ID: 923140727

View in Genome Browser
Species Human (GRCh38)
Location 1:231160362-231160384
Sequence CAGTAGCCACAGATGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923140727_923140734 19 Left 923140727 1:231160362-231160384 CCATCTCCCATCTGTGGCTACTG 0: 1
1: 0
2: 1
3: 27
4: 289
Right 923140734 1:231160404-231160426 TTCCAAGTCCCCTAGCTGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 99
923140727_923140733 18 Left 923140727 1:231160362-231160384 CCATCTCCCATCTGTGGCTACTG 0: 1
1: 0
2: 1
3: 27
4: 289
Right 923140733 1:231160403-231160425 GTTCCAAGTCCCCTAGCTGAGGG 0: 1
1: 0
2: 1
3: 4
4: 87
923140727_923140732 17 Left 923140727 1:231160362-231160384 CCATCTCCCATCTGTGGCTACTG 0: 1
1: 0
2: 1
3: 27
4: 289
Right 923140732 1:231160402-231160424 TGTTCCAAGTCCCCTAGCTGAGG 0: 1
1: 0
2: 2
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923140727 Original CRISPR CAGTAGCCACAGATGGGAGA TGG (reversed) Intergenic
900626860 1:3612248-3612270 CAGCAGCCACAGACAGGAGGAGG + Intergenic
901153657 1:7121591-7121613 CAGTAGGCACTGATGGGCTATGG + Intronic
901205324 1:7491437-7491459 GAGTAGACACAGAGGGAAGATGG + Intronic
901293688 1:8144549-8144571 CAGAATCCACACGTGGGAGAAGG + Intergenic
901509578 1:9710085-9710107 CAGCTGGCACAGAAGGGAGATGG - Intronic
903277856 1:22233108-22233130 CAGGAGCCAGAGGTGGGTGAAGG - Intergenic
903932953 1:26874423-26874445 CAGTAGGCTGAGGTGGGAGATGG + Intergenic
904390919 1:30185303-30185325 CAGATGCCACAGATGGCACAAGG - Intergenic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
905514293 1:38550537-38550559 CAGTAGACAGAGAGCGGAGATGG + Intergenic
907922861 1:58929580-58929602 GAGTAGTCAAAGCTGGGAGAGGG + Intergenic
908322485 1:62991740-62991762 CATCAGCCACAGGTGGGAGGTGG - Intergenic
909343562 1:74558605-74558627 CAGAAGGGACAGAAGGGAGAAGG - Intergenic
909603990 1:77490332-77490354 CAGTAGTCACAGGTGGGAGCAGG + Intronic
910005830 1:82396010-82396032 GAGAAGCCAGAGAAGGGAGAAGG - Intergenic
910196212 1:84642268-84642290 CTGTAGCTACAGTTGGGACACGG + Intergenic
912364033 1:109118216-109118238 CAGTAGGCAGAGATGGAGGAAGG + Intronic
913316977 1:117561769-117561791 CAGAAGCCAAAGATGGAGGATGG + Intergenic
915196774 1:154195399-154195421 CATTCGCCACAGAGGGAAGAGGG + Intergenic
916256323 1:162791125-162791147 CAGTAGGCAAAGATGGAAAAGGG - Intronic
916598718 1:166271882-166271904 CTGTAACCTCAGATGGCAGAAGG + Intergenic
917537646 1:175886013-175886035 GAGAAGGTACAGATGGGAGATGG + Intergenic
918425178 1:184402180-184402202 CAGTAGCCACATATGGTTAATGG + Intronic
918861515 1:189832249-189832271 CACTAGACACAGTTGGTAGATGG - Intergenic
919171106 1:193955237-193955259 AATTAGCCTCAGATGGGAAAGGG - Intergenic
922325263 1:224522473-224522495 CCCAAGCCACAGGTGGGAGAAGG + Intronic
923140727 1:231160362-231160384 CAGTAGCCACAGATGGGAGATGG - Intergenic
924439833 1:244077004-244077026 GAGTAGCGACAGATGGCAGAAGG - Intergenic
924641445 1:245837292-245837314 TGGCAGCCACAGCTGGGAGACGG + Intronic
1062875672 10:941159-941181 CAGCACCCACAGGTGGGAGTGGG - Intergenic
1063709327 10:8461994-8462016 CAGTAGCAGCAGATCTGAGATGG + Intergenic
1064430405 10:15265955-15265977 CAGGAGCCAGAGGTGGTAGAAGG + Intronic
1065205610 10:23355183-23355205 CTGTGGCCACAGAGGAGAGAAGG - Intergenic
1066722785 10:38356778-38356800 CAGTAGGCAAAGATGGAAAAGGG - Intergenic
1067285528 10:44905009-44905031 TGGGAGCCACAGATGAGAGATGG + Intergenic
1068763946 10:60742503-60742525 CAGTGGCCACTGAAAGGAGATGG - Intergenic
1069649591 10:70035777-70035799 CAGTAGGTGGAGATGGGAGAAGG - Intergenic
1070289217 10:75103883-75103905 CAGTCTCCACAGGTGGGAGTGGG - Intronic
1070355968 10:75640636-75640658 CAGAGGCTGCAGATGGGAGAGGG - Intronic
1070399411 10:76040234-76040256 CAGCAGCCCCAGCTGGGAGCAGG - Intronic
1070846278 10:79524680-79524702 CAGGAGGCTGAGATGGGAGAAGG + Intergenic
1070927521 10:80235630-80235652 CAGGAGGCTGAGATGGGAGAAGG - Intergenic
1071148044 10:82598385-82598407 AACAAGCCACAAATGGGAGAAGG + Intronic
1071450201 10:85786704-85786726 CAGTAATTACAGATGGGAAAGGG + Intronic
1071577604 10:86740871-86740893 AAGTAGATACAGATTGGAGAAGG + Intergenic
1072730631 10:97843787-97843809 AAATGGCCACAGATGGGAGCTGG - Intergenic
1073108444 10:101046913-101046935 CAGTAGTCACAGCTTGGAGCAGG - Intergenic
1073589069 10:104738908-104738930 CAGCTGCCACAGTTGGGAGGAGG - Intronic
1075173615 10:120139104-120139126 GAGTAGAAACAGAAGGGAGAGGG - Intergenic
1075268457 10:121026519-121026541 CAGAGGTCACAGATGTGAGAAGG - Intergenic
1075921227 10:126215117-126215139 CAGAAGTCACAGATGTGAGCAGG - Intronic
1077213578 11:1384607-1384629 CTGTAGCTACAGAAGGCAGAGGG - Intergenic
1077675601 11:4191137-4191159 AAGTGCCCACAGAGGGGAGAGGG - Intergenic
1080193841 11:29583887-29583909 CACTAGCAACACAGGGGAGATGG + Intergenic
1080843885 11:36009165-36009187 AAGTAGCCACAGATATGAGTTGG - Intronic
1084551550 11:69846179-69846201 GAGAAGACACAGAGGGGAGAAGG + Intergenic
1084780828 11:71407273-71407295 GAAGAGCCAGAGATGGGAGACGG + Intergenic
1085150749 11:74251288-74251310 CAAAAGCCAGAGATGGAAGAGGG + Intronic
1085695703 11:78702756-78702778 CAATAGTCACATATGGGAAATGG + Intronic
1085794146 11:79521431-79521453 CAGAAGCCAGAGTGGGGAGAAGG + Intergenic
1089254808 11:117188631-117188653 CAATTGCCTCAGATGGGCGAGGG + Intronic
1090127422 11:124101984-124102006 CAGGAGCCACAGATGTTGGAAGG - Intergenic
1090398498 11:126434263-126434285 CAGGAGCCACCGAGGGGGGAAGG + Intronic
1091616733 12:2055194-2055216 CATCAGCTACAGAAGGGAGAGGG - Intronic
1091747961 12:3004508-3004530 CAGTAGCCACAGATGGGCACTGG + Intronic
1092590296 12:9947052-9947074 CATTAGTCACAGATGGGAAAGGG - Intergenic
1092840359 12:12534417-12534439 GAGTAGCCCCAGACGGGAGTCGG + Intronic
1093948315 12:25135527-25135549 CAGAAGCCACAGAGGGCAGCGGG + Intronic
1094065695 12:26358776-26358798 TGGCAGCCACAGATGGGGGAGGG - Intronic
1094348645 12:29498780-29498802 CACTAGCCACAGAGGGTAAATGG - Intergenic
1095245286 12:39912556-39912578 CAGTAGCCACAGATTAGGGATGG + Intronic
1095837890 12:46658250-46658272 GAGTAGCCACAGATTGGGGGTGG - Intergenic
1096045452 12:48558329-48558351 CAAAAGCCACAGATAGGAGAGGG - Intergenic
1096571365 12:52525279-52525301 CAGTAGCCACAACTGGGAACGGG + Intergenic
1097188894 12:57210209-57210231 CAGGAGCCACAGGAAGGAGATGG - Intronic
1100053777 12:90484340-90484362 GAGTAGGCACAGATAAGAGAGGG - Intergenic
1101520936 12:105481778-105481800 CAGTAGCATCAGCTGGGAGCTGG - Intergenic
1102527674 12:113523634-113523656 CAGCGGCCAGAGATGGTAGAGGG - Intergenic
1105211492 13:18259609-18259631 CTCTGGCCACAGATGAGAGAAGG - Intergenic
1105531456 13:21224474-21224496 CAGCAGCAAGAGATGGAAGAAGG + Intergenic
1105686378 13:22786455-22786477 CAGGAGGCTGAGATGGGAGATGG - Intergenic
1105940251 13:25141448-25141470 GGTTAGCCACAGATGGGAGTTGG - Intergenic
1106415269 13:29541048-29541070 CTGCAGCCACAGGTGGGAGAAGG + Intronic
1106702214 13:32242091-32242113 CATTAGCAACAAAAGGGAGATGG - Intronic
1111668710 13:91301750-91301772 CAGGAGGCTGAGATGGGAGATGG - Intergenic
1111742118 13:92217541-92217563 TTGTAGCCACAGATTGGAGATGG - Intronic
1111873983 13:93869941-93869963 CAGTAACCTGAGGTGGGAGATGG + Intronic
1113593708 13:111517663-111517685 GAGTAGTCAGGGATGGGAGAGGG - Intergenic
1113940773 13:114017623-114017645 CAGAGGCCGCAGAGGGGAGAGGG - Intronic
1115164433 14:30431598-30431620 TATTGCCCACAGATGGGAGAGGG + Intergenic
1117841242 14:59862647-59862669 CAGTGGGAACAGATGGGAAATGG - Intronic
1118010985 14:61610488-61610510 TAGTAGGCACAGCTGGGAGTAGG - Intronic
1119417472 14:74482869-74482891 CAGGAGCCGCAGCTGGGAGGAGG + Intronic
1121035247 14:90697975-90697997 CAGTAACCACAGAGCTGAGAAGG + Intronic
1121504386 14:94465312-94465334 CAGTAGCCACACATGGCTAATGG - Intronic
1121919093 14:97863982-97864004 CAGTTGCCACAGCTGGAAGTTGG + Intergenic
1122971165 14:105152799-105152821 CAGTAGCCCCATCTGTGAGATGG - Intronic
1123869011 15:24552678-24552700 CTGTAGTCATAGATGGGAAATGG + Intergenic
1124237401 15:28002490-28002512 CAGGAGCCAGTGATGGGATAAGG - Intronic
1124650985 15:31473836-31473858 GAGTTAGCACAGATGGGAGAAGG - Intergenic
1126509555 15:49453525-49453547 CAGTAGCCACATGTGGCACATGG + Intronic
1128305980 15:66599356-66599378 CAGAAGCCACACATGGCAGGTGG + Intronic
1129356573 15:74995900-74995922 CGGGAGCCACAGATGGGAATGGG - Intronic
1129488550 15:75902048-75902070 CAGTAGCCAGAGAATGGAGAAGG + Intergenic
1129847200 15:78773386-78773408 CAGTTTCCTCAGATGTGAGACGG + Intronic
1133072091 16:3253441-3253463 CAGTGGCCAAAGAATGGAGAAGG - Intronic
1133159777 16:3903250-3903272 CAGTAGCCAGAGATGAGCAAAGG + Intergenic
1134207563 16:12250370-12250392 GAGAAGCCACAGGTGGGAGCCGG + Intronic
1137009559 16:35309386-35309408 CAGCAGCCCCAGATGAGAGGCGG + Intergenic
1137801748 16:51267832-51267854 CAGTAGGCACTGAAGCGAGAAGG - Intergenic
1139656673 16:68391659-68391681 CAGTAGGCAAAGCAGGGAGATGG + Intronic
1139926861 16:70493348-70493370 CAATAGCCACACATGGCTGAGGG - Intronic
1141250349 16:82350836-82350858 CATTAGCCACAGATGCATGAGGG + Intergenic
1141921419 16:87138230-87138252 CAGCAGCCATGGATGGGAGTTGG - Intronic
1143346725 17:6254995-6255017 CAGTGACCACAGAGGGGAGCTGG + Intergenic
1143446741 17:7014417-7014439 CGGATGCCAGAGATGGGAGAAGG - Exonic
1147166108 17:38594244-38594266 CAGCAGCCAAGGATGGGGGAGGG + Intronic
1147760555 17:42795184-42795206 CACTAGCCAGAGAAAGGAGAGGG - Exonic
1148571059 17:48669471-48669493 CAGTATCCTCACATGGCAGATGG - Intergenic
1149470424 17:56911646-56911668 CAGGAGGCTAAGATGGGAGAAGG + Intronic
1149992466 17:61390596-61390618 CAGCAGCCACAGAGTGGAGTGGG - Intronic
1150796302 17:68240154-68240176 CAGTGGCCTCACATGGCAGAAGG + Intergenic
1150852269 17:68714971-68714993 CAGTAGTCACAGGGGGGACACGG - Intergenic
1152428015 17:80229137-80229159 CAACAGCCACAGAAGAGAGAGGG + Intronic
1152550740 17:81028707-81028729 CCGCAGCCACAGACGGGGGAGGG + Intergenic
1152676745 17:81645212-81645234 CAGCAGCCCCAGCAGGGAGAAGG - Exonic
1153146565 18:2039473-2039495 CAGTGGCCAGTGATGGGAGCTGG + Intergenic
1155545906 18:26914648-26914670 TAGGAGACACAGATGGGACACGG + Exonic
1156148680 18:34218346-34218368 TAGTAGCCACAATAGGGAGATGG - Intronic
1156279194 18:35617112-35617134 CAGTAGCCACAGACAGGAAATGG - Intronic
1156880152 18:42067934-42067956 CAGTATCCACAGATAAGTGAGGG + Intronic
1156912688 18:42429271-42429293 AGCTAGCCTCAGATGGGAGATGG - Intergenic
1157324177 18:46657206-46657228 CAGGAGCCAGAGAAGGCAGAGGG - Intergenic
1159776878 18:72612826-72612848 CAGCAGCCCCAGCTGGGAGCTGG - Intronic
1160465787 18:79074629-79074651 CGGTATCCCCTGATGGGAGAGGG + Intronic
1162175019 19:8823975-8823997 CAGTTACCACAGAGGGGACAGGG - Intronic
1163103079 19:15109201-15109223 CAGTAGCCGCCGATGGGTGCTGG + Exonic
1163458710 19:17423886-17423908 CAGAATCCAGAGTTGGGAGAGGG - Intronic
1163741806 19:19018878-19018900 CTGTAGTCACAGGTGAGAGAAGG + Intronic
1165136790 19:33674662-33674684 CGGGAGGCACAGATGGCAGATGG + Intronic
1165895818 19:39140251-39140273 CTGAAGCCACAGAGGGGAGATGG + Intronic
1167276079 19:48540492-48540514 CAGTAGGCACAGGTGGGGAAGGG - Intergenic
1167576665 19:50320956-50320978 CAGGGGGCACAGCTGGGAGAGGG + Intronic
1168124498 19:54276076-54276098 CAGTAGCCCCATCTGGGAGCAGG - Intronic
1168679044 19:58300484-58300506 CACTGGCCACAGATGGGTCAGGG + Exonic
925505363 2:4556375-4556397 CAGTGGCCAGAGACGGGAGAGGG + Intergenic
925641113 2:5986661-5986683 CAGCAGACACGGGTGGGAGAGGG - Intergenic
928056323 2:28058959-28058981 CAGCAGCCACAGAAGGCACAGGG - Intronic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929581718 2:43085618-43085640 CAGTGGACAGAGATGGGAGCAGG - Intergenic
930703457 2:54482669-54482691 CAGTAGCCACACATGGCTCATGG + Intronic
932974348 2:76579703-76579725 CAGTAGCCACAGTCTGGATAAGG + Intergenic
933285197 2:80377872-80377894 CTCTGGCCACAGATGAGAGATGG - Intronic
934773062 2:96920198-96920220 CCGTAGCCAAAAGTGGGAGAAGG + Intronic
937142767 2:119616496-119616518 AGGAAGCCACAGAAGGGAGATGG - Intronic
938581913 2:132654144-132654166 CACTAGCCAAAGATGGGGGAAGG + Intronic
938790468 2:134671423-134671445 GAGTGGCCAGACATGGGAGAGGG - Intronic
938807076 2:134816010-134816032 CAGTAGCCACAGTTTGGAAGAGG + Intergenic
941204704 2:162557499-162557521 CAGTGGCAAAAGATGGGAGATGG + Intronic
941649463 2:168078395-168078417 GAGCAGCCACAGAGAGGAGATGG + Intronic
941722922 2:168831227-168831249 CTGTAACCTCAGATGGCAGAAGG + Intronic
946697204 2:222371849-222371871 AAGGAGCCACTGTTGGGAGATGG - Intergenic
948055536 2:235007208-235007230 CAGGAGGCACAGAGGGGAGCTGG + Intronic
948590006 2:239043208-239043230 CAGGAGCAAGAGATGGGAAAGGG - Intergenic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
949015050 2:241704119-241704141 CAGAAGTCAAAGAAGGGAGAGGG - Intronic
1170469640 20:16655628-16655650 GAGGAGCAACAGATGGGATATGG + Intergenic
1171451165 20:25237137-25237159 CAGTAGCCACAGGTTGGAAGAGG + Intergenic
1172162020 20:32875403-32875425 CAGGGGGCACAGAAGGGAGATGG - Intronic
1172265118 20:33605108-33605130 CAGTGGCCACACTTGGGAAAGGG - Intronic
1172321036 20:33994972-33994994 CAGTAGCCACAGAAGTGCAAAGG + Intronic
1173866667 20:46316920-46316942 CTGAGGCCACAGATGGGACAAGG + Intergenic
1173970850 20:47151029-47151051 CAGTAGCCAGAGAGGTGAAAAGG + Intronic
1174274386 20:49393122-49393144 CAGCAGGCAGAGATGGGAGTAGG + Intronic
1174842941 20:53916812-53916834 CAGTAGCCACATGTGGGTGGTGG - Intergenic
1175223153 20:57429037-57429059 CAGTGGCCACGGATGGGCGAGGG - Intergenic
1175519489 20:59590953-59590975 CAACAGCCACATATGGGACATGG - Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1179114196 21:38475220-38475242 CAGTGGCAAGGGATGGGAGATGG + Intronic
1179655377 21:42841522-42841544 CAGGTGCCTCAGTTGGGAGAAGG + Intergenic
1180116144 21:45706481-45706503 CAGTAGAGAGAGATGGCAGAGGG - Intronic
1180764733 22:18339829-18339851 CTCTGGCCACAGATGAGAGAAGG + Intergenic
1180792821 22:18586009-18586031 CACCAGGCACAGGTGGGAGAAGG - Intergenic
1180814296 22:18779855-18779877 CTCTGGCCACAGATGAGAGAAGG - Intergenic
1180863897 22:19104887-19104909 CAGCAGCAGCAGAGGGGAGAAGG + Intronic
1181200482 22:21214190-21214212 CTCTGGCCACAGATGAGAGAAGG - Intronic
1181228915 22:21409310-21409332 CACCAGGCACAGGTGGGAGAAGG + Intergenic
1181249736 22:21525555-21525577 CACCAGGCACAGGTGGGAGAAGG - Intergenic
1181570121 22:23763882-23763904 AAGTCACCACACATGGGAGATGG + Intronic
1181573548 22:23780565-23780587 CAGTACCTACAGATGGGTGGGGG - Exonic
1181701256 22:24622769-24622791 CTGTGGCCACAGATGAGAGAAGG + Intronic
1183005710 22:34900002-34900024 CACTGGCCACAGATGGATGAGGG - Intergenic
1183137252 22:35900889-35900911 CAGTAGCGACTCATGGGAGAAGG + Intronic
1183945699 22:41324625-41324647 CATTAGCCACAGGAGGGAGCAGG + Intronic
1184658274 22:45952923-45952945 CAGCAGACACAGCTGGGAGGCGG - Intronic
1184743448 22:46442492-46442514 CAGGAGCCACAGCTGGGGGCAGG - Intronic
1184747727 22:46465733-46465755 CAGAAGCCACAGATGCGTGCAGG + Intronic
1184821064 22:46909636-46909658 CAGCAGCAACAGAAGGAAGAAGG - Intronic
1184887495 22:47355338-47355360 GAGTAGCCACAGATGGCATTTGG + Intergenic
1184994639 22:48196578-48196600 CATTAGCCAGAGAGGGGAAAGGG + Intergenic
1203226356 22_KI270731v1_random:80734-80756 CTCTGGCCACAGATGAGAGAAGG + Intergenic
1203264395 22_KI270734v1_random:5542-5564 CTCTGGCCACAGATGAGAGAAGG - Intergenic
951350727 3:21603817-21603839 CAGTAGGCAGGGATGGTAGAAGG + Intronic
952274616 3:31865283-31865305 CAGTAGCCACATCTGGCTGATGG - Intronic
952838825 3:37627370-37627392 CAGCAGCCCCAGAGAGGAGACGG - Intronic
953075490 3:39566114-39566136 CAGTAGCCACATATGGCTCATGG - Intergenic
954145537 3:48632625-48632647 CAGTAGACACAGGTGGGACAGGG - Intronic
955718936 3:61861681-61861703 AATTAGTCAGAGATGGGAGAAGG + Intronic
956347319 3:68294932-68294954 CAGTAGCCACAAATGGCCAATGG + Intronic
956858937 3:73303391-73303413 CAGTAGCCACAAATCCAAGAAGG - Intergenic
959560313 3:107772239-107772261 CAGAAGCCACAGAGGAGTGAGGG + Intronic
960248932 3:115430967-115430989 CAGTAGCCACAAATGGCTAATGG + Intergenic
963217929 3:142771999-142772021 CAGTAGAAACAGATGCCAGAAGG - Intronic
963250713 3:143100651-143100673 CAGTAGTCACTGATGACAGAAGG - Intergenic
964124170 3:153218540-153218562 CTGTAGCCCCAGATGTGAGAGGG + Intergenic
968377077 4:52544-52566 CAGTAGCTACATATGGCAGGTGG - Intergenic
968384280 4:122650-122672 CAGTAGCTACATATGGCAGGTGG - Intergenic
968393443 4:211920-211942 CAGTAGCTACATATGGCAGGTGG - Intergenic
968410376 4:385160-385182 CAGTAGCTACATATGGCAGGTGG - Intergenic
969931984 4:10639726-10639748 CAGTAGCCACATGTGGCAAACGG + Intronic
970122752 4:12775205-12775227 AAGTAGCTAGAGATGGAAGATGG - Intergenic
974543974 4:63275904-63275926 CAGTAGCCACAGCAGGTAGCAGG - Intergenic
974694768 4:65352015-65352037 CTGTAACAGCAGATGGGAGACGG + Intronic
974868064 4:67604225-67604247 GAGCAGCCACTGCTGGGAGATGG + Intronic
975306939 4:72860680-72860702 CAGTAGACACAGCAGGCAGATGG - Intergenic
978352881 4:107838892-107838914 CAGTGGCTACAGAAGGCAGATGG - Intronic
978771770 4:112464730-112464752 CAGTAGCCACACATGGAAACAGG + Intergenic
978819380 4:112948106-112948128 GAGTAGGGAAAGATGGGAGATGG + Intronic
983970329 4:173863819-173863841 CAGAATCCACAGAGGTGAGATGG - Intergenic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
987221135 5:15791662-15791684 CACTAGCCAGAACTGGGAGAGGG + Intronic
987341702 5:16945050-16945072 CTGTGGCCACTGGTGGGAGAGGG + Intergenic
987425433 5:17767493-17767515 CAGTAGCCACAGATGGCTTATGG - Intergenic
988576745 5:32433192-32433214 CAGTGGACGCAGATGGGAAATGG - Intronic
988589685 5:32538063-32538085 GAGAAGCCACAGAGGGAAGAAGG - Intronic
990291697 5:54358504-54358526 CAGTAGCCACATGTGGCTGATGG - Intergenic
991445743 5:66698385-66698407 CAGTAGCCTAAGAAGGGAGGGGG - Intronic
991605802 5:68399589-68399611 CAGTAGCCACATATGGCTAAGGG + Intergenic
991982129 5:72243103-72243125 GGGTAGACAGAGATGGGAGAGGG + Intronic
993877939 5:93329882-93329904 CAGAAGCCAGAGTTGGGGGATGG - Intergenic
995123253 5:108557467-108557489 CCCTTGCCACAGATGGGAAAGGG - Intergenic
995722451 5:115151066-115151088 CAGACTCCACAGGTGGGAGAAGG + Intronic
997012885 5:129900093-129900115 CAGTAGCTACAGCTCAGAGAAGG + Intergenic
998432652 5:142079730-142079752 CAGTAGCCACAGATGGCAGGTGG - Intergenic
999665785 5:153911405-153911427 CAGTAGCCATAGGTGGGGAAGGG - Intergenic
1000821935 5:165995487-165995509 CCGGAGACACAGAGGGGAGAAGG + Intergenic
1001082408 5:168676980-168677002 CAGAAGCCACAGATCAGAGAGGG + Intronic
1001129623 5:169053129-169053151 CTGTAGCTACAGTTGGGAGTTGG + Intronic
1002282019 5:178136577-178136599 CAGTGGCTACAGATGGGTCAAGG + Intronic
1004578379 6:16922523-16922545 CAGTGGCAGGAGATGGGAGAGGG + Intergenic
1005938339 6:30542154-30542176 CAGAAGCCCCAGATGTCAGAGGG - Exonic
1005979338 6:30824431-30824453 GAGTGGGGACAGATGGGAGATGG + Intergenic
1006826531 6:36940004-36940026 CAGCAGCCACAGACGGCACATGG - Intergenic
1007445571 6:41903011-41903033 GGGTAGCTACAGATGGGAAAAGG + Intergenic
1007902332 6:45423156-45423178 CAGCGGGCACAGGTGGGAGAGGG - Intronic
1007949506 6:45858866-45858888 CAGATGCTACAGCTGGGAGAGGG + Intergenic
1008535484 6:52503708-52503730 CAGTGGCCACAGAAGGGAGGGGG + Intronic
1010559752 6:77334187-77334209 CAGGAGCCACAGGTTGGAGTTGG + Intergenic
1010617243 6:78029050-78029072 CACCAGCAACAGATTGGAGAGGG + Intergenic
1013172382 6:107648417-107648439 CTGTAGTCACAGTGGGGAGAGGG + Intronic
1013961164 6:115902099-115902121 CAGCAGCTCCAGATGGAAGATGG + Intergenic
1015069141 6:129068467-129068489 CTGTAGCCTCACATGGCAGAAGG + Intronic
1018300072 6:162392377-162392399 TAGTAGACAGAGATTGGAGATGG - Intronic
1021723050 7:23522955-23522977 TAGTAGTCAAAGTTGGGAGAAGG - Intronic
1022224198 7:28346351-28346373 CTGTATCCTCACATGGGAGAAGG + Intronic
1022647104 7:32241821-32241843 CTGTATCCACAGAGAGGAGATGG + Intronic
1024923692 7:54588812-54588834 CAGCAGTTACAGATTGGAGATGG + Intergenic
1026212856 7:68322364-68322386 GAGTAGCCACAGCTGCTAGAAGG - Intergenic
1027420412 7:78012846-78012868 CAGGAGCCACACTGGGGAGATGG - Intergenic
1027917744 7:84347831-84347853 CAGTAGCCAGAGATGAGATGAGG + Intronic
1028192984 7:87874066-87874088 TAGTAGCCACAGAAAGGATATGG - Intronic
1029919043 7:104242859-104242881 CAGTGGCCACAGAGGAGAGAAGG + Intergenic
1031472070 7:122177603-122177625 CAGGGGCCAGGGATGGGAGAAGG - Intergenic
1032185933 7:129726164-129726186 CAGTAGGCACAGAATAGAGATGG - Intronic
1033312685 7:140273379-140273401 CAGCAGCAAGAGTTGGGAGAGGG - Intergenic
1034302803 7:150031319-150031341 CAGTAGTCACAGAAGTGTGAAGG + Intergenic
1034498091 7:151433807-151433829 CAGTAGCCACAGCCAGGACAGGG - Intronic
1034840009 7:154386972-154386994 CAGAAACCACAGCTGTGAGAAGG + Intronic
1035251784 7:157602623-157602645 CAGTGGCCACTGATGGCAGATGG - Intronic
1035251795 7:157602721-157602743 CAGCAGCCACTGATGGTGGAGGG - Intronic
1035279308 7:157767226-157767248 CATAAGCCACAGATGGATGATGG - Intronic
1035314350 7:157988864-157988886 CTTTAGACACAGATGTGAGAAGG - Intronic
1037121320 8:15290563-15290585 CACTAGCCACAGCTGGTGGAGGG - Intergenic
1041545998 8:59043718-59043740 CACTAGCCAGAAATGCGAGATGG + Intronic
1041698597 8:60763364-60763386 CAGTAGCCACACATGGCTGGTGG + Intronic
1042036305 8:64538201-64538223 CAGTAGCCACTGGTCAGAGAGGG - Intergenic
1042185324 8:66131000-66131022 GACTAGCCACAGTTGGGAGTGGG + Intronic
1042334388 8:67614802-67614824 CAGTGGCCAAAGAATGGAGAAGG - Intronic
1042459655 8:69048807-69048829 CAGAAACCACAGAGGAGAGATGG + Intergenic
1047206226 8:122804725-122804747 CAGTTGCCTCAGCTGGGAAATGG - Intronic
1048326365 8:133442373-133442395 CAGTGGCAAAAGATGGGAGCAGG - Intergenic
1049204258 8:141356083-141356105 CAGGGGCCACAGCTGGGAAATGG - Intergenic
1049592062 8:143467086-143467108 CTGCAGCCGCAGAGGGGAGAGGG + Intronic
1052553797 9:29986672-29986694 CAGTGGACACTGATGGGAGAGGG + Intergenic
1054969094 9:71063656-71063678 CAGTAGACAAAGATGGCTGAGGG + Intronic
1056272535 9:84960368-84960390 CCTGAGCCACAGAAGGGAGAAGG + Intronic
1057570606 9:96201599-96201621 CAGGAGCCACAGATGTGAAATGG + Intergenic
1057874404 9:98743037-98743059 CCGTAGCCACAGAGGGCACAGGG + Intronic
1058189242 9:101892688-101892710 CCATAGACACTGATGGGAGATGG + Intergenic
1059333239 9:113549899-113549921 CAGGAGGCTGAGATGGGAGATGG + Intronic
1060507983 9:124212728-124212750 CAGGACACACACATGGGAGAAGG - Intergenic
1061406719 9:130396302-130396324 CAGGAGCCCCAGGTGGGAGAGGG + Intronic
1062154205 9:135037339-135037361 CAGCAGGCACAGAAGGCAGAGGG + Intergenic
1203572160 Un_KI270744v1:141702-141724 CAGTAGCTACATATGGCAGGTGG + Intergenic
1188266981 X:28088885-28088907 CAAGTGCCACAGATGGGACAGGG - Intergenic
1189074213 X:37898858-37898880 CAGAAACCAGAGATGGGACATGG + Intronic
1189357985 X:40326037-40326059 CAGGAGCAAGAGAGGGGAGAGGG + Intergenic
1192247263 X:69384114-69384136 CAGCACTCACAGCTGGGAGATGG - Intergenic
1195597893 X:106713612-106713634 CAGTAGCCACAGATGGCTCGTGG - Intronic
1196758323 X:119177466-119177488 GAGAAACCACAGATGGGAAATGG + Intergenic
1197114495 X:122817383-122817405 CAGTAGCCACTGCTGGTAGCCGG + Intergenic
1197695181 X:129541722-129541744 CAGAAGCCAATGTTGGGAGATGG - Intronic
1197881104 X:131167582-131167604 CAGTAGATACAGATGCCAGATGG + Intergenic
1198019380 X:132643390-132643412 CAGTTTCCACACATGGGACATGG - Intronic
1200183836 X:154168975-154168997 CAGTGGCCAATTATGGGAGACGG + Intergenic
1200189490 X:154206103-154206125 CAGTGGCCAATTATGGGAGACGG + Intergenic
1200195243 X:154243912-154243934 CAGTGGCCAATTATGGGAGACGG + Intergenic
1200200895 X:154281033-154281055 CAGTGGCCAATTATGGGAGACGG + Intronic