ID: 923125767

View in Genome Browser
Species Human (GRCh38)
Location 1:231033230-231033252
Sequence GGAGAATGACACTGGCAACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923125758_923125767 8 Left 923125758 1:231033199-231033221 CCAAGGCGGCCAGGAGGCCAGGG 0: 1
1: 0
2: 4
3: 39
4: 491
Right 923125767 1:231033230-231033252 GGAGAATGACACTGGCAACGGGG 0: 1
1: 0
2: 0
3: 7
4: 110
923125762_923125767 -9 Left 923125762 1:231033216-231033238 CCAGGGCTCCATATGGAGAATGA 0: 1
1: 0
2: 1
3: 17
4: 170
Right 923125767 1:231033230-231033252 GGAGAATGACACTGGCAACGGGG 0: 1
1: 0
2: 0
3: 7
4: 110
923125760_923125767 -1 Left 923125760 1:231033208-231033230 CCAGGAGGCCAGGGCTCCATATG 0: 1
1: 0
2: 4
3: 22
4: 211
Right 923125767 1:231033230-231033252 GGAGAATGACACTGGCAACGGGG 0: 1
1: 0
2: 0
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923125767 Original CRISPR GGAGAATGACACTGGCAACG GGG Intronic
901651764 1:10747086-10747108 GGGGAATGGCACTGCCAACTGGG - Intronic
901720659 1:11194541-11194563 GGGGAACTACACTGGCAATGTGG + Exonic
902646755 1:17804936-17804958 GGAGAATGACACTGGCTGCTGGG - Intronic
902929229 1:19718687-19718709 GCATTATGACACTGGCAACCAGG - Intronic
910084417 1:83382347-83382369 GGAGAATCTCACAGGCAAGGGGG + Intergenic
912841422 1:113042776-113042798 GGAGAATGACCCGGTCAACTCGG - Intergenic
914703741 1:150155069-150155091 GGAGAATGTCACTAGGAATGCGG + Intronic
917167062 1:172124337-172124359 GGAGAAGGACACTTGAAACATGG + Intronic
917344987 1:174021260-174021282 GGAAACAAACACTGGCAACGCGG - Intronic
920272082 1:204773275-204773297 GGAGAAGGACACTGGCCAATGGG - Intergenic
921157680 1:212450919-212450941 GAAGAATGAAACTGGGAAGGAGG - Intergenic
923125767 1:231033230-231033252 GGAGAATGACACTGGCAACGGGG + Intronic
924453157 1:244197695-244197717 GGAGAATGATACTGGAAAGCTGG + Intergenic
1063949310 10:11207604-11207626 GGAAACTTACACTGGCAGCGTGG - Intronic
1065503143 10:26401396-26401418 GGTGGATGACAGTGGCAAGGAGG - Intergenic
1068812332 10:61270169-61270191 GGAGAATTACTCTGGCATCATGG + Intergenic
1071213815 10:83375602-83375624 GGAGAAAGACAATGGCAGTGAGG - Intergenic
1072284576 10:93901178-93901200 GGATGATGACACTTTCAACGAGG - Exonic
1072891593 10:99329672-99329694 GGAGAATGGCACCGGCGACTGGG + Exonic
1074031246 10:109690928-109690950 GGATAATGACACTGGCCCCTGGG - Intergenic
1074537884 10:114341709-114341731 GGAGTATGACAGTGACCACGGGG - Intronic
1075254935 10:120918190-120918212 GGAGAATGTTCCAGGCAACGGGG + Intergenic
1078406784 11:11077087-11077109 GGAGAATGGCACTCGAAACAAGG - Intergenic
1080055260 11:27900349-27900371 GGAGAAAGACCCTGGCATGGAGG - Intergenic
1080660076 11:34288696-34288718 GGAGAGTGACCTTGGAAACGTGG - Intronic
1083854239 11:65384584-65384606 TGAGAATGACACAGGAAACAGGG + Intergenic
1084669189 11:70595282-70595304 GGAGGGTGGCACTGGCACCGGGG - Intronic
1096496138 12:52040473-52040495 GGAGGATGACACTGTCATCCTGG + Intronic
1101432094 12:104635090-104635112 GGAGAATGAAGCTGGGTACGGGG - Intronic
1107386799 13:39919058-39919080 GGAGCATGACATTTGCAATGGGG - Intergenic
1107689022 13:42933561-42933583 GAAGGATGACAATGGCAAAGAGG - Intronic
1111945424 13:94660105-94660127 GAGGAATGTGACTGGCAACGTGG + Intergenic
1116509571 14:45726838-45726860 GGAGAGTGACAGTAGCAAAGTGG - Intergenic
1117448375 14:55826890-55826912 GGAGACTGGCAGGGGCAACGAGG - Intergenic
1121092374 14:91191556-91191578 GGAGAATGAGGCTGGGAAGGAGG - Intronic
1126467501 15:48974144-48974166 GTAGAATCACACTGGCAAGGTGG + Intergenic
1131351346 15:91703010-91703032 AGAGAATTTCACTGACAACGAGG - Intergenic
1134668164 16:16034971-16034993 AGAGAATGATACTGCAAACGTGG + Intronic
1138384458 16:56626637-56626659 AGGGAATGACACGGGCAATGAGG - Intronic
1138385557 16:56633511-56633533 AGGGAATGACACGGGCAATGAGG - Intronic
1140016054 16:71186689-71186711 GGAGAATGACAGTTGCTACTTGG - Intronic
1141104626 16:81223335-81223357 GGAAAATGACAGAGGCAACAGGG - Intergenic
1141396526 16:83710077-83710099 GGGGAATGCCACTGGCATCTAGG + Intronic
1143906404 17:10212587-10212609 ACAGATTGACACTGGCAATGAGG + Intergenic
1146063024 17:29616991-29617013 GGAGATGGACACAAGCAACGGGG - Exonic
1147521403 17:41177013-41177035 GAAGAATGACCCTGGGAAGGAGG + Intergenic
1151952057 17:77360298-77360320 GGAGAATGACTGTGGCAAATAGG - Intronic
1153687177 18:7557980-7558002 GGAGAATGGGACTGGGAATGGGG - Intergenic
1159246829 18:65816785-65816807 GTAGCATGACACTGGAAACAAGG + Intronic
1159887532 18:73923253-73923275 GGAGAATGACAATGACGACAAGG + Intergenic
1162423507 19:10579880-10579902 GGAGAGTGACCCTGGGAACCAGG + Intronic
1167403737 19:49290317-49290339 GGAGGATGACAATGGCAAAAAGG + Exonic
925625485 2:5838790-5838812 GGTGGATGACTCTGGCAACCAGG - Intergenic
926054887 2:9768687-9768709 GGAGAATGAGACAGCCCACGAGG + Intergenic
930688744 2:54337109-54337131 GGAGGCTGACACTGGCACAGTGG - Intronic
936829034 2:116618233-116618255 GGGGAGTGACAGTGGCTACGGGG - Intergenic
937307472 2:120881353-120881375 GGAGAAGGACAGTGGCAGGGAGG + Intronic
938343942 2:130553563-130553585 GGGGTATGCCACTGGAAACGGGG - Intergenic
938345891 2:130567159-130567181 GGGGTATGCCACTGGAAACGGGG + Intergenic
939222753 2:139324096-139324118 GAAGATTGACATTGGCAAAGAGG - Intergenic
939332826 2:140786887-140786909 GGAGAATGACAGTGAGAGCGAGG + Intronic
939677280 2:145088182-145088204 GGAGAATTGCAATGTCAACGGGG + Intergenic
940279569 2:151975617-151975639 GGAGAAAGTCCCTGGCCACGTGG + Intronic
943055723 2:182976039-182976061 GGAGAATGAAACTGGGAAAGGGG + Intronic
946575338 2:221069656-221069678 GGAGGAAGTCACTGGCAATGTGG + Intergenic
1168958353 20:1850209-1850231 GAAGAATGTCACTGACAACTTGG - Intergenic
1168989133 20:2079360-2079382 GGAGAATGACAGCGGGAAGGAGG - Intergenic
1169681289 20:8216948-8216970 GGAGAATGTCCCTGGTAAGGGGG - Intronic
1171192466 20:23168832-23168854 AGAGAATGAGAATGGCCACGTGG - Intergenic
1178209591 21:30514076-30514098 GGAGAAGGAGACTAGCAACTGGG + Intergenic
1178769633 21:35491005-35491027 GGAGAATGAAACAGGGAAGGAGG + Intronic
1178877160 21:36422293-36422315 GCAGAATGACACCGGCATGGGGG - Intergenic
1179012945 21:37570415-37570437 GTAGAATGACTCTGGCAGAGCGG + Intergenic
1181295253 22:21833061-21833083 GTAGGATGACAGTGGCAATGTGG + Intronic
1185259107 22:49851881-49851903 GGAGCTTGACACTGGCAGAGGGG + Intergenic
949403533 3:3690551-3690573 ATAGAATGACACTAGCAACCTGG + Intergenic
952870459 3:37895596-37895618 GGAGAATGACACTTGGAAAATGG - Intronic
953751034 3:45608550-45608572 GGAGAATGACGCTGGGCACGTGG + Intronic
955049484 3:55395680-55395702 GGAGAAGGACACAGGGAACTGGG + Intergenic
955445566 3:59006645-59006667 GGAGAATGGGACTGCCTACGAGG - Intronic
955887767 3:63618921-63618943 GGAGAATGAGACAGGAAAGGAGG + Intergenic
956023743 3:64959880-64959902 AGAACATGACACTGGCAACATGG + Intergenic
956648252 3:71478509-71478531 GAAGAATGAGAGTGGCAAGGAGG + Intronic
960087531 3:113607043-113607065 GGTAAATGTCACTGGCAACCAGG + Exonic
961825563 3:129597410-129597432 GGAGAAGGGCACAGGCAAGGGGG + Intronic
963876626 3:150483238-150483260 GGAGAGTGACAATAGCAAGGTGG + Intergenic
982767508 4:159365628-159365650 AGAGAAGGACACTGACAATGTGG + Intergenic
984740486 4:183156859-183156881 AGAGAATGACAATGCCAACATGG - Intronic
989030151 5:37110558-37110580 GGAGAATGAGGCTGGCTAGGTGG - Intronic
989157157 5:38355115-38355137 GGAGAATGAGACAGGAAAGGAGG + Intronic
990830062 5:59946258-59946280 AGATAATGATACTGGCAAAGTGG + Intronic
991427688 5:66508665-66508687 GGAGAATAGCACTGGCAAGAAGG - Intergenic
992595914 5:78347288-78347310 GGAGAATGAGACAGGTAACAGGG - Intergenic
995546462 5:113237007-113237029 TGAGAAGGAAAGTGGCAACGGGG + Intronic
1000575977 5:162975767-162975789 GGAGAAGGACACTTGCAATTAGG - Intergenic
1001592749 5:172877654-172877676 GGAAAATGACACTGTCACAGGGG - Intronic
1010011823 6:71056560-71056582 AGAGAATGTGACTGGGAACGGGG - Intergenic
1012333658 6:98026656-98026678 GGAGTTTGAGACTGGCAACAGGG - Intergenic
1013139337 6:107315844-107315866 GGAGAAATACACTGGGAAGGTGG + Intronic
1022514722 7:30968314-30968336 GGAGAATGACACAGGGAAGGAGG + Intronic
1022550597 7:31235640-31235662 GGAGAAAAACACTGGAAATGGGG + Intergenic
1027301240 7:76838473-76838495 GGAGAATCTCACAGGCAAGGGGG + Intergenic
1029997739 7:105025062-105025084 GGAGAATGACATGTGGAACGTGG + Intronic
1031088916 7:117329349-117329371 GGAGAAGGATACTGTCAACTTGG + Intergenic
1033031964 7:137835662-137835684 GGGCAATGACAATGGCAATGAGG + Intronic
1034337414 7:150332394-150332416 GGAGCATGTCACTGGCCATGGGG + Exonic
1039533431 8:38285879-38285901 GGAGAAAGACAATGGTGACGTGG - Intronic
1042431002 8:68706394-68706416 GGAGAGTGACACTGTGAAAGAGG + Intronic
1048654215 8:136517506-136517528 GGAGAATGACCATGGAAATGAGG - Intergenic
1056946796 9:91004602-91004624 GAATAATGACACTGGCATAGTGG - Intergenic
1057392044 9:94648277-94648299 GGAGAAGGGGACTGGCAAGGAGG - Intergenic
1057918059 9:99072656-99072678 GGAGAATCCCCCTGGCAACCTGG + Intergenic
1062543602 9:137052258-137052280 GGAGAACGACACAGGCATTGTGG - Exonic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1188232177 X:27678122-27678144 GGAGAATGGCACTGCCAACCAGG - Intronic
1190388647 X:49910296-49910318 GGAGGATGAAACTGGAAGCGGGG - Intergenic
1198060436 X:133041192-133041214 GGAGAATGAGACTGACAAATTGG - Intronic
1199093018 X:143713254-143713276 GGAGAATGGGACTGGGAACAGGG - Intronic