ID: 923122956

View in Genome Browser
Species Human (GRCh38)
Location 1:231010547-231010569
Sequence CTTCTTCCCTTGGAGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923122956_923122960 21 Left 923122956 1:231010547-231010569 CCTTTTTTCTCCAAGGGAAGAAG No data
Right 923122960 1:231010591-231010613 TTCCTGTATTCTTTCCTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923122956 Original CRISPR CTTCTTCCCTTGGAGAAAAA AGG (reversed) Intergenic
No off target data available for this crispr