGG + Intergenic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
936918914 2:117668001-117668023 GAGGGGAAGAAGACCGTGGAAGG - Intergenic
937057493 2:118952028-118952050 TAGGGGAAGGGGAAGGAGAAGGG - Intronic
937130893 2:119512310-119512332 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
937130896 2:119512316-119512338 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
937130899 2:119512322-119512344 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
937777526 2:125797293-125797315 GAGGGGGAGGGGGACGGGGAGGG + Intergenic
937985027 2:127634573-127634595 CTGGGGAAGGGGAAGGTACAGGG - Intronic
938043416 2:128095389-128095411 AAGGGGAAGGGGAAGGAGAAGGG - Intronic
938043423 2:128095407-128095429 GAGGGGAAGGGGAAGGTAAAGGG - Intronic
938366204 2:130736583-130736605 CAGGGGAGAGGGAAAGTGGGAGG - Intergenic
938900721 2:135796751-135796773 CAGGGGGAGGGGTCCATGGAAGG - Intronic
939144257 2:138393906-138393928 CAGAGGAAGGTGAATGCGGAAGG - Intergenic
939787697 2:146537454-146537476 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
940216145 2:151305426-151305448 AAGGGGAAGGGGAAGGAGAAGGG + Intergenic
940372941 2:152922907-152922929 GAGGGGAAGGGGAAGGGGAAGGG - Intergenic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
940605727 2:155922646-155922668 TAGGGGAAGGGAAACCTCGAAGG - Intergenic
940901663 2:159131507-159131529 CAGGGGAAGGGGCGGGGGGAGGG - Intronic
941038196 2:160590516-160590538 GAGGGGAAGGAGAAGGGGGAGGG - Intergenic
941038216 2:160590564-160590586 AAGGGGAAGGGGGAAGAGGAAGG - Intergenic
941038226 2:160590594-160590616 GAGGAGAAGGGGAAGGGGGAGGG - Intergenic
941234030 2:162946641-162946663 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
941760650 2:169238925-169238947 AAGGGGAAAGAGAAAGTGGAGGG - Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942239454 2:173946227-173946249 CTGGGAAAGGGGTACATGGAAGG + Intronic
943081691 2:183264765-183264787 AAGGGGAAGGGGAAAGGGAAGGG - Intergenic
943805630 2:192121447-192121469 GAGGGGAAGGAGGAGGTGGAAGG + Intronic
943921529 2:193713251-193713273 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
943921532 2:193713257-193713279 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
944036164 2:195296854-195296876 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
944128284 2:196318656-196318678 CAGCGGAGGGGGAGCCTGGAGGG - Exonic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945266409 2:207895503-207895525 CAGGGGAAGGAGACTGTGAAAGG - Intronic
945314733 2:208359822-208359844 CAGGGGAAGGCGAGGGTGGCTGG + Intronic
945506439 2:210647113-210647135 CAAGGAGAGGGGAAGGTGGAAGG + Intronic
946010493 2:216560143-216560165 AAGGGGAAGGGGAATGGGAAGGG - Intronic
946021923 2:216646226-216646248 CAGTGGAAGGGGAGGGTGGTGGG + Intronic
946089237 2:217206181-217206203 CAGGGGCAGGGGGAAATGGATGG + Intergenic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946301580 2:218827519-218827541 CTGGGGAAGGGGACTGTGGGAGG + Intronic
946316575 2:218919381-218919403 AAGGGGAAGGGGAAGGGGAAAGG - Intergenic
946408415 2:219504900-219504922 GAGGGGGAGGGTAACTTGGAGGG + Intronic
946409592 2:219509504-219509526 CTGGGGAAGGGGAGCGGGGGTGG - Intergenic
946431409 2:219628810-219628832 AAGGGGAAGGTCACCGTGGAAGG - Intronic
946519067 2:220446583-220446605 GAGGGAAAGGGGAAGGGGGAAGG - Intergenic
947272085 2:228347851-228347873 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
947343622 2:229166967-229166989 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
947511007 2:230754385-230754407 GAGGGGAAGGGGAAGAAGGAGGG - Intronic
947511020 2:230754421-230754443 GAGGGGAAGGGGAAGAAGGAGGG - Intronic
948241778 2:236443812-236443834 CAGAGAAAAGGGAATGTGGAAGG - Intronic
948344332 2:237282667-237282689 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948344346 2:237282697-237282719 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
948684126 2:239659444-239659466 CAGAGGAAGGGGAAGGTGTGAGG - Intergenic
948809547 2:240467590-240467612 CAGGGGGAGGAGGACTTGGAGGG + Exonic
1168773860 20:432741-432763 CAGGGGCAGGGGAAGGTGAGTGG + Intergenic
1169178628 20:3542567-3542589 AAGGGGAAGGAGAAAGGGGAAGG - Intronic
1169596376 20:7204266-7204288 CTGGGGAAGGGAGAAGTGGAAGG - Intergenic
1169920567 20:10730830-10730852 AAGGGGAAGGGGAAAGGGAAGGG - Intergenic
1170308223 20:14963358-14963380 CAGGGGAAGGAGACCTGGGAGGG + Intronic
1170579244 20:17685256-17685278 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1170699998 20:18695417-18695439 AAGGGGAAGGGGGAGGCGGAGGG - Intronic
1170742027 20:19066610-19066632 CAGGGGTGGGGGAAGGGGGATGG - Intergenic
1171183911 20:23111387-23111409 CAGGGGAAGGGAGATGGGGAAGG + Intergenic
1171313544 20:24166287-24166309 CAGGGGGAGGGGTCAGTGGATGG - Intergenic
1171474518 20:25397830-25397852 AAGGGAAAGGGGAAGGGGGAAGG + Intergenic
1172434785 20:34921301-34921323 CAGGGGAATGGGAGAGAGGAAGG - Intronic
1172762817 20:37333903-37333925 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1172811763 20:37653181-37653203 CAGGGGCTAGGGAACGGGGAGGG + Intergenic
1173164503 20:40677165-40677187 CAGGGGAGGGGGAAAGGGAAAGG - Intergenic
1173469546 20:43312271-43312293 TAGGGGAGTGGGAAAGTGGAGGG + Intergenic
1173569600 20:44067798-44067820 CAAGGGAATGGGAACCTGGCTGG - Intronic
1173738618 20:45379914-45379936 CAGGGTAAAGGGAACAGGGAGGG + Intronic
1173750044 20:45469661-45469683 GCGGGGAAGGGGAGGGTGGAGGG - Intergenic
1173869523 20:46332664-46332686 CAGGGGCAGGGGAATAAGGAGGG + Intergenic
1174008328 20:47428266-47428288 CAGAGGGAAGGGAAGGTGGACGG - Intergenic
1174062707 20:47843938-47843960 GAAGGGAAGGGGGAAGTGGAAGG + Intergenic
1174379788 20:50149260-50149282 AGGGGGAAGGGAAAGGTGGAGGG - Intronic
1174709524 20:52690263-52690285 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1175110094 20:56641780-56641802 CAGGGCAAGGGGAAAAGGGAGGG - Intergenic
1175239174 20:57533994-57534016 GAGGAGAAGGGCACCGTGGAAGG - Intergenic
1175503632 20:59467188-59467210 CCAGGGAAGGGGAATGGGGAGGG + Intergenic
1175565011 20:59967749-59967771 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1175699305 20:61125468-61125490 CAGGGGGAGGGGAAGGAGAAGGG + Intergenic
1175707621 20:61192756-61192778 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1175919644 20:62444709-62444731 CAGGGGATGGGAGAGGTGGATGG + Intergenic
1175967338 20:62666123-62666145 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1175967341 20:62666129-62666151 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1175967344 20:62666135-62666157 GAGGGGAAGGGGAAGGGGAAGGG - Intronic
1175998635 20:62822224-62822246 CTGGGGAGGGGGAATGGGGAGGG - Intronic
1176104969 20:63381629-63381651 CAGGCAGAGGGGAGCGTGGAGGG + Intergenic
1176190888 20:63809113-63809135 CCTGCGAAGGGGAACGTGGAAGG - Intronic
1176203986 20:63878213-63878235 GACGGGAAGGAGAACGTGGCCGG + Intronic
1177329310 21:19635656-19635678 CAGGGGAAGGGGTACGAGGTGGG + Intergenic
1177432680 21:21010944-21010966 AAGGGGAATGGGAATGTGGGTGG + Intronic
1177758351 21:25373802-25373824 GAGGGGGAGGGGAAAGGGGAGGG - Intergenic
1177758365 21:25373829-25373851 GAGGGGGAGGGGAAAGGGGAGGG - Intergenic
1177801584 21:25833699-25833721 CAGGGGAAGGGGACCTGGAAAGG - Intergenic
1178319866 21:31597207-31597229 GAGGGGAAGGGGAAGGGAGAAGG - Intergenic
1178322331 21:31614841-31614863 GAGGGGAAGGGGAAAGGGAAGGG + Intergenic
1178906700 21:36642614-36642636 CAGGGGAAGGGGAAAGAGTATGG + Intergenic
1179819793 21:43930192-43930214 CGGGGGCAGGGAACCGTGGAAGG - Intronic
1179947632 21:44688820-44688842 CAGCGGAAGGGGAGTGGGGAGGG + Intronic
1180147113 21:45927887-45927909 CAGGGAATGGGGCACGGGGAGGG - Intronic
1180472905 22:15676972-15676994 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1180488581 22:15821588-15821610 CCGGGGCAGGGAAGCGTGGACGG + Intergenic
1180590166 22:16930604-16930626 AAGGGCAAGGGGAGTGTGGATGG + Intergenic
1180623955 22:17181613-17181635 CAGGGGTTGGGGAACGGGGCAGG + Intronic
1180872501 22:19154584-19154606 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1181080738 22:20413204-20413226 CAAGGGAAGGGGAAGGGGAAGGG + Intergenic
1181080741 22:20413210-20413232 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1181745805 22:24954053-24954075 CAGGGGATGGGGCACGGGAAAGG - Intronic
1182886395 22:33777636-33777658 GAGGGGAAGGGGGAGGGGGAGGG + Intronic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183419741 22:37704465-37704487 AAGGGGGAGGGGAAGGGGGAGGG + Intronic
1183688349 22:39374760-39374782 CACAGGCAGGGGAGCGTGGATGG + Intronic
1183715500 22:39530956-39530978 CGGGGGGAGGGGCATGTGGAAGG + Intronic
1184100767 22:42340843-42340865 GAGGGGGAGGGGAAAGGGGAGGG + Intronic
1184243212 22:43222419-43222441 CAGGGTCAGGGGACCGTGGGAGG - Intronic
1184383594 22:44161710-44161732 GAGGGGAAAGGGAACCTGTATGG + Intronic
1184651932 22:45923384-45923406 CAGGGGTAGGGGAACCTAGAGGG - Intronic
1184958832 22:47914011-47914033 CAGGGCAAGAGGAACAGGGAGGG - Intergenic
1185038646 22:48492665-48492687 CAGGGGAAAGGGGCCCTGGATGG + Intronic
1185229812 22:49673560-49673582 AGGGGGAAGGGGAAGGGGGAGGG + Intergenic
949698811 3:6731635-6731657 CAGGTGAAGGGAAAAGTGCATGG + Intergenic
949725647 3:7041294-7041316 CCTGGGAATGGGAAGGTGGAAGG - Intronic
949985510 3:9537622-9537644 CAGGAGAAGGTGGACTTGGAAGG - Intronic
950141727 3:10620503-10620525 CAGGAGTAGGGAAACCTGGAAGG + Intronic
950187491 3:10954036-10954058 CTGGGGAAGGGGAGCTTGCAGGG - Intergenic
950194824 3:11001595-11001617 CAGGGGCAGGGGATGGTTGATGG + Intronic
950293467 3:11807045-11807067 CCTGAGAAGGGGAACATGGAAGG - Intronic
950757260 3:15185545-15185567 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
951543559 3:23805826-23805848 CAGGGGGAGGGGAGCGCGGGTGG + Intergenic
951795917 3:26538210-26538232 AAGGGGAAGGGGAAGGGGAAAGG + Intergenic
951930113 3:27955873-27955895 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
952277559 3:31892181-31892203 CAGAGGAAGGAGCACGTGTATGG + Intronic
952531649 3:34268552-34268574 CAGGGCGGGGGGAATGTGGATGG - Intergenic
952558550 3:34561610-34561632 GAGGGGTAGGGGAACGGGGGAGG + Intergenic
952708259 3:36401888-36401910 AAAGGGAAGGGGAAAGGGGATGG + Intronic
953870348 3:46620676-46620698 CAAGGGAAGGGGAAAGATGAGGG + Intronic
954377433 3:50202519-50202541 GAGGGGAAGGGCACTGTGGATGG - Intergenic
954511395 3:51129034-51129056 CTGGGGAAGAGGTATGTGGATGG - Intronic
954901837 3:54026596-54026618 TAGGGGAAGAAGTACGTGGAGGG - Intergenic
955087809 3:55720075-55720097 GAGGGGGAGGGGAAGGGGGAGGG - Intronic
956230142 3:67005636-67005658 GAAGGGAAGGGGAAGGGGGAGGG - Intronic
956488390 3:69745451-69745473 CAGAGGAAGGGGAACTGGGGAGG + Intronic
956747935 3:72324221-72324243 CAAGGGAAGAGGAAGGTGGCAGG - Intergenic
957019432 3:75108416-75108438 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
957019435 3:75108422-75108444 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957672946 3:83328656-83328678 AAAGGGAAGGGGAAGGGGGAGGG + Intergenic
958885456 3:99721431-99721453 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
958885470 3:99721473-99721495 GAGGGGAAGGGAAGCCTGGATGG + Intronic
959095525 3:101951364-101951386 CAGGGGTAGGGGAGCGGGGCAGG + Intergenic
959796512 3:110436058-110436080 CAGGTGGAGGGGAACATTGAGGG - Intergenic
960720693 3:120622376-120622398 CAGGGGAAGGGGAAGGAGACTGG - Intergenic
961000569 3:123371544-123371566 CAGGGGAAGTGGCACGCGGCCGG + Intronic
961135355 3:124504973-124504995 CAGGGGAAGGGGTACAAGAAGGG + Intronic
961830293 3:129619761-129619783 GCGGGGAAGGGGAACCTGGCTGG - Intergenic
961925207 3:130472157-130472179 CAGGGAATGGGGAAGTTGGAGGG + Intronic
963106789 3:141654177-141654199 GAGGGGAAGAGGAAAGTGGGGGG + Intergenic
963143257 3:141965541-141965563 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
963143266 3:141965559-141965581 GAGGGGAAGGGGAAGGGGAAGGG + Intronic
963938869 3:151081439-151081461 CAGGGGAAGTGGGAGGGGGAGGG - Intergenic
964089860 3:152862732-152862754 CAGGGGAAGGGAAAAGGGAAAGG - Intergenic
964409696 3:156384865-156384887 AAGGGGTAGGGGCACCTGGAAGG + Intronic
964435196 3:156643919-156643941 CAGAGGCAGGGGAATGAGGAAGG - Intergenic
964523196 3:157588916-157588938 CAGGGGAAGGTGAGCATGAATGG + Intronic
964833301 3:160910178-160910200 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
964833332 3:160910251-160910273 AAGGGGAAGGGGAAAGGGGAAGG - Intronic
964833335 3:160910257-160910279 AAGGGGAAGGGGAAGGGGAAAGG - Intronic
966461465 3:180181631-180181653 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
966461468 3:180181637-180181659 GAGGGGAAGGGGAAGGGGAAGGG - Intergenic
966555205 3:181251364-181251386 AAGGGGAAGGGGAAGGGAGAAGG - Intergenic
966555206 3:181251370-181251392 GAGGGGAAGGGGAAGGGGAAGGG - Intergenic
966799321 3:183748215-183748237 AAGGGGAAGGGGAAAGGGAAGGG - Intronic
966836128 3:184050854-184050876 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
966897655 3:184457729-184457751 AAGGGGAAGGGGAAATTGGAGGG + Intronic
966954750 3:184864142-184864164 GAGGGGGAGGGGAAGGGGGAAGG + Intronic
967004740 3:185373747-185373769 CAGGGGTAGGGCAATATGGATGG - Intronic
967880207 3:194296616-194296638 CAGGGGGAGGGGAGAGTAGAAGG + Intergenic
968339312 3:197941467-197941489 GAGGGGAAGGGGGAGGGGGAAGG - Intronic
968506987 4:975353-975375 CCGTGGAAGGAGACCGTGGAGGG - Intronic
968529968 4:1086564-1086586 GAGGGGTAGGGGAAAGAGGATGG + Intronic
968614621 4:1571745-1571767 CAGGGGGAAGGGAGCGTGGAAGG + Intergenic
968630618 4:1649126-1649148 AAGGGGAAGGGGAAGGGGAAAGG + Intronic
968630621 4:1649132-1649154 AAGGGGAAGGGGAAAGGGAAGGG + Intronic
968630641 4:1649180-1649202 AAGGGGAAGGGGAAGGGGAAAGG + Intronic
968630643 4:1649186-1649208 AAGGGGAAGGGGAAAGGGAAAGG + Intronic
968632948 4:1661594-1661616 CACAGGGAGGGGGACGTGGATGG - Intronic
968741726 4:2334737-2334759 AAGGGGAGGGGGAAGGGGGAGGG - Intronic
968857509 4:3138155-3138177 AAGGGGAAGGGAAAAGGGGAAGG - Intronic
968903880 4:3443070-3443092 TAGCGGAAGGGGAACCTGCAGGG - Exonic
969274745 4:6127702-6127724 CAGGGAAAGGGGATCAAGGAGGG - Intronic
969397674 4:6933272-6933294 AAGGGGAAGGGGAAGGGGGAGGG - Intronic
969397678 4:6933278-6933300 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
969397681 4:6933284-6933306 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
969397684 4:6933290-6933312 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
969618753 4:8268502-8268524 TCGGGGAATGGGAAGGTGGAGGG - Intergenic
969707442 4:8819594-8819616 CAGGGGAAGGGGAAGGGAGTAGG + Intergenic
969853099 4:9977545-9977567 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
970572133 4:17393358-17393380 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
970878989 4:20906024-20906046 AAGGGGAAGGGGAAGGGGAAAGG - Intronic
971248629 4:24952833-24952855 CAGGGGATGGGGAAGATGGGGGG - Intronic
971381133 4:26098991-26099013 CAGGGGAAGGGGATTGTCCAAGG + Intergenic
971466404 4:26967799-26967821 AGGGGGAAGAGGAAAGTGGAGGG - Intronic
972190825 4:36588527-36588549 CAGGGAAAGGGGTAGGTGTAGGG - Intergenic
972346453 4:38196515-38196537 CAGGAGAAGGGGGAGTTGGAGGG + Intergenic
972770534 4:42193209-42193231 CAGGAGAGGAGGAAAGTGGAAGG - Intergenic
973120911 4:46520275-46520297 TTGGGGAAGAGGTACGTGGATGG - Intergenic
973328974 4:48893180-48893202 CGGGGGCAGGGGAAGGTGGCTGG + Intronic
973333249 4:48930950-48930972 CTGGGGAAGGGGATCGGGGCAGG + Intergenic
973610504 4:52632015-52632037 CAAGGGAAGGGGAAGGGGAAGGG + Intronic
973610507 4:52632021-52632043 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
973610509 4:52632027-52632049 AAGGGGAAGGGGAAGGGGAAAGG + Intronic
973610512 4:52632033-52632055 AAGGGGAAGGGGAAAGGGAAGGG + Intronic
973697106 4:53500909-53500931 CAAGGGAAGGGGAATGAGGGAGG - Intronic
974206123 4:58705326-58705348 CAGGGGCAGGGCAGTGTGGAAGG + Intergenic
974214938 4:58832955-58832977 AAGGGGAAGGGGAAGGCGAAGGG - Intergenic
974214942 4:58832967-58832989 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
974597688 4:64036622-64036644 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
974597692 4:64036628-64036650 AAGGGGGAGGGGAAGGGGGAGGG - Intergenic
974597699 4:64036640-64036662 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
975139338 4:70903379-70903401 CGAGTGGAGGGGAACGTGGAGGG + Intronic
975360217 4:73460937-73460959 GAGGGGGAGGGGAAGGAGGAGGG - Intergenic
975442029 4:74421808-74421830 GAGGGGAAGGGGAAGGAAGATGG + Intergenic
976259041 4:83128452-83128474 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
976264809 4:83180528-83180550 CAGGGTAAGGGGAAGTTGGGGGG - Intergenic
976266179 4:83187010-83187032 GAGGGGGAGGGGGACGGGGAGGG + Intergenic
976753750 4:88477277-88477299 GAAGGGAAGGGGAAGGGGGAGGG + Intronic
976753802 4:88477404-88477426 GAGGGGAAGGGGAAGGTGAAGGG + Intronic
976753830 4:88477481-88477503 GAGGGGAAGGAGAAGGTGAAGGG + Intronic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977809754 4:101346183-101346205 CAGGGGGAGGGGGAGGGGGAGGG + Intronic
977839617 4:101686974-101686996 GAGCAAAAGGGGAACGTGGAAGG - Intronic
978268536 4:106858878-106858900 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
980505139 4:133709304-133709326 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
981422784 4:144570560-144570582 CTGGGGAAGGGGTGCATGGATGG + Intergenic
981430235 4:144648759-144648781 GAGGAGAAGGGGAAGGGGGATGG + Intronic
981661461 4:147171943-147171965 CAGAGAAAGGGGACAGTGGAAGG - Intergenic
981814005 4:148807656-148807678 AAGGGGAAGGGGAAGGAGGGTGG + Intergenic
982364360 4:154559167-154559189 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
982364363 4:154559173-154559195 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
982811035 4:159826172-159826194 CAGGGGAAGCAGAACATGAAGGG + Intergenic
982981764 4:162146703-162146725 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
983131746 4:164028572-164028594 AAGGGGTAGGGAAACGAGGAGGG + Intronic
983487988 4:168353832-168353854 CAGGGTAGGGGAAATGTGGATGG + Intergenic
984207079 4:176798291-176798313 TCAGGGAAGGGGAACTTGGAGGG - Intergenic
984725147 4:183013420-183013442 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
984725150 4:183013426-183013448 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
984725153 4:183013432-183013454 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
984725156 4:183013438-183013460 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
984869821 4:184316187-184316209 GAGGGGAAGGGGAAGGGGAAAGG - Intergenic
985552725 5:541619-541641 GAGGAGCAGGGGAAGGTGGAGGG - Intergenic
985790890 5:1926387-1926409 CAGGGGAAGGGGAAGGCGCAGGG - Intergenic
985790916 5:1926459-1926481 CAGGGGAAGGGGCAGGCGTAGGG - Intergenic
985790972 5:1926623-1926645 CAGGGGCAGGGGCAGGTGCAGGG - Intergenic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986183629 5:5416977-5416999 GAGGGGAAGGAGGACGGGGAGGG + Intergenic
986723458 5:10577110-10577132 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
986946597 5:13029116-13029138 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
986946600 5:13029122-13029144 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
986946603 5:13029128-13029150 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
986946606 5:13029134-13029156 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
986946609 5:13029140-13029162 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
987153264 5:15062295-15062317 CTGGGGAAGAGGTATGTGGATGG + Intergenic
987332546 5:16869913-16869935 GAAGGGAAGGGGAAGGGGGAGGG + Intronic
987332550 5:16869919-16869941 AAGGGGAAGGGGGAGGGGGAGGG + Intronic
987878573 5:23711849-23711871 CAGGGGGTGGGGAACTTGCAGGG - Intergenic
987976939 5:25026636-25026658 CAGGGGAAAGGTCACGTGGTGGG + Intergenic
988735984 5:34021764-34021786 CAGGGTGAGGGGAAAGGGGAGGG + Intronic
989741559 5:44779274-44779296 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
989741562 5:44779280-44779302 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
989741565 5:44779286-44779308 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
989741568 5:44779292-44779314 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
989750595 5:44888689-44888711 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
989750598 5:44888695-44888717 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
989750601 5:44888701-44888723 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
989750604 5:44888707-44888729 GAGGGGAAGGGGAAGGGGAAGGG - Intergenic
990446183 5:55896578-55896600 GAGGGGAGGGGGAAGGTGGGGGG - Intronic
990589644 5:57249751-57249773 GAGGGGAAGGGGGAGGGGGAAGG - Intronic
990589652 5:57249764-57249786 GAGGGGAAGGGGAGAGGGGAAGG - Intronic
991460134 5:66849413-66849435 GAGGGGAAAGGGGAGGTGGAGGG - Intronic
991472433 5:66983653-66983675 GAGGGGGAGGGGAATGGGGAGGG + Intronic
991646662 5:68807949-68807971 AAGGGGAAGGGAAAAGGGGAAGG + Intergenic
991937938 5:71820763-71820785 AAGGGGAAGGGGAAAGGGAAAGG - Intergenic
992004627 5:72465363-72465385 CTGGGGAAGGGGAGTGTTGAAGG + Intronic
992578973 5:78151835-78151857 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
992578980 5:78151847-78151869 GAGGGGGAGGGGAAGGGGGAGGG - Intronic
992579074 5:78152036-78152058 GAAGGGAAGGGGAAGGGGGAGGG - Intronic
992797291 5:80264596-80264618 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
992797294 5:80264602-80264624 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
993901150 5:93584922-93584944 AAGGGGAAGGGGAAGGGGGGAGG - Exonic
993901154 5:93584928-93584950 GAGGGGAAGGGGAAGGGGAAGGG - Exonic
993926593 5:93873386-93873408 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
993926595 5:93873392-93873414 AAGGGGAAGGGGAAGGGGAAAGG + Intronic
994984330 5:106915098-106915120 TTGGGGAAGAGGTACGTGGATGG - Intergenic
995637402 5:114209302-114209324 CAGAGGAAGGGGAACTAGTAAGG - Intergenic
996392117 5:122973161-122973183 CTGGGGAAGAGGTATGTGGATGG - Intronic
996418317 5:123234001-123234023 AAGGGGAAGGGGAAAGAGAAAGG - Intergenic
996423266 5:123285661-123285683 AAGGGGAAGGGGTGGGTGGAGGG - Intergenic
996423272 5:123285673-123285695 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
996423275 5:123285679-123285701 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
996423278 5:123285685-123285707 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
996423281 5:123285691-123285713 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
996423284 5:123285697-123285719 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
997266188 5:132496646-132496668 GAGCGGAAGGGGAAGGTGGGGGG - Intergenic
997435681 5:133873165-133873187 CAGGGGAAGGGGAAGATTGCGGG + Intergenic
997438525 5:133892374-133892396 CAGGGGCAGGGGTGGGTGGATGG - Intergenic
997465696 5:134086683-134086705 AAGGGGAAGGGGAAGGAAGAAGG - Intergenic
997857726 5:137388381-137388403 CAGGGTAAGGGGTATGTGGCGGG + Intronic
997889826 5:137665851-137665873 AAAGGGAAGGGGAAAGGGGAAGG + Intronic
998005943 5:138657099-138657121 GAGGGGAAGGTGAATGTGGCTGG + Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
999236209 5:150097311-150097333 AAGGGGAAGGGGAAGGAGAAGGG + Intronic
1001104712 5:168843282-168843304 CAGGTGAAGAGGAAGGTGGAGGG + Intronic
1001288402 5:170439727-170439749 CTGGGGAAGGGGAATGTTGCTGG - Intronic
1001290526 5:170455290-170455312 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1001442202 5:171751514-171751536 GAAGGGAAGGGGAATGTGGTTGG - Intergenic
1001442551 5:171755480-171755502 GAAGGGAAGGGGAATGTGGTTGG - Intergenic
1001479958 5:172081874-172081896 AAGGGGAAGGGGAGGATGGAAGG - Intronic
1001834737 5:174822481-174822503 CAGAGTAAGGAGAACATGGACGG + Intergenic
1002173666 5:177389347-177389369 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1002173669 5:177389353-177389375 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1002173672 5:177389359-177389381 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1002663251 5:180804830-180804852 CAGGTGAAGGGGAAACAGGATGG + Intronic
1003061363 6:2865309-2865331 GAGGGGAAGGGAAGCGGGGAGGG - Intergenic
1003133692 6:3416903-3416925 GAGGGGATGGGGAACATGGAAGG + Intronic
1003136025 6:3435347-3435369 GAGGGGAAGGGGAGCAGGGATGG - Intronic
1003319633 6:5038862-5038884 CCGCGGAAGGAGACCGTGGAGGG + Intergenic
1003542885 6:7033551-7033573 GAGAGGAAGGGGTACTTGGATGG - Intergenic
1004114029 6:12749541-12749563 GAGGGGGAGGGGAAGGGGGAGGG - Intronic
1004293253 6:14387424-14387446 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1004710250 6:18162953-18162975 CTGGAGAAGGGGACCGTGGCAGG + Intronic
1005039531 6:21588499-21588521 CAGGGGATGGGGTAGGAGGACGG + Intergenic
1005277735 6:24238104-24238126 AAGGGGAAGGGGAAAGGGAAGGG + Intronic
1005331249 6:24752762-24752784 CAGGGTTAGGGGAACCTGCAAGG + Intergenic
1005354532 6:24969705-24969727 CAAGTGAAGGGGAGAGTGGAGGG - Intronic
1005710697 6:28501532-28501554 GAGGGGGAGGGGGAGGTGGAGGG - Intergenic
1006285355 6:33089080-33089102 CAGGGGATGGTGAAAGTGGAAGG + Intergenic
1006459282 6:34148940-34148962 CAGGGGAAGGGGAAGGGTGAAGG + Intronic
1006562972 6:34929771-34929793 AAGGGGAAGGGGGAGGGGGAGGG - Intronic
1006567666 6:34973971-34973993 CAAGGGAAGGGGAAGGGGAAGGG - Intronic
1006567711 6:34974089-34974111 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1006567731 6:34974135-34974157 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1006567734 6:34974141-34974163 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1006567750 6:34974177-34974199 GAAGGGAAGGGGAAGGGGGAAGG - Intronic
1006567776 6:34974235-34974257 AAGGGGAAGGGGAACGGGAACGG - Intronic
1006567778 6:34974241-34974263 AAGGGGAAGGGGAAGGGGAACGG - Intronic
1006689026 6:35863618-35863640 CATGGGGAGGGGGAGGTGGAGGG + Intronic
1007287109 6:40755567-40755589 CAGGTGAAGGGGGAGGAGGAGGG - Intergenic
1007465015 6:42045775-42045797 CAGGGAAAGGGAAACTTGGCAGG + Intronic
1007939439 6:45765428-45765450 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1007939442 6:45765434-45765456 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1007967564 6:46016106-46016128 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967574 6:46016131-46016153 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967584 6:46016156-46016178 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967594 6:46016181-46016203 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967604 6:46016206-46016228 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1008111242 6:47497350-47497372 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1008665237 6:53709524-53709546 CATGGGGAGGGGAACGGGAAGGG + Intergenic
1010107860 6:72189940-72189962 CTGGGGAAGAGGTACGTGGATGG - Intronic
1010887421 6:81261880-81261902 GAGGGGAAGAGGAAGGGGGAGGG + Intergenic
1010938156 6:81885792-81885814 TTGGGGAAGGGGGATGTGGATGG - Intergenic
1011616614 6:89203287-89203309 CAGAGGAAGGGGAGCCTGAAAGG - Intronic
1012002038 6:93665554-93665576 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012344674 6:98170951-98170973 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1013173709 6:107659887-107659909 CAGGGGAAGGGGAGGCGGGAGGG + Exonic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013711104 6:112900286-112900308 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1013711107 6:112900292-112900314 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1013888308 6:114998165-114998187 CAGTGGAAGGGGAACTGGAAGGG - Intergenic
1014629687 6:123773321-123773343 CAGAGGAAGGGACACATGGAGGG - Intergenic
1014751425 6:125261051-125261073 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1015095359 6:129408970-129408992 CTGGGGAAGAGGTATGTGGATGG - Intronic
1015434965 6:133174725-133174747 AAGGGGAAGGGGAAGGAGAATGG - Intergenic
1015659500 6:135559326-135559348 CAGGGGAAGGGGGAATAGGAAGG + Intergenic
1015778220 6:136836382-136836404 CAGGGGAAGGGGGACCAGAATGG + Intronic
1016582776 6:145647701-145647723 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1017006185 6:150029338-150029360 TAGGGGTATGGGAAAGTGGATGG + Intergenic
1017036283 6:150270069-150270091 GAGGGGGAGGGGAAGCTGGATGG + Intergenic
1017339562 6:153305189-153305211 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1017339578 6:153305237-153305259 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1017339611 6:153305357-153305379 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1017339633 6:153305435-153305457 TAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017539991 6:155391158-155391180 CTGGGGAAGGGTAGCGGGGAGGG + Intergenic
1017618396 6:156269724-156269746 CAGAGGTAGGGCAAGGTGGAAGG - Intergenic
1019472653 7:1229696-1229718 CGGGGGAAGGGGCAGGCGGAAGG + Intergenic
1020021563 7:4872449-4872471 CAGGGGCTGGGGAACGGTGAGGG - Intronic
1020201922 7:6086675-6086697 AAGGGGAAAGGGAAGGGGGAAGG - Intergenic
1020509625 7:9037387-9037409 CACGGGAAGGGGGTTGTGGAGGG - Intergenic
1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG + Intergenic
1021677028 7:23090657-23090679 GAGGGGATGGGGAACGTGGATGG - Intergenic
1021904856 7:25323045-25323067 CTGGGGAAGGGGATAATGGAGGG + Intergenic
1022070447 7:26908512-26908534 GAGGGGAAGGGGAAGGGGAAGGG + Intronic
1022070450 7:26908518-26908540 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1022070453 7:26908524-26908546 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1022070456 7:26908530-26908552 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1022274420 7:28841811-28841833 AAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1022274428 7:28841829-28841851 AAGGGGAAGGGGAAGGGGAAAGG + Intergenic
1022274431 7:28841835-28841857 AAGGGGAAGGGGAAAGGGAAGGG + Intergenic
1022670304 7:32449369-32449391 AAGGAGAAGGGGAACGGGAAGGG + Intergenic
1023362949 7:39434220-39434242 CAGGGAAATGGGAAAGAGGATGG + Intronic
1023911143 7:44557680-44557702 AAGGGGAAGGGGAGGGAGGAAGG + Intergenic
1023923118 7:44645379-44645401 CAGGGGAAGGGGACTCTGGTAGG - Exonic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024744297 7:52389053-52389075 CCGGGGAAGAGGTATGTGGATGG + Intergenic
1025108988 7:56196896-56196918 GAGGGGAAGGGAAAGGGGGAGGG - Intergenic
1025231733 7:57207197-57207219 GAAGGGAAGGGGGAAGTGGAAGG - Intergenic
1026106680 7:67426920-67426942 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1026676835 7:72435282-72435304 AAGGGGAAGGGGAACGAGAAGGG + Intronic
1026762540 7:73137707-73137729 GAGGGGGAGGGGAAGGGGGAGGG + Intergenic
1026863749 7:73810497-73810519 CAGGGGAAGGGGCTCCTGGTGGG - Intronic
1027039003 7:74947483-74947505 GAGGGGGAGGGGAAGGGGGAGGG + Intergenic
1027084684 7:75254993-75255015 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1027148550 7:75715898-75715920 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1027253493 7:76414658-76414680 AAGGGGAAGGGGAAAGGGAAGGG - Intronic
1027253496 7:76414664-76414686 GAGGGGAAGGGGAAGGGGAAAGG - Intronic
1027406972 7:77872363-77872385 CTGGGGAAGAGGTATGTGGATGG - Intronic
1028433512 7:90775627-90775649 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
1028433519 7:90775639-90775661 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
1030099336 7:105931347-105931369 GAGAGGAAGGGGAAAGAGGAGGG - Intronic
1030277626 7:107737264-107737286 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1030902396 7:115140609-115140631 AAGGGGAAGGAGAACGGGAAGGG - Intergenic
1031088212 7:117323800-117323822 CATAGGGAGGGGAACTTGGAGGG + Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031554837 7:123161520-123161542 CAAGGAAAGGAGAAAGTGGAAGG - Intronic
1031595108 7:123640723-123640745 GAGGAGAAGGGGAAGGGGGAAGG + Intergenic
1031865986 7:127039618-127039640 AAGGGGAAGGGGAAGGAGAAGGG + Intronic
1031915621 7:127560185-127560207 GAGGGAAAGTGGAAGGTGGAAGG - Intergenic
1032583909 7:133129173-133129195 CTGGGGAAAGGGCATGTGGATGG + Intergenic
1033213753 7:139479642-139479664 CAGGGGGAGGGTAGCGTGGTAGG + Exonic
1033215108 7:139487686-139487708 GAGGTGAAGGGGAAGGGGGAGGG + Intergenic
1033565518 7:142574893-142574915 CAGGGGGAGGGGGAGGGGGAGGG - Intergenic
1033804348 7:144937494-144937516 AAGGGGAAGGGGAAAGGGAAGGG - Intergenic
1033804356 7:144937512-144937534 AAGGGGAAGGGGAAAGGGAAGGG - Intergenic
1033804362 7:144937525-144937547 AAGGGGAAGGGGGAAGGGGAAGG - Intergenic
1033804365 7:144937531-144937553 AGGGGGAAGGGGAAGGGGGAAGG - Intergenic
1033804369 7:144937538-144937560 AAGGGGAAGGGGGAAGGGGAAGG - Intergenic
1033804372 7:144937544-144937566 AAAGGGAAGGGGAAGGGGGAAGG - Intergenic
1033804381 7:144937562-144937584 AAGGGGAAGGGGAAGGAGAAAGG - Intergenic
1033804402 7:144937629-144937651 AAGGGGAAGGGGAAAGGGAAAGG - Intergenic
1033969813 7:147025405-147025427 AAGGGGGAGGGGAAGGGGGAGGG + Intronic
1034169895 7:149054902-149054924 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1034412095 7:150947123-150947145 AAGGGGAAGGGGAGGGGGGAGGG + Intronic
1034439870 7:151081137-151081159 CTGGTGAAGGGGAGCGGGGAGGG - Exonic
1034892611 7:154854398-154854420 CAGAGAAAGGGGTCCGTGGATGG + Intronic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1035338390 7:158144637-158144659 AAGGGGAAGGGGAAGGAGAAGGG + Intronic
1035389716 7:158496675-158496697 CAGGGAAGGGGGAAGGGGGAAGG - Intronic
1035413208 7:158662740-158662762 CAGGGGGAGGGGAATGGTGAAGG + Intronic
1035479208 7:159168658-159168680 CAGGGGCTGGGGAAGGAGGAAGG + Intergenic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035856947 8:2985942-2985964 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1035856950 8:2985948-2985970 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1035856953 8:2985954-2985976 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1035886452 8:3296352-3296374 CAGAGGAAGGGGGACTGGGAAGG + Intronic
1036718035 8:11144882-11144904 AAGGGGAAGGGGAAGGAGAAGGG + Intronic
1036977611 8:13431759-13431781 CTTGGGAAAGGGAACGTGGGTGG + Intronic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037787870 8:21913066-21913088 CCAGGGAAGGGGAAAGAGGATGG + Intronic
1038042637 8:23737991-23738013 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1038044026 8:23750819-23750841 CAGGGAAAGGAGAACAAGGAAGG - Intergenic
1038166305 8:25088068-25088090 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1038166307 8:25088074-25088096 AAGGGGAAGGGGAAGGGGAAAGG + Intergenic
1038166310 8:25088080-25088102 AAGGGGAAGGGGAAAGGGAAGGG + Intergenic
1038618697 8:29119460-29119482 CAGGTGAAGGGGAGTGGGGAGGG - Intronic
1038812705 8:30866372-30866394 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1039117963 8:34113342-34113364 CAGGGGCACGGGAAGGGGGAAGG + Intergenic
1039870362 8:41540520-41540542 CCGGGGAAGGGGAGCTTGGCCGG + Intronic
1040949587 8:52924002-52924024 CAGGAGATGGGGAACAAGGAGGG - Intergenic
1041284818 8:56249515-56249537 AAGGGGAAGGGGAAGGGGAAAGG - Intergenic
1041284820 8:56249521-56249543 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1041284823 8:56249527-56249549 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1041284826 8:56249533-56249555 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1041924398 8:63221581-63221603 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1043800928 8:84608540-84608562 CTGGGGAAGGGCAAAGTGGGAGG - Intronic
1043938281 8:86167967-86167989 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1043938284 8:86167973-86167995 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1043938288 8:86167979-86168001 AAGGGGAAGGGGAAGGGGGAGGG + Intergenic
1044202477 8:89453118-89453140 TTGGGGAAGAGGTACGTGGATGG + Intergenic
1044434707 8:92148373-92148395 TTGGGGAAGGGGTATGTGGAGGG + Intergenic
1044733253 8:95250041-95250063 CAGGGGAAGGGAGACATGGGTGG - Intronic
1046305155 8:112356573-112356595 CATGGGAAGTGGAATATGGAGGG - Intronic
1047523721 8:125615280-125615302 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1047811517 8:128414905-128414927 CAGGGGAAGGAGAAAGTGAAGGG + Intergenic
1047884239 8:129230938-129230960 CAGGGGAAGAGGCATGTAGATGG + Intergenic
1048234300 8:132675180-132675202 AAGGGGTCGGGGAACGTGCAGGG - Intronic
1048456696 8:134584788-134584810 CGGGGGAAGGGGAAAGAGGGCGG + Intronic
1048516570 8:135116800-135116822 GAGGGGGAGGGGAAAGGGGAGGG - Intergenic
1048588907 8:135802917-135802939 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1048588919 8:135802947-135802969 AAGGAGAAGGGGAACGGGAAGGG - Intergenic
1048754824 8:137727225-137727247 AAGGGGAAGGGGAACCGGAAGGG + Intergenic
1049202060 8:141345134-141345156 CAGGGGAAGAGGGAAGTGAATGG + Intergenic
1049301508 8:141872931-141872953 CAGGGGCAGGGGAGGGTGGTGGG + Intergenic
1049461604 8:142732069-142732091 CAGGGGAAGGGGAAGGAGAGGGG - Intronic
1049598150 8:143494092-143494114 GAGGGGAAGGGGAGCGCTGAGGG + Intronic
1050482761 9:6103231-6103253 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1050490868 9:6186569-6186591 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1050690750 9:8223835-8223857 CAGGAGAAGAGGAAGGGGGAAGG + Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051487320 9:17623045-17623067 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1051487323 9:17623051-17623073 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1051487326 9:17623057-17623079 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1051487329 9:17623063-17623085 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1051487332 9:17623069-17623091 AAGGGGAAGGGGAAGGGGAAGGG - Intronic
1052074749 9:24127396-24127418 AAGTGGAGGAGGAACGTGGAGGG + Intergenic
1052561478 9:30089360-30089382 CTGGGGAAGAGGTATGTGGACGG - Intergenic
1052615083 9:30828852-30828874 CAGAGGAAGGGTAATGTGGATGG + Intergenic
1052840447 9:33288443-33288465 CAGGGGAGGGGGAACCCGGTCGG - Intergenic
1052951812 9:34219726-34219748 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1052951856 9:34219822-34219844 GAGGGGAAGGGGAAGGGAGAGGG - Intronic
1052976786 9:34417045-34417067 AAGGGGAAGGGGAAAGGGAAGGG - Intronic
1054713934 9:68538605-68538627 CAGGGGACTGGGAATATGGATGG - Intronic
1055581479 9:77711145-77711167 GAGGGGAAGGGGAAGGAGGAGGG - Intergenic
1056378489 9:86036419-86036441 CAAGGGAAGGGAAACGTGCTTGG - Exonic
1056431766 9:86535161-86535183 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1056431769 9:86535167-86535189 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1056431772 9:86535173-86535195 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1056431775 9:86535179-86535201 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1056431778 9:86535185-86535207 AAGGGGAAGGGGAAGGGGAAGGG - Intergenic
1057453080 9:95182885-95182907 CAGGGGAAGGTGACTGGGGAAGG + Intronic
1057702534 9:97374338-97374360 CAGGGGCAGGGGGTCATGGATGG - Intronic
1057987304 9:99730182-99730204 CAGAGGAAGGGGAGAGTGAAAGG - Intergenic
1058297183 9:103324007-103324029 AAGGGGAAGGGGAAGGAGAAAGG - Intergenic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1058817564 9:108699042-108699064 AAGGGGAAGGGAAAGGGGGATGG + Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059428408 9:114235672-114235694 CAGGGGCAGGGGCAGGGGGAGGG - Intronic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1060241383 9:121906668-121906690 AAGGGAAAGGGGAAAGGGGAAGG + Intronic
1060394433 9:123305555-123305577 AAGGGGAAGGGGAAAGGGAAAGG - Intergenic
1060521717 9:124297844-124297866 CAAGGCAAAGGGGACGTGGAAGG - Intronic
1061042968 9:128150241-128150263 CAGGGGAAGTGGTATGTGGTAGG + Exonic
1061331888 9:129899800-129899822 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1061331891 9:129899806-129899828 AAGGGGAAGGGGAAGGGGAAGGG + Intronic
1061360411 9:130138436-130138458 GAGGGGATGGGGAAGGGGGAAGG - Exonic
1061360433 9:130138486-130138508 GAGCGGAAGGGGAAGGGGGAGGG - Exonic
1061587619 9:131578954-131578976 AAGGGGAAGCGGAAAGTGAAAGG + Exonic
1061741629 9:132710840-132710862 GAAGGGAAGGGGAAGGGGGAAGG - Intergenic
1061920426 9:133779577-133779599 AAGGGGATGGAGAACGTGGTGGG + Intronic
1061922856 9:133791531-133791553 CGGGGGGAGGGGGACGGGGAGGG - Intronic
1062087983 9:134658455-134658477 CAGGGGCGGGGGGACGTGCAGGG - Intronic
1062135563 9:134925636-134925658 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1062143715 9:134976690-134976712 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1062182064 9:135196220-135196242 AATGGGAAGGGGAACTGGGAAGG - Intergenic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1062446556 9:136597705-136597727 CAGGGGGAGGGAAGGGTGGAGGG + Intergenic
1062738052 9:138149558-138149580 AAGGGGAAGGGGAAGGGAGAAGG - Intergenic
1203775419 EBV:70328-70350 CACGCGAAGGGAAACGTGGGAGG - Intergenic
1185729708 X:2451540-2451562 TAGGGGAAGAAGAATGTGGACGG + Intronic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1187734251 X:22288592-22288614 GAGGGGGAGGGGGACGGGGAGGG - Intergenic
1188033336 X:25289151-25289173 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1189684404 X:43548826-43548848 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1189838239 X:45042237-45042259 CCGTGGAAGGAGACCGTGGAGGG + Intronic
1190176238 X:48152579-48152601 CAGGGGTTGGGGATGGTGGATGG + Intergenic
1190311800 X:49122272-49122294 CAGGAGAAGGGGCAGGTGGCGGG + Intronic
1190324765 X:49199824-49199846 CAAGGGGAGGGGAGAGTGGAAGG - Intronic
1190491142 X:50983605-50983627 CAGGGGAAGGGGAACCAGAAGGG + Intergenic
1190561936 X:51694944-51694966 AAGGGGAAGGGGAAGGAGAAAGG + Intergenic
1191872301 X:65758460-65758482 CAGAGGATGGGGAATGTGGATGG + Intergenic
1192448957 X:71230897-71230919 AAGGGGAAGGGGAAGGAAGAGGG + Intergenic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1193721235 X:84990071-84990093 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1193721238 X:84990077-84990099 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1195010631 X:100729854-100729876 CAGGGGAGGGGGAATGAGGGAGG + Intronic
1195112827 X:101664657-101664679 TAGGGGGAGGGGAAGGAGGAAGG - Intergenic
1196198404 X:112858885-112858907 CAAGGGAAGGGGAATGGGGAAGG - Intergenic
1196784103 X:119407281-119407303 CAGGGGAAGAGCAACATGTAGGG - Intronic
1197904817 X:131413367-131413389 GAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1198450962 X:136767096-136767118 CAGGGGAAGGGGAGCGCGCGAGG - Intronic
1199430903 X:147758732-147758754 CAAGGGAAGGGAAATGTGGCAGG - Intergenic
1199812577 X:151365333-151365355 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1200112107 X:153745639-153745661 CAGGGGAAGGAAAATGTGGCGGG + Intergenic
1200766888 Y:7087765-7087787 AAGAGGAAGAGGAAGGTGGAAGG - Intronic
1201230143 Y:11856266-11856288 AAGGGGAAGGGGAAGGGGAAGGG + Intergenic
1201230147 Y:11856278-11856300 AAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1201630236 Y:16063596-16063618 CAGGGGGAGGAGAATATGGAGGG + Intergenic
1201948143 Y:19535185-19535207 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic