ID: 923126030

View in Genome Browser
Species Human (GRCh38)
Location 1:231035335-231035357
Sequence GTCTCCCACCTGTGCAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923126030_923126033 11 Left 923126030 1:231035335-231035357 CCCACTCTGCACAGGTGGGAGAC 0: 1
1: 0
2: 2
3: 8
4: 140
Right 923126033 1:231035369-231035391 ATAGTTTAAAGAAAAAAATGAGG 0: 1
1: 0
2: 18
3: 172
4: 1619

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923126030 Original CRISPR GTCTCCCACCTGTGCAGAGT GGG (reversed) Intronic
901079306 1:6574869-6574891 ATCGCCCACCTGGGCAGAGAAGG - Exonic
904449154 1:30599998-30600020 GCCTCCCACCTGTGTAGAGCTGG + Intergenic
905625172 1:39485242-39485264 CTCACCCACCTGTGCTGAGGTGG + Intronic
907666090 1:56434932-56434954 GGCTCCCAGCTGTGCAGGGAAGG + Intergenic
909563008 1:77025858-77025880 GTTTCCCACCCGTGGAGGGTGGG - Intronic
914348860 1:146822502-146822524 GTATCCCACCTAGGCAGAGGTGG - Intergenic
915517123 1:156420162-156420184 GACTCCTACCTGTGCCGACTGGG + Intronic
915754868 1:158249904-158249926 GTCACCCATCTGTGGAGGGTTGG - Intergenic
918125024 1:181575769-181575791 GTCTCCCACCTGGGCAGCACAGG + Intronic
919962412 1:202485140-202485162 GTTTCCCCCCTGTGCAGCTTTGG + Intronic
922353166 1:224751821-224751843 GTCTCCAGCCTGAGCAAAGTGGG - Intergenic
922875762 1:228938673-228938695 TTCTCCCAGCTGAGCAGAGCTGG + Intergenic
923126030 1:231035335-231035357 GTCTCCCACCTGTGCAGAGTGGG - Intronic
924222587 1:241893504-241893526 GTTTCCCACATTTGCACAGTGGG - Intronic
1063162637 10:3430749-3430771 GCCTCCCAGCTGTGCAAATTGGG + Intergenic
1063275371 10:4561447-4561469 GTCTCCCACCTGTTCAGTCAAGG + Intergenic
1063791135 10:9449447-9449469 ATCTCCCACCTGTGGGGATTAGG - Intergenic
1063923564 10:10955554-10955576 GTCAGCCACCTGTGTGGAGTAGG + Intergenic
1067851457 10:49757399-49757421 GTCTCCCACCAGTGCCGTATGGG - Intronic
1068965320 10:62906045-62906067 GTCTCTCATCTGTGGAGACTGGG - Intronic
1069118617 10:64539381-64539403 GTCTCCCTTCTCTGCAGGGTAGG - Intergenic
1074877764 10:117627623-117627645 GTCTCCCAGCTGGGAAGAGCAGG + Intergenic
1077432417 11:2522375-2522397 GTTTCCCGGCTCTGCAGAGTGGG + Intronic
1077509855 11:2952829-2952851 ATCACCCACCTGGGCAGAGCAGG + Intronic
1081538830 11:44015411-44015433 GTCTCCCACTGGAGGAGAGTGGG - Intergenic
1081586080 11:44384815-44384837 GGCACCCACCTGGGCAGAGTGGG + Intergenic
1084542892 11:69798348-69798370 GTCTCACACCTGTGCCGGGCTGG + Intergenic
1087319475 11:96640306-96640328 GCCTCTCACCTCTGCAGAGAGGG + Intergenic
1089012086 11:115139686-115139708 GTCTCCAGCCTGCCCAGAGTGGG + Intergenic
1089632799 11:119794090-119794112 GACTCCCTCCTGTGCAGAGAGGG + Intergenic
1092930730 12:13312895-13312917 GTCTTCAAAGTGTGCAGAGTGGG - Intergenic
1094077618 12:26495150-26495172 ACCTCCCACCTGTGCAGTTTTGG + Exonic
1097170785 12:57111474-57111496 GTGTGCCTCCTGTGCCGAGTGGG + Intronic
1102281421 12:111621834-111621856 CTCTGCAACTTGTGCAGAGTAGG + Intergenic
1102498165 12:113333665-113333687 CTCTCCCTGCTGTGCAGGGTGGG - Intronic
1102944523 12:116974252-116974274 CTCTTACACATGTGCAGAGTAGG - Intronic
1104990276 12:132620618-132620640 GGCTCCCACCTGCACAGAGAGGG + Intronic
1107795300 13:44045691-44045713 ATATCCCACCTGTGTAGAGCGGG - Intergenic
1113358106 13:109602280-109602302 GCAGCCCACCTGTGCAGAGCTGG - Intergenic
1114189450 14:20429661-20429683 GGCTCCCACCTGGACACAGTAGG + Exonic
1114591629 14:23870105-23870127 GTCTCTGACTTGGGCAGAGTGGG - Intergenic
1115990974 14:39149557-39149579 CTCTTCCAGCTGAGCAGAGTTGG - Exonic
1117670598 14:58102123-58102145 TTCTCTTACCTGTGCAGAGCTGG - Intronic
1122370003 14:101224437-101224459 GCCTCACATCTGAGCAGAGTGGG - Intergenic
1124630757 15:31335784-31335806 GTCACCCATCCATGCAGAGTAGG - Intronic
1125266834 15:37891350-37891372 TTCTCACAACTGTGCAAAGTTGG + Intergenic
1128462507 15:67881833-67881855 GTCTCCCACTTCTCCTGAGTTGG + Intergenic
1132054871 15:98643285-98643307 GTCACACAGCTTTGCAGAGTAGG + Intergenic
1132729622 16:1355022-1355044 GTCTCCCGCATGTGCGGGGTCGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132887145 16:2187269-2187291 ATCTCTCACATGTGCAGAGCGGG - Exonic
1133886208 16:9830235-9830257 GTCTTCCATCTGTGAAGTGTTGG - Intronic
1135208206 16:20500009-20500031 GATTCCCACCTGTCCAGAGGGGG - Intergenic
1135210693 16:20523691-20523713 GATTCCCACCTGTCCAGAGGGGG + Intergenic
1135591996 16:23711680-23711702 GTCTCCCTCCTCTGTAGAATGGG - Intronic
1139340952 16:66267530-66267552 GGGCCCCACCTGTGCACAGTGGG - Intergenic
1139985176 16:70893053-70893075 GTATCCCACCTAGGCAGAGGTGG + Intronic
1141661774 16:85445334-85445356 GTCTGCCTCCTTTGCAGAGTGGG - Intergenic
1143031953 17:3972904-3972926 GGCTCCCAGCTGTTCAGGGTGGG + Intergenic
1143517583 17:7427459-7427481 GTCTGGCTCCTGTGCAGAGAGGG - Exonic
1144936362 17:18902198-18902220 GTCACCCACCTGTTCACAGAGGG + Intronic
1149625855 17:58080402-58080424 CTCTACCAGCTGTGCAGATTTGG - Intergenic
1151426346 17:74033245-74033267 TTTCCCCACCTGTGCAGAATGGG + Intergenic
1152613146 17:81325446-81325468 GCCTACCACCTCTGCACAGTCGG - Intronic
1152741159 17:82019044-82019066 GTCTCCAGCCTGTGCAGAAGGGG - Exonic
1155529951 18:26756839-26756861 GTCTGGCGCCTGTGCAGGGTGGG + Intergenic
1155984678 18:32217609-32217631 GTCTCTCTCCAGTCCAGAGTGGG + Intronic
1160149195 18:76386269-76386291 GTCCAGCAACTGTGCAGAGTGGG - Intronic
1160509313 18:79444438-79444460 GTCTCCCTCCAGAGCAGCGTGGG - Intronic
1161396175 19:4045951-4045973 GTCACCCACCTCAGCAGGGTAGG + Exonic
1163602086 19:18255331-18255353 GCCACACACCTGTGCAGAGCCGG - Exonic
1166304031 19:41927842-41927864 GCCTCCCACCTTCCCAGAGTTGG + Intronic
925752494 2:7102088-7102110 CTCTCCCACCTGTGAAGAGTTGG + Intergenic
925851201 2:8083863-8083885 GTTTCCCTATTGTGCAGAGTGGG + Intergenic
927043088 2:19249505-19249527 GTCCCCCATCTGTGCTGAGATGG - Intergenic
929243012 2:39671829-39671851 GTCTCTCATCTGAGCAGAGGAGG + Intronic
931424973 2:62162511-62162533 CTCTCCCAACTCTGCATAGTGGG + Intergenic
932765436 2:74466118-74466140 GTCTACCACTAGTGGAGAGTGGG - Intergenic
933553327 2:83802749-83802771 GCCTCCCAGCTGGGAAGAGTGGG + Intergenic
942175531 2:173330179-173330201 TTTTCCCAACTGTACAGAGTAGG + Intergenic
942517431 2:176768612-176768634 GTTTCCCAGCTGTGCAAACTCGG + Intergenic
943765117 2:191652511-191652533 GTCTCCCACCTGAAAAGAATAGG - Intergenic
944209944 2:197196893-197196915 GTCCCTCACCTGTGGAGAGGTGG - Intronic
947695898 2:232188203-232188225 GTTTCCCCTCTGTGCAGAGAAGG + Intronic
948977025 2:241470060-241470082 GTGTCCCACATTTGGAGAGTGGG - Intronic
1172650429 20:36498312-36498334 GAATCCCACCTGTGCAGCGCAGG - Intronic
1172873596 20:38150844-38150866 CACTCCCACCTGTGCAGCTTTGG + Intronic
1173071531 20:39773182-39773204 TTATCCCACCTGTGGAGAGAGGG + Intergenic
1173152682 20:40581359-40581381 TTCTCTCACCTGTGTAGAGGTGG - Intergenic
1175364844 20:58445894-58445916 CTCTCAAACCTGTGCACAGTGGG - Exonic
1175585680 20:60137686-60137708 GTCTCCAATCTGTGCAGAGTAGG + Intergenic
1181177789 22:21047619-21047641 GTCTCCCAGATGTGGAGGGTAGG - Intronic
1181333580 22:22113412-22113434 TTCTTTCACCTGTGCAGAGAAGG - Intergenic
1182895191 22:33853699-33853721 CTTTCCCACATGTGCTGAGTTGG + Intronic
1184033547 22:41908293-41908315 GTCCCACAGCTGTGCAGAGCTGG - Intergenic
1184761393 22:46546792-46546814 GTCTCCCAGATGTGCAGATGTGG - Intergenic
1184943578 22:47785425-47785447 CTCTCCAACCTGCGCAGTGTGGG - Intergenic
950957147 3:17066093-17066115 GTCTCCCGGATGTGAAGAGTGGG + Intronic
954367954 3:50156040-50156062 GTCTCCCACATCAGCAGAGTGGG + Intronic
956975706 3:74576022-74576044 GTCTGCCTCCTGTGGAGTGTTGG + Intergenic
962825242 3:139095202-139095224 GTCTGGCTCCTGTACAGAGTTGG + Intronic
966923292 3:184628539-184628561 GCCTCCCCCCAGTGCAGAGCTGG - Intronic
968647003 4:1746195-1746217 TTCTCCCATCAGTGAAGAGTGGG + Intergenic
968984875 4:3869702-3869724 GGCTCTCACCTGGGCTGAGTGGG - Intergenic
969877225 4:10144735-10144757 GTCTCCCTCCTGAGCATTGTGGG + Intergenic
971489138 4:27192563-27192585 AGCTCCCACGTGAGCAGAGTGGG - Intergenic
974865296 4:67572786-67572808 GTCTCACAACTCTGCAGAATGGG + Intronic
978061638 4:104345985-104346007 TTTTCCCAGCTGTGCATAGTGGG + Intergenic
978188803 4:105889715-105889737 GTTTCCCACCTGTGTAAAGTGGG - Intronic
987396694 5:17431042-17431064 TTCTCCCTCCAGTGCAGAATAGG - Intergenic
988450359 5:31336212-31336234 GTCATCCAGCTGTGCAGGGTAGG + Intergenic
989553264 5:42760490-42760512 GTCTACCATTTGTCCAGAGTTGG - Intronic
989952787 5:50320333-50320355 GGCTCCCAACAGTGGAGAGTTGG + Intergenic
992844311 5:80729895-80729917 CCCTCCCACTTGTGCAGAATGGG - Intronic
994186212 5:96817920-96817942 TTCTCACACCACTGCAGAGTCGG - Intronic
994525854 5:100903832-100903854 GTCCACCACCCATGCAGAGTGGG - Intergenic
995183628 5:109250678-109250700 GACAGCCACCTTTGCAGAGTGGG - Intergenic
997969764 5:138391660-138391682 GTCTCACTCCTCTGCAGATTCGG + Exonic
998248707 5:140534037-140534059 GTTACCCACATGTCCAGAGTAGG + Intronic
998377284 5:141699608-141699630 GACTCCCACCTCTGCAAAGATGG - Intergenic
1003253430 6:4453876-4453898 GTCTGCCACCTGTGCAGCAAAGG + Intergenic
1003354321 6:5352403-5352425 GCCACACACCTGAGCAGAGTGGG - Intronic
1012168729 6:95991336-95991358 GCCTCCTACCTGGACAGAGTGGG + Intergenic
1013791085 6:113837328-113837350 GTCTCCCACAAGTGAAGAGAAGG - Intergenic
1017811261 6:157985492-157985514 GCTTCCCACCTGTGCTGAGAAGG - Intronic
1018456834 6:163960868-163960890 GTCTCCAACGTGTGCAGGGCTGG + Intergenic
1019406661 7:887599-887621 GTCACCCACCAGGGCAGAGATGG + Intronic
1019517783 7:1447356-1447378 CTCTCCCATCTGTACAAAGTGGG + Intronic
1022245894 7:28559039-28559061 CTCTCACACCTGTGTAGTGTGGG - Intronic
1022834219 7:34098306-34098328 CTCTCCCTCCTGTGCATGGTGGG - Intronic
1023087029 7:36581058-36581080 GTTGACCACCTGTGGAGAGTTGG + Intronic
1024185308 7:46942819-46942841 CTCTCCCAACTGTGCAGATCTGG - Intergenic
1025144993 7:56494632-56494654 CTCTGCCTCCTGTGCAGAGGAGG + Intergenic
1028594947 7:92538426-92538448 GTCTCCCATCTCTGAAGAGGAGG - Intergenic
1029501489 7:100933568-100933590 GTTTCCCACCTGGGCACAGTGGG + Intergenic
1033194044 7:139311511-139311533 GTCTCACCCCTGTGCAGATGAGG - Intergenic
1034628697 7:152514067-152514089 GTCTGACACCTGTGGAGGGTGGG - Intergenic
1034666399 7:152821686-152821708 GTCTCCCCCCTGTGAAGGCTGGG + Intronic
1046646030 8:116786593-116786615 CTCTACCACCAGAGCAGAGTTGG - Intronic
1058896515 9:109405233-109405255 GTTCCCCACCTGTGCAAGGTTGG - Intronic
1060924318 9:127445236-127445258 CTCACCCACCTGTCCTGAGTCGG - Exonic
1062585556 9:137247864-137247886 GTGTCTCACCTGTGCAATGTGGG - Intergenic
1185719905 X:2373234-2373256 GATTCCCACCTGTGAAGGGTGGG - Intronic
1187361141 X:18628648-18628670 GGCACCCAGCTGTTCAGAGTAGG - Intronic
1189192424 X:39122165-39122187 GTCTCCCAGGTGTGCCCAGTGGG - Intergenic
1189232186 X:39461159-39461181 CTCTCCCACCTCTGCAGGATAGG - Intergenic
1198152232 X:133922507-133922529 TTCTGCCACCTGTGCACAGCTGG - Intronic
1200710987 Y:6484908-6484930 TTCTCTCAACTGTGAAGAGTTGG - Intergenic
1201022947 Y:9677077-9677099 TTCTCTCAACTGTGAAGAGTTGG + Intergenic
1201910845 Y:19132267-19132289 TTCTCCCACCTCTGAAGAGTTGG - Intergenic
1201929803 Y:19330129-19330151 GTTTTCCACCTGTACAAAGTAGG - Intergenic