ID: 923126094

View in Genome Browser
Species Human (GRCh38)
Location 1:231035818-231035840
Sequence CAGTTTGCAAAAATGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923126094 Original CRISPR CAGTTTGCAAAAATGGAGCA AGG (reversed) Intronic
901348735 1:8572341-8572363 CTGTGTGCTAAAATGGAGGAAGG - Intronic
901562525 1:10084027-10084049 AGGTTAGCAAAAATGGGGCAGGG - Intronic
901733314 1:11296026-11296048 CAGTCTGGAACAATGGGGCATGG - Intronic
902825255 1:18968949-18968971 CAGTGAGCAATAATGGGGCATGG + Intergenic
904772758 1:32889705-32889727 CAGTTGGCAAAATTGGAATATGG - Intronic
905121943 1:35689068-35689090 AAGTTTCCAAAAGTGGAGCTTGG + Intergenic
905380214 1:37556667-37556689 CAGGTGACAAAATTGGAGCATGG + Intergenic
905855292 1:41307413-41307435 CAGTTAGAAAAAATTGAGCTGGG - Intergenic
906064862 1:42973445-42973467 CAGGCTGTAAAATTGGAGCATGG + Intergenic
906439585 1:45829683-45829705 CAGTTTCCCAAAATGAAGTATGG + Intronic
907254043 1:53164733-53164755 CAATGTACAAAAATGCAGCAGGG - Intergenic
909300554 1:74008156-74008178 AATTGTGCAAAAATGGAGAAAGG - Intergenic
910723452 1:90312969-90312991 CAGTTTGCTAAAGAGGAGTAGGG - Intergenic
910784156 1:90975977-90975999 CAGTTTGAAAAAATAGCACAAGG + Intronic
912449899 1:109762203-109762225 CAGTTTGCAGAACTGAAACAGGG - Intronic
913001826 1:114588288-114588310 TAGTTAGCACAAATGCAGCATGG - Intronic
914379185 1:147101083-147101105 CAGTTAGCAAAGAGAGAGCAGGG + Intergenic
915143778 1:153782673-153782695 TAGTTTGCAAAGATGAACCAGGG + Intergenic
915189636 1:154138117-154138139 CAAGTTGCAAAAATGGTTCAAGG - Exonic
918250065 1:182695381-182695403 GAGTGTGCTAAAATGGAGGAAGG - Intergenic
919371206 1:196728478-196728500 CAGTCTGCATAAATGGAAGATGG + Exonic
920009595 1:202858326-202858348 CAGCTTTAAAAAATGGAGGAGGG + Intergenic
920537261 1:206746160-206746182 AAGTTTGCAAGGGTGGAGCATGG - Intergenic
920661806 1:207921734-207921756 CACTTTGCAGAAAGTGAGCAGGG - Intergenic
921436700 1:215131216-215131238 CAGTTGGCAAAAATGACGTATGG + Intronic
923126094 1:231035818-231035840 CAGTTTGCAAAAATGGAGCAAGG - Intronic
923281625 1:232448691-232448713 CAGAATGCCAAAATGGTGCAGGG + Intronic
924639081 1:245816359-245816381 CTGTTTGCTAGAATGGAGCTTGG + Intronic
924654928 1:245965814-245965836 GAGTTTGCACAAATGTAGAATGG - Intronic
1063421894 10:5919095-5919117 AGATTTGCAAAAATGGAACATGG + Intronic
1063956500 10:11272479-11272501 CAGTTTTCAGAAATGGTGGATGG - Intronic
1064926479 10:20574858-20574880 CAGTTTGCAAAAAAGAAACAGGG - Intergenic
1066995398 10:42558456-42558478 CAGTATGCAAAAATAGAGAAAGG - Intergenic
1067059607 10:43071180-43071202 CTGTTTCCAAAAATGGTGCCTGG + Intergenic
1069354856 10:67573317-67573339 CAGTTTGCAAGCATGCAGCCTGG + Intronic
1070042665 10:72796994-72797016 CAGTTTTCATAAATGTTGCATGG + Intronic
1070445457 10:76496392-76496414 CAGTTTGCTGAGATGGAGCTGGG - Intronic
1071033923 10:81219230-81219252 TAGTTTGCAAAAATTCATCATGG + Intergenic
1071926466 10:90415459-90415481 CAGCTTGCACACATGAAGCAGGG - Intergenic
1072008812 10:91285817-91285839 AAGTTTTGTAAAATGGAGCAGGG - Intergenic
1072523640 10:96252693-96252715 CAGTTTGCAAAACTGTAGAATGG + Intronic
1076036921 10:127206825-127206847 AAGCTTTGAAAAATGGAGCAGGG - Intronic
1078289742 11:9996831-9996853 TTGTTTGCCAAAATGAAGCATGG - Intronic
1078298847 11:10104362-10104384 CAGTTTGAAACAATGGTGGAAGG + Intronic
1078544691 11:12238883-12238905 AAGATAGCAAAAATAGAGCAGGG + Intronic
1081446844 11:43138984-43139006 CAGTGGGCAGAACTGGAGCATGG - Intergenic
1081821414 11:45999346-45999368 TACTTTGCAGAAATGGAGTAAGG + Intronic
1082027369 11:47582599-47582621 CAGGTTACAAAAATGAAGCTAGG - Intronic
1082743412 11:56936448-56936470 CAGTTTGAAAAAATTGAGTTGGG + Intergenic
1083552483 11:63600283-63600305 CTGTTTTAAAAAATGCAGCATGG - Intronic
1085012961 11:73154068-73154090 CCATTTGCAAAAATGGAGTTTGG - Intergenic
1085163270 11:74369278-74369300 CAGTGTACAAAAATGGATAATGG + Intronic
1086469240 11:87088484-87088506 CAGTTTTCAACAATTGAGTAAGG - Intronic
1088694896 11:112358323-112358345 AAGTCTGCAAGAATGGAGCGGGG - Intergenic
1089050118 11:115538632-115538654 CAATTTCCAAAAATGGAATAAGG - Intergenic
1090057124 11:123432884-123432906 CTGTTTGCAACAACTGAGCATGG + Intronic
1094644496 12:32308829-32308851 CAGTTTGCAAAGATGTAGAGGGG + Intronic
1094773796 12:33697603-33697625 TTGAATGCAAAAATGGAGCAAGG - Intergenic
1095173765 12:39066200-39066222 CAGTTTGAATAAATGTAGAAAGG + Intergenic
1096408982 12:51363899-51363921 CAGCTAGCAACAGTGGAGCAAGG - Intronic
1096430031 12:51535354-51535376 CAGTTTTAACAAATGTAGCAGGG - Intergenic
1097081367 12:56433604-56433626 CAGATTGCCAAAACAGAGCAAGG + Exonic
1098609823 12:72442680-72442702 CAGGGTGCAAAATAGGAGCAGGG - Intronic
1099271011 12:80511371-80511393 CAGTTAGCGAAAAGGAAGCAGGG + Intronic
1100141508 12:91624432-91624454 CATTTTGAAAGAAAGGAGCAAGG - Intergenic
1101417924 12:104524686-104524708 CCATTTGCCAAAATGGAGGATGG - Intronic
1102184511 12:110937226-110937248 CAGTTTGGAGAAATGCAGCGCGG - Intergenic
1103053960 12:117803987-117804009 CAGTTTACAAAAATAGCCCATGG - Intronic
1105615957 13:22012707-22012729 CAGGGTGCTATAATGGAGCATGG - Intergenic
1106328879 13:28720267-28720289 GAGTTTCAAACAATGGAGCATGG + Intergenic
1107315660 13:39128791-39128813 CAGTTTGCAGAAATAGCGGAGGG + Intergenic
1111913618 13:94338533-94338555 CACTTGGGAAAAATGGACCATGG - Intronic
1111951100 13:94710340-94710362 CAGTTTACAAAAAAGGAAAAAGG - Exonic
1111972141 13:94927553-94927575 CAGTCTGCCAAATGGGAGCATGG + Intergenic
1112052995 13:95662755-95662777 GAGTTGGCCAAAATGTAGCAGGG - Intergenic
1112917642 13:104570982-104571004 CAGTTTCCAAGAAAGAAGCAAGG - Intergenic
1114440628 14:22743939-22743961 CAGTTGGCAAAATTTGAACAGGG + Intergenic
1114755032 14:25249544-25249566 TAATTTTCAAAAATGCAGCATGG + Intergenic
1115083800 14:29489426-29489448 AGGGTTGCAAAAAAGGAGCAAGG - Intergenic
1115388512 14:32826208-32826230 CAGTATGCAAAATTGAAGAAAGG + Intronic
1116219270 14:42061642-42061664 CAGCTTCCAAAAATCTAGCAAGG + Intergenic
1118922740 14:70165031-70165053 CACTTGCCAAAAATGGATCAGGG - Intronic
1118949454 14:70420728-70420750 AAATGTGCAAAAATAGAGCAAGG - Intergenic
1119897913 14:78236175-78236197 CAGTTTGTGAAAATGCAACAAGG - Intergenic
1120314286 14:82871982-82872004 CAGTTTGCACCCATGAAGCAGGG - Intergenic
1120812499 14:88818633-88818655 CAGTCAGAAACAATGGAGCAAGG - Intergenic
1121872176 14:97418575-97418597 CAGTTTGCCTAAATGGAGGAGGG - Intergenic
1123150296 14:106175023-106175045 GAGTGTTCATAAATGGAGCAGGG - Intergenic
1123724354 15:23087309-23087331 CAGTTTGCAGAAAAGGAGGCAGG + Intergenic
1124200555 15:27675277-27675299 CAGTCTGGATAAATGGATCAAGG + Intergenic
1124618731 15:31261874-31261896 CACTCTGCAACAAAGGAGCATGG - Intergenic
1125088228 15:35757478-35757500 CAGTTGGAAATAATGGAGCTTGG - Intergenic
1126223484 15:46242340-46242362 TAATTTGCAAAAGTGGAGCTTGG + Intergenic
1127579672 15:60326754-60326776 CAGTTTTCAAAAAAGGGACAAGG - Intergenic
1128752004 15:70156476-70156498 CAGTTGGCGATAATGGAGCTGGG - Intergenic
1130602198 15:85283794-85283816 CACTTTGCAAAACAGGAGGAAGG + Intergenic
1130766808 15:86879199-86879221 CATTTTGCAAAACAGGAGGAAGG - Intronic
1131034366 15:89211491-89211513 CAGGTTTGAAAAATGAAGCAGGG + Intronic
1133397908 16:5463018-5463040 CATTTTTTAAAAATGGACCAAGG - Intergenic
1135077229 16:19403895-19403917 CAGTTTGCACCCATGAAGCAGGG + Intergenic
1135270682 16:21067129-21067151 CAGTTTTCAGGAATGGGGCATGG - Intronic
1139116816 16:63964152-63964174 CAGGCTGCAAAATTTGAGCATGG + Intergenic
1141084048 16:81078754-81078776 CACTTTGCAAAAACGGAGAATGG + Intergenic
1146675232 17:34768737-34768759 CAGTGTGTAAAAAGGAAGCAAGG - Intergenic
1148057043 17:44805504-44805526 AAGATTGCCAAAATGGAGCACGG - Exonic
1149338456 17:55662258-55662280 GAGGATGCAAAAATGGAACAGGG - Intergenic
1150831986 17:68530489-68530511 CAGTTTGCATGAGTGAAGCATGG - Exonic
1151573197 17:74937506-74937528 CAGTTGGGATATATGGAGCAGGG + Intronic
1152261598 17:79270185-79270207 GAGTTGGGAAAAAGGGAGCAGGG - Intronic
1153506875 18:5809835-5809857 CCGTTTTCAAAAATGGTGCTGGG - Intergenic
1156642456 18:39119060-39119082 CAATTTTTAAAAGTGGAGCATGG - Intergenic
1156707981 18:39907090-39907112 GAGTTTGCAAAATGGGAGTATGG - Intergenic
1157146611 18:45169690-45169712 CACTGTGGGAAAATGGAGCAGGG - Intergenic
1159784422 18:72696692-72696714 CAGTTTGCACCCATGAAGCAAGG - Intergenic
1161058587 19:2202758-2202780 CGGTTTGCAAACATGAAGGAAGG + Exonic
1161756332 19:6136971-6136993 CAGTTCACAAAAAAGGAGCCTGG - Intronic
1162402453 19:10454284-10454306 CAGTTTGGAAAAAGGGAACGTGG - Intronic
1163816479 19:19468068-19468090 CATTCTGGAAAAATTGAGCAGGG + Intronic
1164847341 19:31444872-31444894 TAGTTTGCAATACTGGAGCTGGG + Intergenic
925269155 2:2590106-2590128 GTGTTGGCAAAAATGGGGCAGGG - Intergenic
925567123 2:5268528-5268550 CAGTATACAAATATGTAGCATGG - Intergenic
925965854 2:9065284-9065306 CAGTTTTGAAAATTAGAGCAAGG + Intergenic
927555652 2:24029646-24029668 CAGTTTACCAAGATGGAGCTGGG - Exonic
929640582 2:43575043-43575065 CAGTTTACAATAATGGCTCATGG - Intronic
929840610 2:45458654-45458676 CTGTTTTCAAAAATGTAGTAAGG - Intronic
932865996 2:75343813-75343835 CAGATTCAAAAGATGGAGCAAGG - Intergenic
933029948 2:77315872-77315894 TAGTTTGACAAATTGGAGCAAGG - Intronic
933878218 2:86641536-86641558 CCGTTTGCAGAAATTCAGCAAGG - Intronic
937596009 2:123674298-123674320 CAGTCTGCAAACATGGAGAAAGG + Intergenic
937648531 2:124294549-124294571 CAGTTTGAAGAACTGGAGGAAGG + Intronic
939413152 2:141857635-141857657 CAGTTTTCTAAAATGGAGAGGGG - Intronic
939894935 2:147780033-147780055 CAGTTTGCAGTAATGGAGTAAGG - Intergenic
940196189 2:151096952-151096974 AAGTTTGCTAAAACGGAGGATGG - Intergenic
940901165 2:159127867-159127889 CAATTTGGAAAAAAGGAGCATGG + Intronic
941096853 2:161247112-161247134 CAGTTTGCAGAAATCCAGCAAGG + Intergenic
941208455 2:162604771-162604793 TAGTATGAAAAAAGGGAGCAGGG - Intronic
942129610 2:172865280-172865302 CTGTTTGCAAAAAGTGACCAAGG - Intronic
942207899 2:173640628-173640650 CAGTTTGGAGAATTGGACCATGG - Intergenic
942941784 2:181627180-181627202 CAGTTTGGTACAATGGAGAATGG + Intronic
945159388 2:206873719-206873741 CAGTTTGGAAAATGGTAGCATGG + Intergenic
945379574 2:209123701-209123723 CAGTCTGCACAAATTCAGCAAGG - Intergenic
946579821 2:221116151-221116173 CAGTTAGCAAAGATGGATGAGGG + Intergenic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
948000024 2:234560158-234560180 CAGTTTGCAGAATGGGAGAAGGG + Intergenic
948214224 2:236216686-236216708 CAGTTTGCTAGATTGCAGCAAGG - Intronic
948961587 2:241342952-241342974 CAGTTTGCTAAAATTGATCCTGG + Intronic
1170979220 20:21195554-21195576 CAGGATGCAAACCTGGAGCAAGG - Intronic
1172335008 20:34108398-34108420 CAGTTTACAAATAAGGACCAGGG + Intronic
1172900521 20:38331262-38331284 CAGTTAGTAAGTATGGAGCAGGG - Intronic
1175861863 20:62154711-62154733 CAGTTTGCCAAAAAAGACCAGGG - Intronic
1176864512 21:14037868-14037890 TAATTTGCAAAAGTGGAGCTTGG + Intergenic
1178451639 21:32707064-32707086 CAGTATGAAAAAAGGGAGAAAGG - Intronic
1179088497 21:38242000-38242022 CAGAGGGCAAAAAGGGAGCAAGG - Intronic
1179130987 21:38636929-38636951 CAGTTTACAAACATGAACCATGG + Intronic
1179394265 21:41023735-41023757 GCCTTTGCCAAAATGGAGCATGG - Intergenic
1185130673 22:49037167-49037189 AGGTTTGCAAGACTGGAGCAAGG + Intergenic
949395659 3:3612306-3612328 TAGTTTACAAACATGCAGCAGGG + Intergenic
949528668 3:4931980-4932002 CAATTGACAAAACTGGAGCATGG + Intergenic
949649878 3:6144760-6144782 CATTTTACAAAAATGGATAATGG + Intergenic
953915810 3:46920591-46920613 CAGTTGGTAAAACTGGAGCTGGG - Intergenic
956042748 3:65162790-65162812 CAGTTTCCAAGGGTGGAGCAAGG + Intergenic
956106402 3:65823248-65823270 GAGTTTGCAAAAGTGGATGACGG + Intronic
956345627 3:68274944-68274966 CAATTTGCAAAACAGAAGCATGG + Intronic
956684473 3:71811971-71811993 GAGTGTGCAAACATGGAACATGG + Intergenic
957288329 3:78245634-78245656 TAGTTTGAAAAAATAAAGCAGGG - Intergenic
958137634 3:89517124-89517146 CAATTTTCATAAATGGATCATGG + Intergenic
958696280 3:97531433-97531455 CAGTGTGCATAAAAGGAGTAAGG - Intronic
959320100 3:104862244-104862266 AAGTGTGCAAAAATGAGGCATGG + Intergenic
959442813 3:106399523-106399545 CAGATAGCAAAGATGGAACAAGG - Intergenic
960506222 3:118497989-118498011 CAGTTTTTAAATATGGAACATGG + Intergenic
960932120 3:122863291-122863313 CAGTCTGAAAATCTGGAGCATGG + Intronic
961143903 3:124578402-124578424 CAGTTAGCAACCAGGGAGCATGG + Intronic
962017674 3:131459056-131459078 CAGTTTGCCAGAATGGAGTCTGG + Intergenic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
963580017 3:147113867-147113889 CAGTTGGCAGAAGTGGAGGAGGG + Intergenic
964210598 3:154222804-154222826 TAGTTTGCAGAAAGGGAGCCAGG + Intronic
966328546 3:178784388-178784410 CAGTTTACAAAGAGGAAGCATGG - Intronic
967805573 3:193711985-193712007 GAGTTGGCAAAAATGAAGCATGG - Intergenic
969588842 4:8109797-8109819 CAGTTTGCAAAACCGGAGGCAGG - Intronic
971243796 4:24911596-24911618 CAGTTTGAGAAGATGGAGCCAGG + Intronic
972532152 4:39971072-39971094 CAGTTTTCAAGAATGGAACAAGG - Intronic
973131917 4:46658417-46658439 CAGTATGCAATGATGAAGCATGG + Intergenic
974719759 4:65723351-65723373 CAGTAAGCAAAATTGGAGAAGGG + Intergenic
975354069 4:73379359-73379381 CAATTTAAAATAATGGAGCATGG - Intergenic
976366619 4:84240152-84240174 CTGTTTCCAAAACTGGAGTAAGG + Intergenic
976634467 4:87273808-87273830 TAGTTTGCAAGAATGGTGGAGGG + Intergenic
978159416 4:105527648-105527670 CAGTTTCCAAAATTTAAGCAGGG + Intergenic
978580590 4:110227763-110227785 CAGTTTGCAACCTTGGTGCAGGG + Intergenic
979138563 4:117143923-117143945 CAGTTCTCAAATATGGAGAAGGG - Intergenic
979400992 4:120249348-120249370 CAATTTGTAAAAATGTATCAAGG - Intergenic
979704345 4:123703728-123703750 CAGTTTGAAAAGAATGAGCATGG + Intergenic
980327959 4:131372700-131372722 TAGTTTGCAAATATGGATCTTGG - Intergenic
981735722 4:147948369-147948391 CAGTTGGTAAAAATTGAACATGG - Intronic
984817111 4:183849166-183849188 CAGTTACCAAAATTGGAGCTTGG + Intergenic
985095645 4:186410069-186410091 CTGATTCCAAGAATGGAGCAAGG + Intergenic
985326656 4:188778135-188778157 CATTTTGCAAAGAGGGAACATGG + Intergenic
988704419 5:33710357-33710379 CAGTTTCCACCACTGGAGCATGG + Intronic
991989604 5:72324515-72324537 CAGGTTGGAGAAATGGAGGAGGG - Intronic
993051558 5:82932189-82932211 CATTTTGAAAAAAGTGAGCATGG + Intergenic
993344758 5:86769187-86769209 AAGTTTGGAAAAATGCAGCCTGG - Intergenic
993518159 5:88863651-88863673 CAGTTTCCAGAAATGGAGGCGGG - Intronic
996912025 5:128667325-128667347 TACTTTGCAGAACTGGAGCAAGG - Intronic
997218752 5:132138851-132138873 CAGTTTTGAAAAATGTACCATGG + Intergenic
997357679 5:133274313-133274335 CATTTTGCAAAAGTAGAGAAGGG - Intronic
997892966 5:137691554-137691576 CAGTGTGGAAAGGTGGAGCAGGG + Intronic
1000961369 5:167605238-167605260 CATTTTGATAAAATAGAGCATGG + Intronic
1001061418 5:168492965-168492987 CAGTTTGAAAAACTTGAGAAAGG + Intronic
1001221975 5:169908404-169908426 TAGTTTTAAAACATGGAGCAGGG - Intronic
1001776817 5:174335106-174335128 GAGTTTGAGAAACTGGAGCAGGG - Intergenic
1004615400 6:17283122-17283144 CTGTGTGCAAAAATGGATCTTGG + Intronic
1006872175 6:37261710-37261732 CAGTTTCAAAAACTGAAGCAAGG - Intronic
1007996051 6:46309109-46309131 AAGTTTGCAGAAATGAAGCCAGG + Intronic
1008193305 6:48486806-48486828 CAGTTTCCAAGGATGGAGGAGGG + Intergenic
1008729774 6:54467359-54467381 CAGTTTGTAAAGATGGGTCAAGG - Intergenic
1008818334 6:55597749-55597771 CAGTTTGTAAAAATGGAAAATGG + Intergenic
1012111178 6:95236518-95236540 CAGTTTGAAAAAATTGGTCATGG + Intergenic
1012201006 6:96405968-96405990 CAGATGGCAAAAGAGGAGCAAGG + Intergenic
1012418328 6:99034341-99034363 CAGTTTGCAAAGATGTGGCTCGG - Intergenic
1012912001 6:105128236-105128258 CAGTTTGATAATATGGGGCATGG - Intronic
1015577923 6:134692288-134692310 CAATTTAAAAAAATGGAACATGG - Intergenic
1015744817 6:136498644-136498666 GAGTTTGGAAAAATGGAAGATGG + Intronic
1017853770 6:158330676-158330698 CAGTTGACAAAAGTGGAGTATGG - Intronic
1019551306 7:1603946-1603968 CAGATTGCAAAAATGCAGCCCGG + Intergenic
1019830623 7:3324884-3324906 CTGTTAGGAAAAATGAAGCATGG - Intronic
1020865716 7:13559509-13559531 CAGTTTTGAAAAATGAAACATGG - Intergenic
1021064050 7:16150479-16150501 CACTTTGAAAATATGAAGCATGG + Intronic
1021432496 7:20576457-20576479 CAGGTTGAAAAAATGGAGGAAGG - Intergenic
1021910934 7:25385545-25385567 CAGTTTACAAAAATGGAGAAGGG - Intergenic
1023055027 7:36284208-36284230 CAGCTTACAAAAATGGTGCCTGG - Intronic
1023433036 7:40114117-40114139 TAGGTTACAAAAATGAAGCATGG - Intergenic
1024372142 7:48597763-48597785 CATTTTTAAAAAATGGAGGATGG - Intronic
1026958159 7:74391174-74391196 CAAATTGCAAAGATGGAACATGG - Intronic
1028409210 7:90509636-90509658 CAGTTTACAAACATGAAGCCAGG + Intronic
1028431191 7:90749154-90749176 AAGTTTGTAAAAATGGTGCAGGG + Intronic
1030021358 7:105278376-105278398 CAATTTGCAAAAATGAGGCTGGG + Intronic
1030805458 7:113912627-113912649 CAGTTAGCAGAAGTGGAGGAAGG + Intronic
1031127485 7:117791407-117791429 CAGTTTGCCACAAGGGAACAGGG - Exonic
1034904362 7:154930818-154930840 CAGTTTGAAGAATGGGAGCAAGG + Intronic
1037863208 8:22421169-22421191 CAGTTTGCAAACATGGCCCCTGG - Exonic
1038728229 8:30101014-30101036 TAGTTTGCAAAAGTAGAGCTGGG - Intronic
1038890568 8:31717545-31717567 CACTTTGTAAGACTGGAGCAGGG - Intronic
1043545586 8:81312162-81312184 CAAAGTGCAAAAATGAAGCAGGG + Intergenic
1043743101 8:83839134-83839156 CAGCTGGCAAAACAGGAGCATGG + Intergenic
1045023435 8:98064105-98064127 CAATTGGCAAAAAGGGAACATGG + Intergenic
1045702083 8:104879026-104879048 AAATTTGCAAAAATGGATCAAGG + Intronic
1050317160 9:4414211-4414233 CAGTTCAGAAAAATGTAGCAGGG + Intergenic
1052730354 9:32278053-32278075 CAGCTGGGAAAAATGGAGGATGG - Intergenic
1054721976 9:68613331-68613353 CAATTTGCAAACATGGGGGATGG - Intergenic
1055660798 9:78502129-78502151 CAGGTTGGAGAAATGGATCACGG + Intergenic
1056804848 9:89720689-89720711 TGGTTTCCAAAAATGGAACAGGG - Intergenic
1057383600 9:94589526-94589548 CAGTGAGCAGACATGGAGCATGG - Intronic
1058500054 9:105604321-105604343 CAGTTTGCAGATATAGTGCAGGG - Exonic
1059286292 9:113174674-113174696 GAGTTTTCAGAAATGGAGTAAGG - Intronic
1059344762 9:113620658-113620680 CACTTTGCAAAAATGCAGGCGGG - Intergenic
1059378917 9:113908340-113908362 CAGTTTAAAAAAATGGAGGAGGG + Intronic
1059703698 9:116800400-116800422 CTGTGTGCAAAAATTAAGCATGG - Intronic
1189322036 X:40092556-40092578 CAATTTGCTAAGGTGGAGCAGGG - Intronic
1192216553 X:69163331-69163353 CAGTTTAGAATAAAGGAGCAGGG + Exonic
1196083385 X:111657964-111657986 CAGATTGGAAGGATGGAGCAGGG - Intergenic
1197062275 X:122195669-122195691 CAGCTTGCACCAATGAAGCAAGG - Intergenic
1197701029 X:129599797-129599819 CAGTCTGAAAAAATGGGGGATGG - Intergenic
1198657410 X:138929825-138929847 CAGTTCACAACAATGGACCAGGG - Intronic
1201247551 Y:12020749-12020771 CAGTTTGCCATAATGTAGCCTGG + Intergenic