ID: 923128355

View in Genome Browser
Species Human (GRCh38)
Location 1:231053063-231053085
Sequence CCTGGGAGGCAGAAGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4891
Summary {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923128355_923128369 25 Left 923128355 1:231053063-231053085 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 923128369 1:231053111-231053133 TCTCTAGTAGCTGGGATTACAGG 0: 247
1: 9385
2: 118513
3: 266176
4: 249202
923128355_923128365 17 Left 923128355 1:231053063-231053085 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 923128365 1:231053103-231053125 CCCCAGCCTCTCTAGTAGCTGGG 0: 11
1: 627
2: 20048
3: 233573
4: 284759
923128355_923128363 16 Left 923128355 1:231053063-231053085 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 923128363 1:231053102-231053124 GCCCCAGCCTCTCTAGTAGCTGG 0: 6
1: 477
2: 16882
3: 211757
4: 266792

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923128355 Original CRISPR CCTGGGAGGCAGAAGTTGCA GGG (reversed) Intergenic
Too many off-targets to display for this crispr