ID: 923129615

View in Genome Browser
Species Human (GRCh38)
Location 1:231064165-231064187
Sequence AACTCACTAGGTTTTTCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923129615_923129618 14 Left 923129615 1:231064165-231064187 CCTACAGAAAAACCTAGTGAGTT No data
Right 923129618 1:231064202-231064224 CTTACACAATTATGGTTCCCTGG No data
923129615_923129617 6 Left 923129615 1:231064165-231064187 CCTACAGAAAAACCTAGTGAGTT No data
Right 923129617 1:231064194-231064216 GAAAAAGACTTACACAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923129615 Original CRISPR AACTCACTAGGTTTTTCTGT AGG (reversed) Intergenic
No off target data available for this crispr