ID: 923141989

View in Genome Browser
Species Human (GRCh38)
Location 1:231168215-231168237
Sequence TACCTTGGCCTCCCAAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3582
Summary {0: 1, 1: 13, 2: 138, 3: 949, 4: 2481}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923141982_923141989 20 Left 923141982 1:231168172-231168194 CCAGGCTGGTCTCAATTGAACTC 0: 1
1: 5
2: 23
3: 120
4: 522
Right 923141989 1:231168215-231168237 TACCTTGGCCTCCCAAAGCCTGG 0: 1
1: 13
2: 138
3: 949
4: 2481
923141984_923141989 -2 Left 923141984 1:231168194-231168216 CCTGGCCTCAAGCAATCCTCCTA 0: 208
1: 4355
2: 23775
3: 61037
4: 146183
Right 923141989 1:231168215-231168237 TACCTTGGCCTCCCAAAGCCTGG 0: 1
1: 13
2: 138
3: 949
4: 2481
923141985_923141989 -7 Left 923141985 1:231168199-231168221 CCTCAAGCAATCCTCCTACCTTG 0: 62
1: 1455
2: 4453
3: 12206
4: 29871
Right 923141989 1:231168215-231168237 TACCTTGGCCTCCCAAAGCCTGG 0: 1
1: 13
2: 138
3: 949
4: 2481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923141989 Original CRISPR TACCTTGGCCTCCCAAAGCC TGG Intronic
Too many off-targets to display for this crispr