ID: 923134762

View in Genome Browser
Species Human (GRCh38)
Location 1:231108189-231108211
Sequence GGGACCTTGCCTACATGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923134756_923134762 5 Left 923134756 1:231108161-231108183 CCGGAGCAGTTAATGAGGCCCGA No data
Right 923134762 1:231108189-231108211 GGGACCTTGCCTACATGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923134762 Original CRISPR GGGACCTTGCCTACATGCTA AGG Intergenic
No off target data available for this crispr