ID: 923127589

View in Genome Browser
Species Human (GRCh38)
Location 1:231046074-231046096
Sequence TTGTCCTGCTACAAGAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923127589_923127593 16 Left 923127589 1:231046074-231046096 CCACCACTCTTGTAGCAGGACAA No data
Right 923127593 1:231046113-231046135 ATCAGACACCGGGTTAAAGAAGG No data
923127589_923127592 6 Left 923127589 1:231046074-231046096 CCACCACTCTTGTAGCAGGACAA No data
Right 923127592 1:231046103-231046125 GACAAAACTCATCAGACACCGGG No data
923127589_923127594 20 Left 923127589 1:231046074-231046096 CCACCACTCTTGTAGCAGGACAA No data
Right 923127594 1:231046117-231046139 GACACCGGGTTAAAGAAGGAAGG No data
923127589_923127591 5 Left 923127589 1:231046074-231046096 CCACCACTCTTGTAGCAGGACAA No data
Right 923127591 1:231046102-231046124 AGACAAAACTCATCAGACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923127589 Original CRISPR TTGTCCTGCTACAAGAGTGG TGG (reversed) Intergenic
No off target data available for this crispr