ID: 923144391

View in Genome Browser
Species Human (GRCh38)
Location 1:231187701-231187723
Sequence GGGTGGGAAAGGCGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1149
Summary {0: 1, 1: 1, 2: 4, 3: 110, 4: 1033}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923144375_923144391 21 Left 923144375 1:231187657-231187679 CCCAAGTGGGGCATCAAACTGCA 0: 1
1: 0
2: 0
3: 12
4: 85
Right 923144391 1:231187701-231187723 GGGTGGGAAAGGCGGGCAGAAGG 0: 1
1: 1
2: 4
3: 110
4: 1033
923144376_923144391 20 Left 923144376 1:231187658-231187680 CCAAGTGGGGCATCAAACTGCAG 0: 1
1: 0
2: 0
3: 14
4: 155
Right 923144391 1:231187701-231187723 GGGTGGGAAAGGCGGGCAGAAGG 0: 1
1: 1
2: 4
3: 110
4: 1033

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923144391 Original CRISPR GGGTGGGAAAGGCGGGCAGA AGG Intronic
900164477 1:1239282-1239304 GGGTGACAGAGGCGGGGAGAAGG + Intergenic
900318596 1:2071274-2071296 GGGTGGGAGAGACGGCAAGACGG - Intronic
900690783 1:3978994-3979016 GGGTGGGTAATGGGGTCAGAAGG + Intergenic
900936818 1:5771265-5771287 TGGTGAGAGAGCCGGGCAGATGG - Intergenic
901012273 1:6208638-6208660 GGGTGGGGGACGCGGGGAGAGGG - Intronic
901054098 1:6440601-6440623 GGGCGGGACGGGCGGGGAGAGGG - Intronic
901083607 1:6597460-6597482 GGGAGGGAGAGCCGGGCAAAGGG + Intronic
901101321 1:6721299-6721321 GGGTGGCCAAGGCAGGCGGATGG - Intergenic
901108006 1:6772599-6772621 GGGTGGAAAAGCGAGGCAGATGG + Intergenic
901279584 1:8023516-8023538 GGGAGGCCAAGGCGGGCAGATGG - Intronic
901498839 1:9639004-9639026 GGGAGGACAAGGTGGGCAGATGG - Intergenic
901560770 1:10068588-10068610 GGGAGGCCAAGGCAGGCAGATGG - Intronic
901903969 1:12392099-12392121 GGGAGGCCTAGGCGGGCAGATGG - Intronic
901904002 1:12392250-12392272 GGGAGGCCAAGGCGGGCAGATGG + Intronic
902381290 1:16053625-16053647 CGGTGGGAACTGCAGGCAGAGGG - Exonic
902394673 1:16126152-16126174 GGGTGGGAAAGCAGGGCTGTGGG - Intronic
902505876 1:16938882-16938904 GGGTGGGGGAGGGAGGCAGAAGG - Intronic
902662233 1:17913263-17913285 GGGTGAGAAAGGAGGGCAGTAGG - Intergenic
902878003 1:19352615-19352637 TGTGAGGAAAGGCGGGCAGAAGG - Intronic
902988408 1:20169872-20169894 GGGAAGGAAAGAGGGGCAGATGG - Intronic
903018898 1:20379891-20379913 GGGTGGGGAAAGAGGGCAGGTGG - Intergenic
903224023 1:21884966-21884988 GGGTGGGAATGAGGGGCAGCTGG - Intronic
903320355 1:22539293-22539315 GGGTGGGAAAGGCTGGCAGAGGG - Intergenic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903495512 1:23764128-23764150 GGGAGGCCAAAGCGGGCAGATGG - Intergenic
903513841 1:23896648-23896670 GGGTGGGACAGGAAAGCAGAGGG + Intronic
903708495 1:25304357-25304379 GGGAGGCCGAGGCGGGCAGATGG + Intronic
903718619 1:25388056-25388078 GGGAGGCCGAGGCGGGCAGATGG - Intronic
903878898 1:26495254-26495276 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
904026088 1:27504631-27504653 GGGAGGGAAGGGCAGGCCGAAGG + Intergenic
904137887 1:28328212-28328234 GGGAGGCCAAGGCGGGCAGATGG - Intergenic
904392963 1:30197822-30197844 GTATGGGAAAGGCAGACAGAAGG + Intergenic
904560143 1:31391152-31391174 GGGAGGCCAATGCGGGCAGATGG + Intergenic
904565884 1:31428277-31428299 GGGAGGCTGAGGCGGGCAGATGG - Intronic
904590561 1:31613020-31613042 TGGTGGGAAAGGTGGGGAGCTGG - Intergenic
904612248 1:31732168-31732190 GGGAGGGGCAGGTGGGCAGAGGG + Intronic
904665802 1:32120485-32120507 GGGAGGCTGAGGCGGGCAGATGG - Intronic
905272539 1:36796318-36796340 GGGAGAGAAAGGCAGACAGATGG + Exonic
905322909 1:37130405-37130427 GGGTGGGACAGGAGGGGAGGAGG - Intergenic
905515369 1:38558513-38558535 GGGGGGGAAAGGAGGTGAGAGGG - Intergenic
905662349 1:39737309-39737331 AGGTGGGAAAGGTAGGCAGAGGG - Intronic
905820688 1:40988151-40988173 GGGAGGCCAAGGCAGGCAGATGG - Intronic
905894855 1:41538938-41538960 GGGTGGGGAAGCCGAGCAGTGGG + Intronic
906552926 1:46681196-46681218 GGGAGGCCAAGGCAGGCAGATGG - Intronic
906805768 1:48777439-48777461 GGCTGGGAAAGGCGCGGGGAGGG - Intronic
907157364 1:52346591-52346613 GGGTGGGATGGGAGGGCAGAGGG + Exonic
907200479 1:52722473-52722495 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
907266032 1:53261868-53261890 GCGTGGGAAAGGCTGCCAGGTGG + Intronic
907358467 1:53895562-53895584 GAGTGGGCAAGTCGGGGAGAAGG - Intronic
907439488 1:54470264-54470286 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
907449558 1:54535478-54535500 GGGAGGCCAAGGAGGGCAGATGG + Intergenic
907459014 1:54594216-54594238 GGTGGGGAAAGGAGGGGAGAGGG - Intronic
908359778 1:63357559-63357581 AGGAGGCCAAGGCGGGCAGATGG + Intergenic
908681897 1:66671337-66671359 GGGAAGAACAGGCGGGCAGAAGG + Intronic
909893800 1:81039901-81039923 GGATGGAAAAGAAGGGCAGAAGG + Intergenic
910412613 1:86963684-86963706 GGGGGTGACAGCCGGGCAGAGGG + Intronic
910939526 1:92518135-92518157 GGGAGGCCAAGGCAGGCAGATGG - Intronic
910952499 1:92666196-92666218 GGGAGGCCAAGGCCGGCAGATGG + Intronic
911029534 1:93471450-93471472 GGGAGGCCAAGGTGGGCAGATGG + Intronic
911114531 1:94233047-94233069 GGGTGGCTTTGGCGGGCAGATGG - Intronic
911165672 1:94722353-94722375 TGGTGGGAAAGGAGGGGACAGGG + Intergenic
911489166 1:98541141-98541163 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
912320792 1:108711022-108711044 GGGAGGCCAAGGTGGGCAGATGG + Intergenic
912374834 1:109201582-109201604 GGGTGGGGAGGGCGGAAAGAGGG + Intronic
912690958 1:111804356-111804378 GTGTGGGGAAGGCTGACAGATGG - Intronic
913275985 1:117138168-117138190 GGATGGGAAGGGAGGGCACATGG - Intergenic
913957680 1:143319577-143319599 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
914051990 1:144144941-144144963 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
914127207 1:144821600-144821622 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
914425292 1:147570578-147570600 GAGTGGGAATGGGGGGCAAAGGG - Intronic
914758908 1:150583056-150583078 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
914763435 1:150617555-150617577 GGGAGGCCAAGGCGGGCGGATGG - Intronic
914941036 1:152023289-152023311 GGCAGGGAACGGAGGGCAGATGG - Intergenic
915017301 1:152745966-152745988 GTGTGGTAACAGCGGGCAGAAGG - Intronic
915091373 1:153428652-153428674 GGGTGGGATGTGTGGGCAGAGGG + Intergenic
915106374 1:153537198-153537220 GGGAGGGAGAGGAGGGCAGGGGG + Exonic
915262070 1:154684160-154684182 GGATGAGGAAGGAGGGCAGAAGG + Intergenic
915289994 1:154877184-154877206 GGGTGGGAGTGGTGGGCAGGAGG - Intergenic
915302088 1:154957481-154957503 GGGTGGGGAAGGCAGGCATGGGG - Exonic
915304159 1:154968473-154968495 GGTTGGTGAAGGTGGGCAGACGG - Exonic
915582183 1:156820484-156820506 GGGAGGCCAAGGCAGGCAGATGG - Intronic
916080576 1:161229482-161229504 GGCTGGGAAAGTAGGGCTGAAGG + Exonic
916093412 1:161327166-161327188 GGGAGGCTAAGGTGGGCAGACGG - Intronic
916144542 1:161727138-161727160 GGATGGGGAAGGCCGGAAGAGGG - Intronic
916211051 1:162360270-162360292 GGGTCGGAAGAGCGGTCAGAGGG - Intronic
917138024 1:171806533-171806555 GGGTGGGAAAAGTGGGATGAAGG - Intronic
917222582 1:172747892-172747914 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
917797277 1:178541613-178541635 TGGTGGGAGAGGCGTGCAGAAGG - Intronic
918209370 1:182337466-182337488 GGGAGGCCAAGGGGGGCAGATGG + Intergenic
918327069 1:183419931-183419953 GGGTGGAAAGGGAGGGCAAATGG + Intergenic
918597675 1:186310739-186310761 GGGAGGTTAAGGCGGGTAGATGG - Intronic
919891095 1:201975521-201975543 GGGAGGCCGAGGCGGGCAGATGG - Intergenic
920065560 1:203266903-203266925 GGGAGGCCAAGGCGGGCAGATGG - Intronic
920104572 1:203542698-203542720 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
920288820 1:204901883-204901905 GAGGGGCAAAGGCAGGCAGACGG + Intronic
920724673 1:208422981-208423003 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
920947355 1:210542216-210542238 AGGTGGGAGAGGCAGGCAGATGG - Intronic
920974610 1:210774056-210774078 GGGTGGGAAAGGTGGGCATGGGG + Intronic
921637454 1:217513048-217513070 GGGAGGCCAAGGTGGGCAGAAGG + Intronic
921835441 1:219773372-219773394 GGGTGGGAATGGGAAGCAGAAGG + Intronic
922318899 1:224467272-224467294 GGGAGGCAGAGGTGGGCAGATGG - Intronic
922621794 1:226994435-226994457 GGGGGAGAAAGGGAGGCAGAAGG + Intronic
922695364 1:227728558-227728580 GGGAGGGACAGGCGGGGAGGGGG - Intronic
922929490 1:229377593-229377615 TGGTTGGCCAGGCGGGCAGAGGG - Intergenic
922966623 1:229696190-229696212 GGGAGACAAAGGCAGGCAGAGGG - Intergenic
922984373 1:229854696-229854718 GGGAGGGAAAAGTGAGCAGATGG - Intergenic
923144391 1:231187701-231187723 GGGTGGGAAAGGCGGGCAGAAGG + Intronic
923438406 1:233992145-233992167 GGGTGGGATTGGTGGGCAAAGGG + Intronic
924379225 1:243446503-243446525 GGGAGGCCAAGGTGGGCAGATGG - Intronic
924510385 1:244725078-244725100 GGGTGGTAGTGGCTGGCAGAGGG - Intergenic
924626427 1:245699752-245699774 GGATGGGAAGGGGAGGCAGAGGG - Intronic
1062957736 10:1551532-1551554 TGGCAGGAAGGGCGGGCAGAGGG - Intronic
1063415638 10:5870623-5870645 GGGAGGCCAAGGCGGGCAGATGG - Intronic
1063428327 10:5966593-5966615 GGGTGGGAAATGAAGGGAGAGGG - Intronic
1063917868 10:10902920-10902942 GGGAGGGAAAAGCGGGAGGAAGG + Intergenic
1064116732 10:12584578-12584600 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1064118203 10:12596801-12596823 GGGTGGGAAAGGGGGACTGGAGG - Intronic
1064154673 10:12894207-12894229 GGGAGGGAAAGGAGGGAAGGAGG - Intergenic
1064288023 10:14009802-14009824 GGGTGAGAGAGACGGGGAGACGG + Intronic
1065169169 10:23010399-23010421 GGGAGGGAAAGGGGAGGAGAGGG - Intronic
1065205129 10:23349920-23349942 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1065233469 10:23622403-23622425 AGGTGGGGAAGGTAGGCAGAGGG - Intergenic
1065645401 10:27828427-27828449 GGATGGGAAAGGCCGGGAGAAGG + Intronic
1065789150 10:29243840-29243862 GGTTGGGAAAAACAGGCAGATGG - Intergenic
1066421933 10:35271755-35271777 GGGTTGCCAAGGGGGGCAGAGGG - Intronic
1066438072 10:35412472-35412494 GGGTGGGAAGGGCTGGCAGCAGG + Intronic
1066759992 10:38741006-38741028 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1066961625 10:42231762-42231784 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1066984275 10:42450651-42450673 GGGAGGGAGAGGCAGGTAGAGGG - Intergenic
1067059908 10:43072967-43072989 GGGAGGAGAAGACGGGCAGAGGG + Intergenic
1067092528 10:43275743-43275765 GGGTGGGAAAAGCAGCTAGATGG - Intergenic
1067131145 10:43566523-43566545 GGGAGGCTAAGGCGGGCAGATGG - Intronic
1067169518 10:43895175-43895197 GGGGAGGAGAGACGGGCAGAAGG + Intergenic
1067177802 10:43962480-43962502 AGATGGCAAGGGCGGGCAGAAGG - Intergenic
1067228541 10:44390931-44390953 GGCTAGGAAAGGGAGGCAGAAGG - Intergenic
1067323858 10:45247872-45247894 GGGTGGGAGAGGAGGAGAGAAGG - Intergenic
1068098489 10:52521788-52521810 GGGAGGCCAATGCGGGCAGATGG + Intergenic
1069625904 10:69867521-69867543 GGGTGGGAAACTGAGGCAGAAGG + Intronic
1069678114 10:70263870-70263892 GGGAGGCTGAGGCGGGCAGATGG + Intronic
1069855838 10:71440598-71440620 GGCCAGGAAAGGAGGGCAGAGGG - Intronic
1069939126 10:71941675-71941697 GGGGGGGAGAGGGGGGCAGGGGG + Intergenic
1070149251 10:73795716-73795738 GGGAGGCAGAGGCGGGCAGATGG + Intronic
1070877146 10:79825642-79825664 GGAGGGGAAAAGCGGGCCGAGGG + Intergenic
1071305987 10:84299139-84299161 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
1071332761 10:84576211-84576233 GGGTGGGGAAGGTGGGTAGGGGG - Intergenic
1071346777 10:84701008-84701030 GGGTGGGAAGGGAGAACAGAGGG + Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071643641 10:87341686-87341708 GGAGGGGAAAAGCGGGCCGAGGG + Intergenic
1071669873 10:87598357-87598379 GGGAGGCTAAGGCGGGCAGATGG + Intergenic
1071878252 10:89865976-89865998 GGGTGGGAAAGGGGCAGAGAGGG + Intergenic
1072077455 10:91991509-91991531 GGGAGGCCGAGGCGGGCAGATGG + Intronic
1072149390 10:92673557-92673579 GGGTGGGAAAGGATGAGAGAAGG + Intergenic
1072214530 10:93276965-93276987 GGGGGGCCAAGGTGGGCAGATGG + Intergenic
1072622733 10:97090684-97090706 GGGTGGAAAAGGGCGGAAGAGGG + Intronic
1072750429 10:97974932-97974954 GGGAAGGGGAGGCGGGCAGAGGG + Intronic
1072939517 10:99747758-99747780 GGGAGGGCAAGGAAGGCAGATGG - Intronic
1073151898 10:101317317-101317339 GGTTGGGAGAGGGGTGCAGAGGG + Intergenic
1073312203 10:102551112-102551134 AGGTGTGAAATGCGGGCAGAGGG - Intronic
1073364032 10:102922699-102922721 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1073460925 10:103665540-103665562 GGGAGGGAAGGGCAGCCAGAAGG - Intronic
1073585395 10:104704999-104705021 GGTTGGGAAATGAGGGAAGAGGG - Intronic
1073776480 10:106791456-106791478 GGGAGGCCGAGGCGGGCAGATGG + Intronic
1074147056 10:110726095-110726117 GAGAGGGAGAGGCCGGCAGAGGG - Intronic
1074463628 10:113662525-113662547 GGGAGGCCAAAGCGGGCAGATGG - Intronic
1074528234 10:114279315-114279337 GGGAGGGATGGGTGGGCAGACGG - Intronic
1074578512 10:114693900-114693922 GGGAGGGCAAGGCGGGAGGATGG - Intergenic
1074629438 10:115234826-115234848 GGGAGGCCAAGGCGGGCGGATGG - Intronic
1075392267 10:122100883-122100905 GGAGGGGCAAGGCAGGCAGAGGG - Intronic
1075502569 10:122989189-122989211 GGGTGGGCGGGGTGGGCAGAAGG + Intronic
1075741444 10:124698753-124698775 GGGTGGGGAATGGGGGCCGAGGG - Intronic
1075814802 10:125256693-125256715 GGGTGGGGATGGAGGGCTGATGG + Intergenic
1076014285 10:127015354-127015376 TGGTGGGAGACGGGGGCAGAGGG - Intronic
1077015946 11:399295-399317 AGGTGGAGAAGGGGGGCAGATGG - Intronic
1077251924 11:1564555-1564577 GGGTGGGGGAGGAGGGCAGGAGG - Intronic
1077308866 11:1879744-1879766 GGCTGGGAGAGGGGGACAGAGGG + Intronic
1077331950 11:1987744-1987766 GGGCGGGAAGGACGGGCAGATGG - Intergenic
1077342390 11:2031917-2031939 GGGTGGGCCGGGCAGGCAGAGGG - Intergenic
1077607539 11:3622169-3622191 GGGTGTGAAAGGTGGGCTGGGGG + Intergenic
1077824035 11:5784521-5784543 GGGAGGCGGAGGCGGGCAGATGG + Intronic
1078248776 11:9600274-9600296 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
1078578492 11:12520708-12520730 GGGAGGCCAAGGTGGGCAGACGG + Intronic
1078638662 11:13075717-13075739 GGAGGGGAAATGAGGGCAGAGGG - Intergenic
1079346482 11:19656977-19656999 GGGAGGGAAAGGCCTGCAGAGGG + Intronic
1080608995 11:33887811-33887833 GGGAGGCCAAGGCGGGCAGATGG - Intronic
1080656303 11:34261116-34261138 GGGGGGGGCAGGCGGGGAGATGG - Intronic
1080741831 11:35072417-35072439 GGGAGGCCAAGGTGGGCAGAAGG + Intergenic
1080840135 11:35976358-35976380 TGGTGGGAAAGGAGGGTAGGAGG + Intronic
1080941040 11:36918408-36918430 GGGTTGGCATGGCGGGCAGGAGG + Intergenic
1081292937 11:41349094-41349116 TGCTGGGAAAAGCTGGCAGATGG - Intronic
1081577491 11:44328319-44328341 GGGAGGGAAAGTGGGGGAGAGGG - Intergenic
1081711976 11:45223074-45223096 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1081793640 11:45805329-45805351 GGGAGGGAGGGGCGGGCAGGGGG - Exonic
1081867475 11:46367505-46367527 GGTTGGGACAGTGGGGCAGACGG + Intronic
1081993511 11:47349962-47349984 GGGTGGGAAGGGGGGGCAGCAGG - Intronic
1082825882 11:57578493-57578515 GGGAGGCCAAGGCGGGAAGATGG + Intergenic
1083427574 11:62596527-62596549 GGGTAGCTAAGGGGGGCAGAGGG + Exonic
1083555988 11:63628590-63628612 GGGAGGCCAAGGCGGGCAGGCGG + Exonic
1083750704 11:64759204-64759226 GTGGGGGAGGGGCGGGCAGACGG - Intronic
1083933973 11:65860786-65860808 GGTTGGGACAGGCAGGCAGCGGG - Exonic
1084234274 11:67776420-67776442 GGGTAGAAAAGGCTGGGAGAGGG - Intergenic
1084239717 11:67810658-67810680 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1084313272 11:68328985-68329007 GTGTGGGAAGGGCGGGCTCACGG - Intronic
1084337968 11:68472230-68472252 GGGAAGGGAAGGCGTGCAGACGG + Intronic
1084456769 11:69272393-69272415 CAGTGGGACAGGTGGGCAGATGG - Intergenic
1084619677 11:70260991-70261013 GGGAGGCCAAGGCGGGCGGATGG - Intergenic
1084745123 11:71165271-71165293 GGGAGGCCAAGGCGGGCGGATGG - Intronic
1084832716 11:71782186-71782208 GGGAGGCCAAGGCAGGCAGACGG + Intergenic
1084882820 11:72184033-72184055 GGGTGGCAAAGGTGGGAGGATGG - Intergenic
1084941634 11:72616312-72616334 GTGGGGGAAAGGGGGGCAGTGGG - Intronic
1085071816 11:73553740-73553762 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1085309983 11:75510507-75510529 GGGAGGAAAAGGAGGTCAGACGG - Intronic
1086310919 11:85535974-85535996 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1086361783 11:86068294-86068316 GGGTGGGAAGGAAGAGCAGAAGG + Intronic
1086376244 11:86203756-86203778 GGGAGGCTAAGGCTGGCAGATGG + Intergenic
1087634431 11:100687110-100687132 GGGTGGGGCAGGAGGGCAAAGGG + Intergenic
1087665819 11:101046390-101046412 GGGAGGGCAAGCTGGGCAGATGG - Intronic
1087840973 11:102920858-102920880 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1087931869 11:103987275-103987297 GGGTGGGAAAGGAAGGAGGATGG - Intronic
1088626142 11:111732038-111732060 GGGTGGGGAAGGAGAGCAGCAGG + Intronic
1088834688 11:113567844-113567866 TGGCGGGAAAGGCTGGCAGATGG + Intergenic
1089136485 11:116253311-116253333 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1089177730 11:116560504-116560526 GGCTGGGAAGGGGGTGCAGAGGG + Intergenic
1089503263 11:118945494-118945516 GGGTGGAAAAGTCAGGAAGATGG - Intronic
1089561821 11:119347017-119347039 GGGGAGGAAAGGTGGGCAGCTGG - Intergenic
1090091917 11:123705515-123705537 GGGTGGGAGAGGTGGGCATGTGG - Intergenic
1090378517 11:126308718-126308740 GGGTGGGGAGGGTGGGTAGAGGG - Intronic
1090460556 11:126887909-126887931 GGGTGGGAACAGGGGTCAGAAGG + Intronic
1090623585 11:128585298-128585320 GGGAGGGAAGGGAGGGAAGAAGG + Intronic
1090627294 11:128618159-128618181 GGCTGGGGGAGGCGGGGAGAGGG + Intergenic
1202814931 11_KI270721v1_random:42920-42942 GGGCGGGAAGGACGGGCAGATGG - Intergenic
1202825376 11_KI270721v1_random:87106-87128 GGGTGGGCCGGGCAGGCAGAGGG - Intergenic
1091778960 12:3201858-3201880 GGGTGGGAAAGGAGGGGTGTGGG + Intronic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1092218105 12:6696321-6696343 GGGTGGGAAATGCTGGATGAAGG - Intronic
1092279971 12:7091425-7091447 GGGCAGGATGGGCGGGCAGAGGG - Intronic
1093612739 12:21182528-21182550 GGGAGGGACTGGCGGGCAGAAGG - Intronic
1094588212 12:31797258-31797280 GGGAGGCAGAGGCAGGCAGATGG - Intergenic
1094622601 12:32094445-32094467 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1094684932 12:32701965-32701987 GGGAGGCCAAGGCGGGCGGATGG - Intronic
1095533151 12:43214342-43214364 GGGTGGGAAGTGAGGCCAGATGG + Intergenic
1096037956 12:48489654-48489676 GGGAGGCCAAGGCTGGCAGATGG - Intronic
1096284383 12:50285422-50285444 GGGAGGCTAAGGCGGGAAGATGG + Intergenic
1096305082 12:50467540-50467562 GGGAGGCCAAGGTGGGCAGATGG - Intronic
1096309225 12:50505379-50505401 GGGTGGGAGAGGAGGGAAAACGG - Intronic
1096538535 12:52290297-52290319 GTGTGGGAAGGTGGGGCAGATGG + Intronic
1096540244 12:52303067-52303089 GTGTGGGAAGGTGGGGCAGATGG - Intronic
1096792804 12:54055384-54055406 GGGAGGGAGAGGAGGGCAGGGGG - Exonic
1096925831 12:55144876-55144898 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1097053373 12:56236754-56236776 GGGTGGGAACGGAGGGAAGCAGG + Intronic
1097226164 12:57477901-57477923 GGGTGGGGGAGGCGGGAAGTTGG - Intronic
1097278249 12:57827618-57827640 GGGTGGGAAAGGCAGTGAGATGG - Intronic
1097678366 12:62626478-62626500 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1098149341 12:67530332-67530354 GGGTTGGAAAGAAGGGCAGGAGG + Intergenic
1098984216 12:76993119-76993141 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
1099272425 12:80527744-80527766 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1099272442 12:80527852-80527874 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1099570379 12:84310269-84310291 GGGAGGCCAAGGCGGGCACATGG - Intergenic
1099722040 12:86376144-86376166 GGGAGGCCAAGGAGGGCAGATGG + Intronic
1100444839 12:94650645-94650667 GCGCGGGAGAGGCGGGGAGAAGG - Intergenic
1100580619 12:95936150-95936172 GGGTGGGAAAGGAAAGAAGAGGG + Intronic
1101044859 12:100794647-100794669 GGCTAGGAAAGGCGAGAAGAGGG - Intronic
1101443704 12:104722240-104722262 GGGAGGCTAAGGCGGGCAGATGG - Intronic
1101652344 12:106689014-106689036 GGGTGGAAAATGGGGGCAGGAGG + Intronic
1101758185 12:107637949-107637971 GGGTGTGATAGGTGAGCAGAGGG + Intronic
1102301395 12:111774162-111774184 GGGTGGGGGAGTGGGGCAGAGGG + Intronic
1102464813 12:113122562-113122584 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1102517295 12:113458397-113458419 GGGTGGGGAAGGGGAGCAGTTGG - Intergenic
1102959805 12:117085134-117085156 GGGTGGACAGGGCTGGCAGAAGG + Intronic
1103349129 12:120271138-120271160 GGGAGGTAGAGGTGGGCAGATGG - Intergenic
1103675734 12:122654272-122654294 GGGAGGCCGAGGCGGGCAGATGG + Intergenic
1103912638 12:124360746-124360768 GGGTGGGCATTGCGGGCAGAGGG - Intronic
1103931330 12:124452644-124452666 GGGAGGGCGAGGTGGGCAGAGGG + Intronic
1103967741 12:124650995-124651017 GGGTGGGAAAGGCAAGCAGCGGG - Intergenic
1103968334 12:124654143-124654165 GGGAGGCCAAGGCGGGCGGATGG + Intergenic
1103971193 12:124673961-124673983 GGGTGGGGAGGGAGGGCATAGGG - Intergenic
1104416156 12:128598175-128598197 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1104643108 12:130479894-130479916 GGGAGGGAAGGGCCCGCAGAGGG - Intronic
1104807581 12:131599308-131599330 GAGTGAGAAATGCGGGCAGGGGG - Intergenic
1105020941 12:132816509-132816531 GGGTGGGAAAAGCGGGGTAACGG + Intronic
1105271162 13:18875942-18875964 GGGCGGGAAAGGGGGGTACAGGG - Intergenic
1106110950 13:26776506-26776528 GGGTGAGAAATGAGGGCAGGAGG - Intergenic
1106199946 13:27527835-27527857 GGGTGGCAGAGGCAGGCAGGTGG - Intergenic
1106449578 13:29867975-29867997 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1106463546 13:29993373-29993395 GGGTGGGCAAGGCCGCCAGCAGG + Intergenic
1107131917 13:36905514-36905536 GGGATGCCAAGGCGGGCAGATGG + Intronic
1107145853 13:37059705-37059727 GGGCGGGGAAGGCGGGCGGAAGG + Intronic
1107788488 13:43977802-43977824 GGGAGGGAAGGGAGGGGAGAGGG - Intergenic
1107910162 13:45098338-45098360 GGGAGGGCAAGGCAGGCAGACGG + Intergenic
1107985066 13:45768517-45768539 GGCTGGGAGAGAGGGGCAGAGGG - Intergenic
1108001239 13:45907318-45907340 GGATGGGAAGGGGAGGCAGAGGG + Intergenic
1108521036 13:51247163-51247185 AGGTGGGAGAGCCGTGCAGAGGG + Intronic
1108794782 13:54017846-54017868 GGGTGGGAAAGGGAGGGAAAGGG + Intergenic
1109971743 13:69779396-69779418 GGGAAGGAAAGGAGGGAAGAGGG - Intronic
1110247368 13:73342055-73342077 GGGTGGGAAAGGATGGGGGAGGG - Intergenic
1111512766 13:89287701-89287723 GGGTGGGGTAGGGGGGCAGGTGG + Intergenic
1111951553 13:94712588-94712610 GGGTGGGGAAGGCGGGGAGGTGG + Intergenic
1112319167 13:98391508-98391530 GGGAGGCCAAGGCGGGAAGATGG - Intronic
1112378069 13:98862447-98862469 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1112927422 13:104693755-104693777 AGGTGGAAAAGGAAGGCAGAAGG + Intergenic
1113409273 13:110070208-110070230 GGTGGGGAAGGGAGGGCAGAGGG - Intergenic
1113695232 13:112341549-112341571 GGGAGGGAGAGACAGGCAGAGGG - Intergenic
1114293400 14:21307291-21307313 GGGAGGCTGAGGCGGGCAGATGG - Intronic
1114440467 14:22742588-22742610 GGGAGGCAGAGGCTGGCAGACGG + Intergenic
1114464359 14:22910497-22910519 GGGGGGGAAAGGAAGGGAGAAGG + Intronic
1114513495 14:23281722-23281744 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1114590754 14:23862662-23862684 GGGTGGGAGAGTGGGGCAGAGGG - Intergenic
1114597169 14:23923301-23923323 GGGAGGCCAAGGTGGGCAGATGG + Intergenic
1115776399 14:36720060-36720082 GGGTGGGCCTGGCTGGCAGAGGG - Intronic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1115933658 14:38527255-38527277 GGGTGGGAGAGGTGGGAAGGAGG + Intergenic
1116844789 14:49855204-49855226 GGGAGGCCAAGGCTGGCAGATGG + Intergenic
1117105485 14:52393957-52393979 GGGCGGGAAGGGAGGGCACAGGG - Intergenic
1117685932 14:58253226-58253248 GGGAGGCTGAGGCGGGCAGATGG - Intronic
1117715352 14:58574499-58574521 TGTTGGGAAAGGTGGGCAGTGGG + Intergenic
1118046312 14:61975197-61975219 GAGTGGGAAAGGTGCACAGATGG - Intergenic
1118227327 14:63914178-63914200 GGGTGGGAAAGGTGTGCCCAGGG + Intronic
1119294362 14:73521048-73521070 GGGTGAGAAAGGAGGGAAAAGGG + Intronic
1119595480 14:75928986-75929008 GGGTGGGGAGGGTGGGCAGGAGG - Intronic
1119738694 14:77000106-77000128 GGGGGAGCAAGGTGGGCAGAAGG - Intergenic
1120184062 14:81374256-81374278 GGGAGGCAGAGGTGGGCAGATGG - Intronic
1120862929 14:89270929-89270951 TGGGGAGAAAGACGGGCAGAGGG + Intronic
1121100936 14:91249821-91249843 GGGAGGCCAAGGTGGGCAGATGG - Intronic
1121120274 14:91371948-91371970 GGGTGGGAAAGGCAGGCAGTGGG + Intronic
1121144139 14:91568847-91568869 GGTTGGGAATGGCCTGCAGAGGG - Intergenic
1121200602 14:92114055-92114077 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
1121226099 14:92323093-92323115 GGGGGTGAGAGGCGGGCAGGAGG + Intronic
1121304055 14:92894427-92894449 GGGTGGGAGAGACAGCCAGATGG + Intergenic
1121335629 14:93076117-93076139 GGAGGGGAAAGGTGGACAGATGG - Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121697938 14:95928265-95928287 GGGTGGCAGAGAGGGGCAGAGGG - Intergenic
1121751752 14:96363420-96363442 GGCCGCGGAAGGCGGGCAGAAGG + Exonic
1122101994 14:99420154-99420176 GCGTGGGAAAGGCAGGAACAGGG - Intronic
1122119626 14:99545196-99545218 GTGTGGGAGAGGCAGGCAGCCGG - Intronic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1122449919 14:101797473-101797495 GGGTGGAGAAAGAGGGCAGAGGG - Intronic
1122559191 14:102599369-102599391 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1123020237 14:105394502-105394524 GGGTGGGCAGGCCGGGCAGGGGG + Intronic
1123099290 14:105785266-105785288 CGGGGGCCAAGGCGGGCAGATGG - Intergenic
1202930701 14_KI270725v1_random:30513-30535 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1123421655 15:20140899-20140921 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1123443401 15:20305617-20305639 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1123530881 15:21147439-21147461 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1123673924 15:22689838-22689860 GGGTGGGATGGGAGAGCAGAGGG - Intergenic
1124218003 15:27825480-27825502 GGCTGGGAGTGGCGGGGAGAGGG + Intronic
1124351993 15:28962650-28962672 GGGAGGCAGAGGTGGGCAGATGG - Intronic
1125172145 15:36777848-36777870 GGGAGGCCGAGGCGGGCAGATGG - Intronic
1125284069 15:38073277-38073299 GGGTGGGGGAGGCCGGGAGAGGG - Intergenic
1125985510 15:44047327-44047349 GGAGGGGAAAGGAGGGGAGAGGG + Intronic
1126140738 15:45436203-45436225 GGGAGGCTGAGGCGGGCAGATGG + Intronic
1126359713 15:47833896-47833918 TTATGGGAAAGGCTGGCAGATGG + Intergenic
1126402960 15:48293146-48293168 GGGAGGATAAGGCGGGCAGATGG - Intronic
1126557019 15:49999836-49999858 GGGTGGGAAAGGCAGGGAGGTGG - Intronic
1126916563 15:53472885-53472907 CGTTGGGAAAGGCTGTCAGAGGG + Intergenic
1127440619 15:59003342-59003364 GGGAGGTCAAGGTGGGCAGATGG - Intronic
1127574482 15:60277297-60277319 AGGTGGGAAAGGATGGGAGAGGG + Intergenic
1127655431 15:61051154-61051176 GGGTGTGGAAGGATGGCAGAAGG + Intronic
1127753718 15:62069341-62069363 GGGAGGCCGAGGCGGGCAGATGG + Exonic
1127824449 15:62690645-62690667 GGGAGGCCAAGGCGGGCAGCTGG + Intronic
1127926184 15:63545728-63545750 GGGAGGCTAAGGCGGGCGGATGG + Intronic
1128098118 15:64974225-64974247 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1128290746 15:66476651-66476673 GGCATGGAAAGGCAGGCAGAGGG + Intronic
1128764370 15:70242121-70242143 GGGTGGCAAATGCTGGCAAATGG - Intergenic
1129308292 15:74685153-74685175 GGGAGGCTAAGGTGGGCAGATGG + Intronic
1129444604 15:75608139-75608161 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1129453207 15:75662336-75662358 GGGTGGGCAGGGCGGGGAGGAGG - Intergenic
1129461654 15:75702890-75702912 GGTTGACAAAGGCGGGCAGGGGG - Intronic
1129525701 15:76212732-76212754 CTGTGGGCAAGGCTGGCAGAGGG - Intronic
1129715936 15:77850862-77850884 GGGAGGCCAAGGCGGGCAGATGG - Intergenic
1129723198 15:77888956-77888978 GGTTGACAAAGGCGGGCAGGGGG + Intergenic
1129807098 15:78471246-78471268 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1130182257 15:81642400-81642422 AGTTGAGAAAGGCGTGCAGAGGG + Intergenic
1130220127 15:82012387-82012409 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1130346043 15:83046154-83046176 GGGAGGCTGAGGCGGGCAGATGG + Intronic
1130440180 15:83945354-83945376 GGGTGGGAAGGACAGGTAGAAGG + Intronic
1130991151 15:88876905-88876927 GGGTGGGAGTGGGAGGCAGAGGG + Intergenic
1131007876 15:88993327-88993349 GGAAGGGAGAGGCAGGCAGACGG + Intergenic
1131802960 15:96090813-96090835 GGGAAGGAAAGGGGGTCAGAAGG + Intergenic
1132060603 15:98689464-98689486 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1132061902 15:98699093-98699115 GAGAGGGAAAGGAAGGCAGAAGG + Intronic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132537266 16:488646-488668 GGGAGGCCAAGGCGAGCAGATGG - Intronic
1133112368 16:3556087-3556109 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1133343385 16:5053784-5053806 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1133351398 16:5103083-5103105 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1133440087 16:5814201-5814223 GGCTGGGAAAGGAGGGCATACGG - Intergenic
1133569385 16:7026117-7026139 GGGTGGAAATGGCAGCCAGAAGG + Intronic
1133755236 16:8757662-8757684 GGGTTGGAAAGGAAGGGAGAGGG + Intronic
1133894270 16:9910775-9910797 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1134288619 16:12884247-12884269 GGGTGGGAAGGGTGGGAAGGGGG + Intergenic
1134349703 16:13425252-13425274 GGGAGGCCAAGGTGGGCAGATGG + Intergenic
1134353809 16:13462582-13462604 GGGAGGCAGAGGCAGGCAGATGG + Intergenic
1134371506 16:13630211-13630233 GGGAGGCTAAGGAGGGCAGATGG - Intergenic
1134465057 16:14468363-14468385 TGGTGGGAAAGGTGGACAGTCGG + Intronic
1134815776 16:17204544-17204566 GGATGGGGATGGGGGGCAGAGGG + Intronic
1135117045 16:19732700-19732722 GGGAGGCCAAGGAGGGCAGATGG - Intronic
1135250740 16:20899822-20899844 GGGAGGGAAATGAGGGCGGAGGG + Intronic
1135681790 16:24463476-24463498 TGGGGGGAAAGGAGGGGAGATGG + Intergenic
1135873431 16:26173794-26173816 GGGAGGCTAAGGAGGGCAGATGG + Intergenic
1135875132 16:26191790-26191812 GGGAGGGCAAGGTGGACAGATGG + Intergenic
1136043127 16:27595972-27595994 TGGTGGGAGAGGAGGACAGAGGG + Intronic
1136417390 16:30112434-30112456 GTGTGGGAAAAGGGGTCAGAGGG + Intronic
1136863181 16:33714738-33714760 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1137255953 16:46775741-46775763 GGGAGGCCGAGGCGGGCAGATGG + Intronic
1137300327 16:47143304-47143326 GGGTCGGGAAGGCGGCCAGGAGG - Intronic
1137751392 16:50863506-50863528 GGGTGGGAGAGGGTGGGAGAGGG + Intergenic
1137862598 16:51861640-51861662 GGGAGGGAAATGGGGCCAGAGGG - Intergenic
1137961402 16:52885385-52885407 GGATGGGAAAGGAGGGAAGCAGG - Intergenic
1138506366 16:57480262-57480284 GGGTGGGGCAGGAGGGTAGAGGG - Intronic
1138528790 16:57623657-57623679 GGGTGGGGGAGGCGGGCCTAGGG + Intronic
1138569920 16:57863785-57863807 GGGAGGGAAAGCCGGGGAGTGGG + Intergenic
1138616240 16:58169505-58169527 GGGCAAGAAAGGCGGGCAGTGGG + Intronic
1139220349 16:65175498-65175520 AGGTGGTAAAGGCAGGCAGCAGG - Intergenic
1139545953 16:67649636-67649658 GGGTGGGACCAGCGGGCAGGGGG + Intronic
1139667935 16:68471411-68471433 AGGTGGGAGAGGCTGGCAGGGGG - Intergenic
1139673760 16:68509246-68509268 GGGAGGCCAAGGCTGGCAGATGG - Intergenic
1139708381 16:68758051-68758073 GGGAGGCTGAGGCGGGCAGATGG - Intronic
1139900191 16:70322104-70322126 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1140020685 16:71235542-71235564 GGGAGGCTGAGGCGGGCAGATGG + Intergenic
1140437160 16:74956889-74956911 GATTGGGAAAGGCTGGGAGAAGG - Intronic
1141127874 16:81414000-81414022 GGGAGGCAGAGGCAGGCAGACGG + Intergenic
1141244264 16:82291642-82291664 GGGAGGGTGAGGCGGGCAGATGG - Intergenic
1141408006 16:83810588-83810610 GGGAGGCAAAGGCAGGCAGAGGG + Intronic
1141578154 16:84978492-84978514 GGGAGGCCAAGACGGGCAGATGG + Intronic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142158972 16:88547312-88547334 GGGTGGGGAAGGCGAGGAGAGGG + Intergenic
1142404334 16:89878878-89878900 GGGAGGCAGAGGTGGGCAGATGG - Intronic
1142425318 16:89999466-89999488 GGGTGGGAAAGCAGGGCAGTGGG + Intergenic
1203124673 16_KI270728v1_random:1562891-1562913 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1142554193 17:761952-761974 AGGTGGGAAAGAAGGTCAGAGGG + Intronic
1142669161 17:1479571-1479593 GGGTGAGTGGGGCGGGCAGAGGG - Exonic
1142837643 17:2600332-2600354 GGGAGGCCAAGGCGGGCAGAAGG + Intronic
1142837833 17:2601829-2601851 GGGAGGTAAAGGTGAGCAGATGG - Intronic
1142856089 17:2731244-2731266 TGGGGGGACAGGCAGGCAGAGGG - Intergenic
1142968158 17:3593703-3593725 GTGTGGGACAGGCGGTCAGTGGG - Intronic
1143162586 17:4881269-4881291 GGGGAGGGAAGGCGGGCAGGGGG - Intronic
1143465679 17:7134584-7134606 GGGAGGCTGAGGCGGGCAGATGG + Intergenic
1143750259 17:9022173-9022195 GGGGGAGAGAGGCGGGCAGTCGG + Intronic
1143874172 17:9979384-9979406 GGCTGAGAAAGGTGGGGAGATGG - Intronic
1144826207 17:18107129-18107151 GGGTGAGGAATGGGGGCAGAGGG - Intronic
1145742002 17:27282602-27282624 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1146095482 17:29926297-29926319 GGGAGGCCAAGGTGGGCAGACGG + Intronic
1146627622 17:34446195-34446217 GGTGGGGAAAGGCAGGGAGATGG + Intergenic
1146647138 17:34582929-34582951 GGATCGGGAAGGTGGGCAGAGGG - Intronic
1146750316 17:35373252-35373274 GGGTGGGTAATGGGGGTAGAAGG - Intronic
1146795237 17:35775747-35775769 GGGTGGAAAAGGAAGGAAGAGGG - Intronic
1146887866 17:36484407-36484429 GGGAGGCCAAGGCGGGCACATGG - Intergenic
1147662605 17:42125081-42125103 GGGTGGGTAAGGGGGGGAGTGGG - Intronic
1147685936 17:42286991-42287013 GAGTGGGAAAGGAGAGGAGAGGG + Intergenic
1147797993 17:43059551-43059573 GAGTGGGAAAGGCAGGAAGCAGG - Intronic
1147811570 17:43173822-43173844 GGGTGGGGGTGGGGGGCAGAGGG - Intronic
1147916472 17:43890512-43890534 GGGTTGGAGTGGAGGGCAGAGGG - Intronic
1148146414 17:45367708-45367730 GGGTGGGGCAGGCGGGGAGAGGG + Intergenic
1148244191 17:46019770-46019792 GGGAGGCGAAGGTGGGCAGATGG + Intronic
1148354797 17:46968685-46968707 TGGTGGGGAAGGCAGGCAGAGGG - Intronic
1148391499 17:47276150-47276172 GGGTTGGAAAGGAGGGAAGGAGG - Intronic
1148573112 17:48686429-48686451 GGGAGGCTGAGGCGGGCAGATGG + Intergenic
1148615536 17:48997575-48997597 GGGCGGGGAAGGCGGCCTGAGGG - Exonic
1148789144 17:50163760-50163782 GGGTGGGAAGGGAGGTCACAGGG - Intergenic
1148794961 17:50192533-50192555 AGGTGGGAAATGGGGGAAGAAGG + Intronic
1148846332 17:50532326-50532348 GTGTGGGAAAGGCAGGGAGGGGG + Intergenic
1148860046 17:50600011-50600033 GGCTTGGCAAGGCGGGCAGAGGG - Intronic
1149036188 17:52136677-52136699 GGCTCAGAAAGGGGGGCAGAGGG - Intronic
1149526655 17:57361359-57361381 GGAAGGCCAAGGCGGGCAGATGG + Intronic
1150182910 17:63145303-63145325 GAGTGGGAAAGAAGGGTAGAAGG - Intronic
1150451320 17:65271232-65271254 TGGTGGGAAAAGAGGGGAGAGGG + Intergenic
1150725402 17:67647555-67647577 GGGAGGCTGAGGCGGGCAGATGG - Intronic
1151377724 17:73702755-73702777 GGGAGGCTGAGGCGGGCAGATGG - Intergenic
1151389665 17:73777508-73777530 GGGTGGGTAGGGCGGGCAGCTGG - Intergenic
1151463869 17:74272229-74272251 GGGTGGGAAAGTGGGTTAGAAGG - Intergenic
1151535708 17:74737691-74737713 GGCTGGGAAGGGCTGGGAGATGG + Intronic
1151626860 17:75282028-75282050 GGGAGGCCGAGGCGGGCAGACGG + Intronic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1151798495 17:76362965-76362987 GGGAGGCCAAGGCGGGCGGATGG + Intronic
1151818272 17:76482400-76482422 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1152475753 17:80516927-80516949 GGGAAGGAAAGAGGGGCAGAGGG + Intergenic
1152486499 17:80597751-80597773 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1152526424 17:80890534-80890556 GGGTGGGAGGGGCGGGTGGAGGG + Intronic
1152691977 17:81722452-81722474 GGGTGGGAGAGGAGGCCAGTGGG + Intergenic
1152784567 17:82241120-82241142 GGGTGGGGGTGGGGGGCAGAGGG + Intronic
1152796329 17:82309356-82309378 GGGTTGTCAAGGCGGGCAGAGGG - Intergenic
1152841418 17:82571085-82571107 GGGTGGGTAAGGCTGGCTGAGGG - Intronic
1152863494 17:82709316-82709338 GGGTGGGTCATGGGGGCAGAGGG - Intergenic
1152904661 17:82963599-82963621 GGGTGGGATATGCGGGGAGGTGG + Intronic
1153027209 18:682627-682649 GGGAGGCCAAGGCGGGCAGATGG + Intronic
1153031180 18:713531-713553 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
1153350638 18:4077567-4077589 GGGTGGGTCAGGCGGGCAGGAGG - Intronic
1153565476 18:6414305-6414327 GAGGGGGACACGCGGGCAGACGG + Intronic
1153854722 18:9135373-9135395 GGGAGGCTCAGGCGGGCAGATGG - Intergenic
1153971856 18:10234368-10234390 GGCTGGGACAGGTGGGCTGAGGG + Intergenic
1153987844 18:10368841-10368863 GGGAGGGAAAGAGGGGGAGAGGG + Intergenic
1154008087 18:10551174-10551196 GGGAGGCCAAGGCAGGCAGATGG - Exonic
1154275166 18:12952745-12952767 GGGTGGGAGGGGAGGGGAGAGGG - Intronic
1154306310 18:13233348-13233370 GGGTTGGCAAGGTTGGCAGAGGG + Intronic
1154355298 18:13619942-13619964 GGGTGGGAGTGGAGGGCAGTGGG - Intronic
1154502830 18:15005079-15005101 TGGTGGGAGGGGCTGGCAGATGG + Intergenic
1155136175 18:22994963-22994985 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1155170459 18:23263315-23263337 GGCTGGGAAGGGCAGGGAGAAGG - Intronic
1155260409 18:24036870-24036892 GGGAGGCCAAGGCGGACAGATGG - Intronic
1156222315 18:35065053-35065075 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1156383584 18:36585992-36586014 GGGGGAGAAGGGCTGGCAGATGG - Intronic
1156391280 18:36652736-36652758 GGGGGTGACAGGAGGGCAGATGG - Exonic
1157262080 18:46184480-46184502 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1157475983 18:48023961-48023983 GGGTGGCAAAGGCCAGGAGAGGG + Intergenic
1157603044 18:48906403-48906425 GGGAGGCCAAGGTGGGCAGATGG + Intergenic
1157656699 18:49396909-49396931 GGGTAGGACAGGCAGGGAGAGGG + Intronic
1158240693 18:55374659-55374681 GGGAGGCTAAGGCAGGCAGATGG + Intronic
1158543073 18:58374450-58374472 GGCCGGGAAAGGGGGGCAGTGGG - Intronic
1159011675 18:63063954-63063976 GGGAGGCAGAGGCGGGAAGATGG - Intergenic
1160409855 18:78667993-78668015 GGGTGGGATGGGAGGGCAGATGG - Intergenic
1160464359 18:79063824-79063846 GGGAGGCTGAGGCGGGCAGATGG - Intergenic
1160575802 18:79853140-79853162 GGGTGGGCAAAGCGGACAGTGGG + Intergenic
1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG + Intronic
1161249249 19:3271389-3271411 GGGTGGGAAAGGGGTCCAGCTGG + Intronic
1161252171 19:3286063-3286085 AGGTGGACAGGGCGGGCAGAGGG - Intronic
1161657658 19:5525809-5525831 GGGTGGGAAATGTGGGGTGAGGG - Intergenic
1161816661 19:6503334-6503356 GGGAGGCAGAGGTGGGCAGATGG - Intergenic
1161955911 19:7495020-7495042 GGGAGGGAAAGGAAGGAAGAAGG - Intronic
1161955932 19:7495092-7495114 GGGAGGGAAAGGAAGGAAGAAGG - Intronic
1161979045 19:7621039-7621061 GGGCGGGGTAGGCGGGGAGAGGG + Intronic
1162152080 19:8653816-8653838 GGGTGGGAAAGGTTGGGAGGCGG + Intergenic
1162221303 19:9179030-9179052 AGCAGGGAAAGGCGGGGAGATGG - Intergenic
1162278292 19:9675371-9675393 GGGTTGGAAAGGCGGGGATGGGG + Intergenic
1162305723 19:9872270-9872292 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1162457555 19:10795158-10795180 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1162568440 19:11457208-11457230 GGGTGGGGAGGGCAGGCCGACGG - Intronic
1162656417 19:12134401-12134423 GGGAGGTTGAGGCGGGCAGATGG + Intronic
1162950476 19:14069319-14069341 GGGAGGCTGAGGCGGGCAGATGG - Intergenic
1162962434 19:14136116-14136138 GGGAGGTCAAGGCGGGCAGTGGG + Intronic
1163058375 19:14739859-14739881 GGGAGGCCAAGGCGGGCAGATGG + Intronic
1163204304 19:15790995-15791017 GGCTGGGAAGGGTAGGCAGAAGG + Intergenic
1163365979 19:16876390-16876412 GGGTGGCAAAGGCGGGAGGCGGG + Intronic
1163586577 19:18167612-18167634 GGGAGGCTGAGGCGGGCAGATGG + Intronic
1164524140 19:29001096-29001118 GGGTGGGGGAGGTGGGGAGAGGG + Intergenic
1164524149 19:29001117-29001139 GGGTGAGGGAGGCGGGGAGAGGG + Intergenic
1164583147 19:29447580-29447602 GGCTGGGAAAGGCAGCCAGAGGG - Intergenic
1165025428 19:32957568-32957590 GGGAGGTCAAGGTGGGCAGATGG + Intronic
1165027669 19:32973315-32973337 GGGAGGAAAGGGCTGGCAGAGGG - Intronic
1165198211 19:34123251-34123273 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
1165427226 19:35752915-35752937 TGGTGGGGGAAGCGGGCAGATGG - Exonic
1165488311 19:36108611-36108633 GGGAGGCCAAGGCAGGCAGACGG + Intergenic
1166002345 19:39885321-39885343 GGGTGGCCAAGGCGGGACGATGG + Intronic
1166005128 19:39901573-39901595 GGGTGGCCAAGGCGGGACGATGG + Intronic
1166121896 19:40691368-40691390 GGGTGGGGAAGGCGAGAAGGAGG + Intergenic
1166284268 19:41814164-41814186 GTGTGGGAAGGACTGGCAGATGG - Intergenic
1166326466 19:42053936-42053958 GGGTGGGGAGGTGGGGCAGAGGG + Intronic
1166516342 19:43449915-43449937 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1166929973 19:46296635-46296657 GGGTGGGATTGGAGGTCAGAGGG + Intergenic
1167243435 19:48359251-48359273 GGGTGGGATATGAGGGCAGAGGG - Intronic
1167299687 19:48671585-48671607 GGCTGGGATAGGTGGGCAGGTGG + Intronic
1167601913 19:50459487-50459509 GGGTGGGAGAGGAGGTGAGATGG + Intronic
1167706432 19:51083942-51083964 GGATGGGACAGGCAGGCCGATGG + Intronic
1167739653 19:51316874-51316896 GGCTGGGAAAGGCTGTGAGAAGG - Intronic
1168184752 19:54692570-54692592 GGCTGGGAAGGGTGGGAAGAGGG + Intronic
1202691389 1_KI270712v1_random:97365-97387 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
925823053 2:7819467-7819489 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
926145362 2:10393873-10393895 GGGAGGCCAAGGCAGGCAGATGG + Intronic
926176111 2:10593769-10593791 GGGAGGGCAAGGCTGGCACATGG + Intronic
926858741 2:17285273-17285295 GGGTGGGATGGGAAGGCAGAGGG + Intergenic
927120412 2:19955187-19955209 GGGAGGCTGAGGCGGGCAGATGG - Intronic
927596618 2:24403140-24403162 GCGGGGGAAAGGCGGGCGGGGGG - Intergenic
927732439 2:25486221-25486243 GGGAGGCCAAGGCAGGCAGATGG + Intronic
927742377 2:25583019-25583041 GGGAGGCCAAGGCGGGCAGATGG + Intronic
928547961 2:32345484-32345506 GGGAGGTCAAGGCAGGCAGATGG - Intergenic
928926537 2:36585505-36585527 GGGTGGGGAGGGAGAGCAGAAGG + Intronic
929444557 2:41992082-41992104 GGGAGGGAAAGTGGGGGAGAAGG + Intergenic
930280191 2:49360692-49360714 GGGTGGGGGAGGTGGGCAGGTGG - Intergenic
931344319 2:61432232-61432254 GAGTGGCCAAGGTGGGCAGATGG + Intronic
931364844 2:61610167-61610189 GGGAGGCCTAGGCGGGCAGATGG + Intergenic
932028037 2:68155586-68155608 GGGAGGGAGAGGCGGGAGGATGG + Intronic
932199183 2:69810727-69810749 GGATGAGAAAGGCTGGCAAAGGG - Intronic
932335112 2:70926362-70926384 GGCTGACAAAGGTGGGCAGAGGG - Intronic
932411247 2:71549297-71549319 GGGTGGGCATGGCTGGGAGAAGG - Intronic
932581999 2:72998244-72998266 GGGTGGGACAAGCATGCAGAAGG + Intronic
932689065 2:73897066-73897088 GGGTGGGGAAGGCAGGGGGAAGG - Exonic
932758365 2:74424002-74424024 GGGTGGGGAAGGCTCCCAGATGG - Intronic
933657826 2:84904264-84904286 GGGAGGTTAAGGCAGGCAGATGG + Intronic
934239192 2:90252799-90252821 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
934323312 2:91985347-91985369 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
934461631 2:94216153-94216175 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
934504641 2:94880686-94880708 GGGTGGGCAGGGAGAGCAGAGGG - Intergenic
934614433 2:95762537-95762559 GGGTGGGGCAGGGTGGCAGAGGG + Intergenic
934619151 2:95793565-95793587 GGGTGGGAATGGGGCACAGATGG + Intergenic
934641740 2:96030992-96031014 GGGTGGGAATGGGGCACAGATGG - Intronic
934646472 2:96061962-96061984 GGGTGGGGCAGGGTGGCAGAGGG - Intergenic
935064668 2:99637053-99637075 GGGTGGGAAAAGGGGGGAAATGG + Intronic
935641925 2:105299037-105299059 GGGAGACAGAGGCGGGCAGATGG + Intronic
935752572 2:106249984-106250006 GGCTGGGAAAGGCAGGGAGGTGG + Intergenic
935796438 2:106645642-106645664 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
935912991 2:107917529-107917551 GGCTGGGAAAGGCAGGGAGGTGG + Intergenic
935949544 2:108316343-108316365 GAGTGGGAGAGGTGGGAAGAAGG - Intergenic
936159185 2:110071133-110071155 GAGTGGCCAAGGCAGGCAGATGG + Intergenic
936185476 2:110300199-110300221 GAGTGGCCAAGGCAGGCAGATGG - Intergenic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
936662738 2:114560220-114560242 GGGAGGAGAAGGAGGGCAGAGGG + Intronic
937044332 2:118843287-118843309 GGGTGGGGACCGAGGGCAGAAGG + Intronic
937066112 2:119019249-119019271 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
937356377 2:121200522-121200544 AGGAGGGAGAGGCAGGCAGATGG + Intergenic
937357789 2:121209154-121209176 GGGTGGGATATGCGGCCAGGGGG - Intergenic
937896301 2:126979064-126979086 GGGTGGGGAAGCCGGGAAGGAGG - Intergenic
937921802 2:127136547-127136569 GGGTGGGAGACGGGGGAAGACGG + Intergenic
937966799 2:127518274-127518296 GGGAGGCCAAGGCGGGCGGATGG + Intronic
938018151 2:127885254-127885276 GGAGGGGAAAAGCGGGCCGAGGG + Intronic
938306898 2:130262738-130262760 TGCAGGGAAAGGAGGGCAGAGGG - Intergenic
938501997 2:131835249-131835271 TGGTGGGAGGGGCTGGCAGATGG + Intergenic
938800324 2:134757087-134757109 GGGAGGCCAAGGTGGGCAGATGG + Intergenic
939263448 2:139839837-139839859 GGCTGGGAAAGGCAGTAAGAGGG - Intergenic
939623253 2:144446420-144446442 GGCTGAGAAAGGGGAGCAGAGGG - Intronic
940665548 2:156604521-156604543 GGGAGGCCAAGGCGGGCAGATGG - Intronic
941268899 2:163400614-163400636 GGGAGACAAAGGGGGGCAGAAGG - Intergenic
941721001 2:168812778-168812800 AGGTGGGAAAGGCAGAGAGAGGG + Intronic
941975258 2:171397276-171397298 GGGAGGTCAAGGTGGGCAGATGG + Intronic
942050070 2:172131584-172131606 GGGAGGACAAGGCAGGCAGATGG + Intergenic
942210887 2:173668719-173668741 GGTTGGGAGGGGAGGGCAGAGGG + Intergenic
942570720 2:177311251-177311273 GGGAGGCCGAGGCGGGCAGATGG + Intronic
942634073 2:177982834-177982856 GGGAGGCCAAGGTGGGCAGATGG + Intronic
943927172 2:193799741-193799763 GGTTGGAAAGGGCGGGCAAACGG + Intergenic
944278262 2:197864711-197864733 GGGAGGCCAAGGCAGGCAGAAGG - Intronic
944361749 2:198865332-198865354 GGGTGGGCAGGGAGGGCAGCTGG - Intergenic
944714514 2:202365627-202365649 AGGAGGCCAAGGCGGGCAGATGG + Intergenic
945058320 2:205887334-205887356 GGGTAGGAATGGCAGGCAGGTGG - Intergenic
945412507 2:209528092-209528114 GGGTGGGCAGGGGGGGAAGATGG - Intronic
946395995 2:219444088-219444110 GGGTGGGAAAGGGGGGGATGCGG - Intronic
946642800 2:221802372-221802394 AGGGGAGAAAGGCAGGCAGAAGG - Intergenic
946785051 2:223234944-223234966 AGGGGGGAAAGGTGGGGAGAAGG - Intergenic
947106791 2:226675984-226676006 GGGAGGCCAAGGCGGGCGGATGG + Intergenic
947190831 2:227502991-227503013 GGGAGGCAGAGGTGGGCAGATGG + Intronic
947769898 2:232662325-232662347 GGGACGGAAAGGCGGGCTGTTGG + Intronic
947787717 2:232838803-232838825 GGGTGGGGGAGGGGTGCAGAGGG - Intronic
948179324 2:235967117-235967139 GGGTGGGAGAGGCCTGCGGAAGG - Intronic
948236561 2:236395133-236395155 GGGTGGGAAGGGGGCTCAGATGG + Intronic
948341543 2:237256650-237256672 GTCTGGGAAAGGAGGGCAGTTGG - Intergenic
948500400 2:238388871-238388893 GGAAGGCCAAGGCGGGCAGATGG - Intronic
948589525 2:239040183-239040205 AGGTGGCAGAGCCGGGCAGAGGG + Intergenic
948850578 2:240703551-240703573 GGGGTGGAAAAGCAGGCAGAGGG + Intergenic
1168849259 20:965408-965430 GGGGTGGAAAGGCTGGCAGATGG + Intronic
1168856511 20:1012953-1012975 GGGAAGGAGAGGCGAGCAGAGGG + Intergenic
1168877718 20:1182652-1182674 GGGAGGGAGAGGCGAGAAGAGGG + Intronic
1169244137 20:4012171-4012193 GGGAGGCTAAGGCAGGCAGATGG + Intronic
1169964142 20:11196438-11196460 GGGTGGAAAAGGTGGGAGGAAGG + Intergenic
1170475876 20:16713969-16713991 GGGTGGGAATGGAGGGTGGAAGG + Intergenic
1170513334 20:17102072-17102094 GGGAGGGTGAGGCGGGCAGTTGG + Intergenic
1170666269 20:18389204-18389226 GGGTGGGAAAGCAAGGCAGCAGG + Intronic
1170785203 20:19461770-19461792 GGGAGGCAGAGGCGGGCAGATGG - Intronic
1171958730 20:31478180-31478202 GGGTGGGAGGGGTGGGAAGAGGG - Intronic
1172085409 20:32378257-32378279 GGGAGGTCAAGGTGGGCAGATGG - Intronic
1172190378 20:33058752-33058774 GGGTGGGATAGGCGCTCAGAGGG + Intronic
1172725075 20:37033552-37033574 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1172737700 20:37140440-37140462 GGGAGGCAAAGGTGGGCAGATGG - Intronic
1173677111 20:44845508-44845530 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1173724219 20:45286077-45286099 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
1174285378 20:49469049-49469071 GGATGGGAAAGGCTGGAAGCAGG + Intronic
1174350947 20:49967606-49967628 GGGAGGGAAAGGGGGGCGGGGGG - Intergenic
1174970012 20:55264501-55264523 GGGAGGCTGAGGCGGGCAGACGG - Intergenic
1175226532 20:57447770-57447792 GGGAGGCAGAGGTGGGCAGAAGG - Intergenic
1175655539 20:60766534-60766556 GGCTGGGAAAGGCAGGCCAAGGG + Intergenic
1176080846 20:63272482-63272504 GGCTGGGACAGCCGGGCAGGAGG - Intronic
1176102168 20:63369595-63369617 GGGTGGGCAGGGTGAGCAGAGGG - Intronic
1176184155 20:63769084-63769106 GGGTGGGAGAGGAGGGCACATGG + Intronic
1176210379 20:63917794-63917816 GGGAGGCCAAGGTGGGCAGATGG - Intronic
1176592722 21:8659136-8659158 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1176856916 21:13981181-13981203 GGGCGGGAAAGGGGGGTACAGGG - Intergenic
1176865920 21:14055146-14055168 GGGAGGCCAAGGCTGGCAGATGG - Intergenic
1176867674 21:14063040-14063062 GGGCGGGAAAGGGGGGTACAGGG + Intergenic
1177685222 21:24427444-24427466 GGGAGGCCGAGGCGGGCAGATGG + Intergenic
1178512353 21:33216078-33216100 GGGTGGCTAAGGAGGGCAGCTGG + Intergenic
1178569710 21:33724892-33724914 GGGAGGCAAAGGCAGGAAGATGG - Intronic
1178569930 21:33726759-33726781 GGGAGGCTGAGGCGGGCAGACGG - Intronic
1178689322 21:34738265-34738287 AAGTGGGAAAGGCAGGAAGAAGG - Intergenic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1178871405 21:36380121-36380143 GGGAGGCCGAGGCGGGCAGATGG - Intronic
1178873951 21:36398291-36398313 GGGTGGCCAAGGCAGACAGATGG - Intronic
1178948991 21:36970470-36970492 GGGAGGCTAAGGTGGGCAGATGG - Intronic
1179020749 21:37638598-37638620 GGGTGGAAATGGTAGGCAGAAGG - Intronic
1179569229 21:42268243-42268265 GGGTGGGAAAGTAGGGCAGGCGG + Intronic
1179727227 21:43347304-43347326 TGGTGGGAAAGGCGGGCCCTGGG - Intergenic
1180275575 22:10636278-10636300 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1180550054 22:16531218-16531240 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1180613597 22:17113434-17113456 GGGAGGATGAGGCGGGCAGATGG - Exonic
1180782833 22:18530229-18530251 CGGGGCGAAAGGCGGGCAGGTGG - Intronic
1180994763 22:19959917-19959939 AGGTGGGACAGGCGGGCACTGGG + Intronic
1181239731 22:21469591-21469613 CGGGGCGAAAGGCGGGCAGGTGG - Intergenic
1181354617 22:22290603-22290625 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181487570 22:23241316-23241338 GGGGGGGAATGGCAGGAAGAGGG - Intronic
1181534379 22:23534093-23534115 GGGAGGGAAGGGCAGGAAGAGGG + Intergenic
1181635958 22:24174977-24174999 TGGTGGGACAGGCAGGCAGAGGG - Intronic
1182587882 22:31355986-31356008 GGGAGGCCAAGGCGGGCAGATGG - Intergenic
1182638493 22:31748651-31748673 GGGTGGGAAGGATGTGCAGATGG + Intronic
1182721508 22:32404924-32404946 GGGAGGCCAAGGCGGGCGGATGG - Intronic
1183300635 22:37057384-37057406 GGGTGGGACCTGTGGGCAGAAGG - Exonic
1183364446 22:37399670-37399692 GGGTGGGAGAGGTGGGCTGATGG - Intronic
1183933308 22:41248332-41248354 GTGGGGGAAATGCGGCCAGAAGG + Intronic
1183984394 22:41561623-41561645 GGCTGGGAAAGGCAGACAGTTGG + Intronic
1184053092 22:42023432-42023454 GGGAGGGCAAGGCGGGCAGATGG - Intronic
1184057695 22:42063353-42063375 GGTTGGGAGAGGAGGGCAGCAGG - Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184147370 22:42619428-42619450 GGCCGGGAATGGTGGGCAGACGG + Exonic
1184357379 22:43991505-43991527 GGGAGGCCAATGCGGGCAGATGG - Intronic
1184386866 22:44181571-44181593 GTTTGGGGAAGGCGGGGAGAGGG + Intronic
1184410442 22:44323106-44323128 GGGTGGGTGAGGTGGGTAGATGG - Intergenic
1184410533 22:44323519-44323541 GGGTGGGTGAGGTGGGTAGATGG - Intergenic
1184983681 22:48114756-48114778 GAGTGGGAAGGGCTGGCAGGAGG - Intergenic
1184987908 22:48147885-48147907 GCCTGGGAAAAGCGGACAGAAGG + Intergenic
1185345577 22:50309197-50309219 GGGTGGGAAGGGCTGGGAGCAGG - Exonic
949250992 3:1983692-1983714 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
949433111 3:3999694-3999716 GAGTGGGAAAGGTGGGAGGAGGG + Intronic
949698493 3:6727819-6727841 GGCTGGGAAAGGCATGGAGAAGG + Intergenic
949865283 3:8542239-8542261 GGGAGGCCAAGGCGGGCAGATGG - Intronic
950015108 3:9749793-9749815 GAGGGGGAAAGGCGAGCAGCTGG + Intergenic
950016989 3:9761358-9761380 GGGAAGGAAGGGAGGGCAGAGGG + Intronic
950745660 3:15086156-15086178 GGGAGGCCAAGGCGGGAAGATGG + Intronic
952285375 3:31963246-31963268 GGATGGGAAAGGGAGGGAGATGG - Intronic
952287128 3:31980524-31980546 GACTGGGAAAGGGAGGCAGAAGG - Intronic
952337943 3:32421054-32421076 GGGTGGGAGAGGAGGGCAGCAGG - Intronic
952814900 3:37438697-37438719 GGGAAGGAAAGGAGGGCAGGTGG + Intergenic
953135112 3:40175497-40175519 GAATGGGAAAGGAGGGCAGCAGG - Intronic
953258219 3:41310751-41310773 GGGAGGCAGAGGTGGGCAGATGG + Intronic
953364930 3:42336274-42336296 GGGTGAGCAAGGCCTGCAGATGG - Intergenic
953447100 3:42977979-42978001 GGTTGGGAAATGAGGGAAGAGGG - Intronic
953910416 3:46889929-46889951 GGGTTGGAGGGGCGGGGAGAAGG + Intronic
953924471 3:46975416-46975438 GGGAGGCCCAGGCGGGCAGATGG - Intronic
953964470 3:47292664-47292686 GGGAGGCCAAGGCAGGCAGATGG + Intronic
954248990 3:49353898-49353920 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
954581976 3:51707826-51707848 GGCTTGGAAAGGCTGGGAGAGGG - Intronic
954812555 3:53256993-53257015 GGGAGGCAGAGGAGGGCAGATGG - Intergenic
954884182 3:53857522-53857544 GGGAGGCCAAGGCAGGCAGATGG - Intronic
955064156 3:55520211-55520233 GGGAGGGCAAGGGGGACAGATGG + Intronic
955401722 3:58596436-58596458 GGGAGGCTAAGGTGGGCAGATGG + Intronic
956321338 3:68000026-68000048 GGGAGGCCGAGGCGGGCAGATGG - Intergenic
956632247 3:71328188-71328210 GGGAGGCTGAGGCGGGCAGATGG + Intronic
956733181 3:72215445-72215467 GAGGAGGAAAGGCGGGGAGATGG - Intergenic
956882166 3:73521377-73521399 GGGAGGGGTAGGCGGGCAGATGG + Intronic
956915176 3:73863167-73863189 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
956976509 3:74587165-74587187 GGGTGGGAGGTGGGGGCAGAAGG + Intergenic
957372182 3:79309327-79309349 GGGAGGCCAAGGTGGGCAGAAGG + Intronic
958585598 3:96083088-96083110 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
958720747 3:97839822-97839844 GGGAGGCCAAGGCAGGCAGATGG - Intronic
959049285 3:101509138-101509160 GAGTGGGAAAGGGGTGGAGAGGG - Intronic
959168184 3:102807194-102807216 TGGTGGGAGGGGCGGGGAGAGGG + Intergenic
959583951 3:108008654-108008676 GGGTGACAAAGGCCGGGAGATGG + Intergenic
960224041 3:115148178-115148200 GGGTGGGAAAGCCGGAGGGAGGG + Intergenic
960365238 3:116763041-116763063 GGGAGGCCAAGGCAGGCAGATGG + Intronic
960714324 3:120560264-120560286 GGGAGGCCGAGGCGGGCAGATGG + Intergenic
961099310 3:124185253-124185275 GGGAGGCCAAGACGGGCAGATGG - Intronic
961299178 3:125911242-125911264 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
961346869 3:126268641-126268663 GGCGGGGAAAGGGGGGCAGCAGG + Intergenic
961365326 3:126395805-126395827 GGGTGGGAGAGGCAGGGAGCCGG + Intronic
961367677 3:126410983-126411005 GGCTGGAAAAGGCAGGAAGATGG - Intronic
961562146 3:127738059-127738081 GGGAGGCCAAGGTGGGCAGATGG + Intronic
961861431 3:129919395-129919417 GGGAGGGAAAGGAGGGAAGGAGG + Intergenic
961934823 3:130571920-130571942 GGGAGGCCAAGGGGGGCAGATGG - Intronic
962130551 3:132669506-132669528 GGGAGGGCTAGGTGGGCAGATGG - Intronic
962637564 3:137346642-137346664 GGGAGGCCAAGGTGGGCAGAGGG - Intergenic
962722387 3:138187749-138187771 AGGCGGGATAGACGGGCAGAGGG + Intronic
962855174 3:139338862-139338884 GGCTGGGAGAGGCTGGCAAAAGG - Intronic
963121541 3:141780849-141780871 GAGTTGGAAAGGAGGGGAGAGGG + Intronic
966098989 3:176243084-176243106 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
966713850 3:182996241-182996263 GGGAGGCCGAGGCGGGCAGATGG - Intergenic
966752406 3:183334863-183334885 GGGAGGCTAAGGCGGACAGATGG + Intronic
966797575 3:183730302-183730324 GGGAGGCCAAGGCGGGCAGGGGG - Intronic
966913400 3:184571596-184571618 GGGGGGCACAGGCAGGCAGAGGG - Intronic
966925107 3:184639615-184639637 GGCTGGGAAAGGCAGGGTGAGGG + Intronic
967327941 3:188260791-188260813 GGGAGGCTGAGGCGGGCAGATGG + Intronic
967734032 3:192933458-192933480 GGGCGGCCAAGGCCGGCAGATGG - Intergenic
967849535 3:194071397-194071419 GCGTGGGGAAGGCGGGAAGGCGG - Intergenic
968089761 3:195892759-195892781 GGGTGGGGAAGCCGGGGAGTAGG - Intronic
968267016 3:197370160-197370182 GGGAGGCCAAGGCGGGCAGATGG - Intergenic
968579125 4:1381559-1381581 GGGGAGGCAGGGCGGGCAGATGG - Intronic
968725200 4:2244133-2244155 GGGTGGGAATGCAGGGCTGAGGG + Intergenic
968902058 4:3436497-3436519 GGGCAGGAAGGGCGGGCAGTGGG + Intronic
968937048 4:3617069-3617091 GGGAGGGACAGGAGGGAAGAAGG - Intergenic
968943461 4:3651427-3651449 GCGTGGGCAGGGCAGGCAGAGGG + Intergenic
969036938 4:4262027-4262049 GGGTGGGGATGGAGGGCACAAGG - Intergenic
969244779 4:5925120-5925142 GGGAGGGAGAGGCCAGCAGAGGG + Intronic
969393776 4:6907936-6907958 GTGAGGAAAAGGCAGGCAGAGGG + Intergenic
969432563 4:7164384-7164406 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
969815876 4:9687096-9687118 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
969820873 4:9719336-9719358 GGGTAGAAAAGGCTGGGAGAGGG + Intergenic
970093643 4:12437473-12437495 GGGCAGGAAAGGTGGACAGAGGG + Intergenic
970269340 4:14327150-14327172 GGGAGGCTGAGGCGGGCAGATGG + Intergenic
971407867 4:26339058-26339080 GGGAGGCCAAGGTGGGCAGACGG - Intronic
971759090 4:30741431-30741453 GGGAGGCCAAGGCGGGCAGATGG - Intronic
972127590 4:35789128-35789150 GGGAAGGAAAGGTGGGGAGAGGG + Intergenic
972644976 4:40958986-40959008 GGGTGGGATAGGCAGACAGCTGG - Intronic
972732928 4:41813033-41813055 GGGTGTGGAAGGAAGGCAGAAGG - Intergenic
972786974 4:42335532-42335554 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
973531942 4:51843638-51843660 GGGTGGCACCGGCGGGGAGAGGG + Intronic
974440161 4:61905653-61905675 GGGAGGTCGAGGCGGGCAGATGG + Intronic
974542261 4:63252093-63252115 GGGAGGGAAAGGCAGGTGGATGG - Intergenic
975776178 4:77789709-77789731 GGGAGGCAGAGGTGGGCAGATGG + Intronic
975816327 4:78220926-78220948 GGGAGGCTGAGGCGGGCAGATGG + Intronic
975957539 4:79859269-79859291 GAGTGGGAAAGGAGGTGAGAGGG - Intergenic
976493724 4:85701426-85701448 GGGTGGGAAATGTTGGGAGATGG - Intronic
977257085 4:94753307-94753329 GGGAGGCCGAGGCGGGCAGATGG + Intergenic
977992800 4:103465182-103465204 GGGTGGGAAATGTGGGCTGATGG + Intergenic
978119326 4:105059592-105059614 GGGTGGGAATGGGGAGAAGAGGG + Intergenic
978479044 4:109167619-109167641 GGGAGGGAAAGTGGGGAAGAAGG - Intronic
978787785 4:112629429-112629451 GGGAGGCCAAGGCAGGCAGACGG + Intronic
978795380 4:112703302-112703324 GGGAGGCCAAGGTGGGCAGATGG + Intergenic
979195647 4:117917152-117917174 GGGTGGGGAAGGTGGGTTGAGGG - Intergenic
981099011 4:140810743-140810765 GAGAGGGAAAGGTGGGGAGAGGG - Intergenic
981099019 4:140810767-140810789 GAGAGGGAAAGGTGGGGAGAGGG - Intergenic
981266000 4:142784121-142784143 GGGAGGCTGAGGCGGGCAGATGG + Intronic
981706381 4:147663603-147663625 GGGAGGCAAAGGTGGGCAGATGG - Intronic
982308616 4:153960348-153960370 GGGTGGCAGAGGTGGGGAGATGG + Intergenic
982423484 4:155226616-155226638 GGGTGGGAAAGGAAAGTAGAGGG + Intergenic
983902236 4:173147846-173147868 GGATGGGAAAGGCATGCTGAGGG - Intergenic
984159127 4:176229916-176229938 GGGTGGGAGTGGAGAGCAGAAGG + Intronic
984523011 4:180823642-180823664 GGGAGGGAAAGGGAGGGAGAGGG - Intergenic
985014377 4:185618212-185618234 GGGAGGCCAAGGCAGGCAGATGG - Intronic
985081268 4:186266806-186266828 GGGTGGGGAGAGCGGTCAGATGG + Intronic
985611524 5:892272-892294 GGGAGGGAAAGGCGGGAGAAAGG + Intronic
985790104 5:1921961-1921983 GGGTGGGAAAGCCGAGGAAAAGG - Intergenic
985851149 5:2389818-2389840 GGGTGGGAAGGCAGGGCAGGGGG - Intergenic
985948546 5:3205116-3205138 GGGTGGGAAAGAGGAGCAGGTGG - Intergenic
986445401 5:7816513-7816535 GGAGGGGAAAGGAGGGAAGAAGG + Intronic
986603296 5:9495917-9495939 GGATGGGAGAGGGGAGCAGAGGG - Intronic
986775003 5:11006321-11006343 GGGTGTGAAAGGCTGCCACAAGG - Intronic
986781580 5:11071296-11071318 GGGAGGTTGAGGCGGGCAGATGG + Intronic
986856663 5:11876262-11876284 GGGCAGGAAAGGCGGGGAGAGGG + Intronic
987062694 5:14257565-14257587 GGGTGGGGAAGGGGGACAGACGG + Intronic
987116658 5:14731229-14731251 AGGAGGGAGAGGCGGGCTGAAGG + Intronic
988596241 5:32593929-32593951 GGGAGGCCAAGGCAGGCAGATGG - Intronic
988824672 5:34923515-34923537 GGGAGGCCAAGGCGGGCAGATGG - Intronic
990312032 5:54549369-54549391 AGGTGGGCAAAGTGGGCAGAAGG - Intergenic
990768030 5:59209423-59209445 GGGAGGCCAAGGCAGGCAGATGG - Intronic
990982476 5:61614543-61614565 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
991054466 5:62306404-62306426 GGGCGGAAAAGGCGGGGAGGGGG - Intronic
991662736 5:68967088-68967110 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
992637345 5:78737483-78737505 GGGAGGCCAAGGCAGGCAGATGG + Intronic
993944068 5:94097225-94097247 GGCTGGTAGAGGCTGGCAGACGG - Intronic
994104757 5:95935076-95935098 TGAAGGGAAAGGCAGGCAGAGGG - Intronic
995154812 5:108898515-108898537 GGGAGGGAAAGGAAGGAAGAAGG - Intronic
995510161 5:112901076-112901098 GGGAGGCCGAGGCGGGCAGATGG - Intronic
995578612 5:113570339-113570361 GGGAGGCCAAGGCAGGCAGATGG - Intronic
995903145 5:117093446-117093468 GTCTGGGAAAGGTGGGAAGAGGG - Intergenic
996328139 5:122299310-122299332 GGGAGGCCAAGGCGGGCAAATGG + Intergenic
996592974 5:125168729-125168751 GGGAGGCTGAGGCGGGCAGATGG + Intergenic
996698638 5:126425862-126425884 GGGTGGGGAAGGAGGGAATAGGG + Intronic
996754265 5:126919779-126919801 GGGTGGGAAAGGGAGGCTGCTGG - Intronic
996841611 5:127852853-127852875 GGGAGGCCGAGGCGGGCAGATGG + Intergenic
996994450 5:129678050-129678072 GGGAGGTCAAGGTGGGCAGATGG - Intronic
997102518 5:130984556-130984578 GGCTGGGAAAGGCATGGAGAAGG - Intergenic
998078570 5:139256159-139256181 GGGAGGCCGAGGCGGGCAGATGG - Intronic
998212506 5:140210749-140210771 GGGAGGCCGAGGCGGGCAGATGG - Intronic
998963533 5:147512636-147512658 GGGGGGCCAAGGTGGGCAGATGG - Intergenic
999273770 5:150314615-150314637 TGGTGGCAAAGGCAGGCAGGAGG - Intronic
999474256 5:151883929-151883951 GGGTGGGAAATGGGGGGTGAGGG + Intronic
999762019 5:154709687-154709709 GTGTGGGAAAGAGGCGCAGATGG + Intergenic
1000091113 5:157930391-157930413 GGGTGGCCAAGGCAGGCAGATGG + Intergenic
1000346958 5:160322258-160322280 GGTTGGGAAAAGAGGGAAGAGGG - Intronic
1000357644 5:160416131-160416153 GGGAGGCCAAGGTGGGCAGATGG - Intronic
1000684502 5:164230374-164230396 GGGTGGCCAAGGTGGGCAGATGG + Intergenic
1000849098 5:166318007-166318029 GAGTTGGAAAGGAGGGGAGAGGG - Intergenic
1001651497 5:173319191-173319213 GGGTGGACAAGGTGTGCAGAAGG + Intronic
1001703209 5:173722320-173722342 GGGAGGGAAAGGCAAGCTGAGGG + Intergenic
1002149137 5:177212574-177212596 AGGAGGCAAAGGCTGGCAGATGG - Intronic
1002188615 5:177467661-177467683 GGGTGGGGATGGCGGGAGGATGG - Intronic
1002538128 5:179889436-179889458 AGGTGGGAGAGGCGCACAGAAGG + Intronic
1002587149 5:180256395-180256417 GGGTGGGGCAGGGGGGCAGGGGG + Intronic
1002668653 5:180846782-180846804 GGGTGGGAGAGGATGGCAGCAGG - Intergenic
1003536088 6:6976646-6976668 GGGAGGCCGAGGCGGGCAGATGG + Intergenic
1003578821 6:7321014-7321036 GGATGGGAATGGAGGCCAGACGG + Intronic
1003591316 6:7439349-7439371 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1004215948 6:13704386-13704408 GGGAGGCTAAGGCAGGCAGATGG + Intronic
1004669702 6:17784178-17784200 GGGAGGCAAAGGCAGGAAGATGG + Intronic
1005048961 6:21666344-21666366 GGGCGGGAGATGCGGGGAGAGGG + Intergenic
1005260814 6:24057362-24057384 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1005303279 6:24491457-24491479 AGGAGGCCAAGGCGGGCAGATGG + Intronic
1005666722 6:28064898-28064920 GGGAGGCCAAGGTGGGCAGATGG + Intergenic
1005883042 6:30074805-30074827 GGGAGGGAGCGGCGGGCGGAAGG - Intronic
1005957914 6:30677336-30677358 GGGGGGGAAGGGTGGGCAGAAGG - Intronic
1006034185 6:31198806-31198828 GGGAGGGTGAGGCAGGCAGATGG + Intronic
1006097126 6:31662875-31662897 GGGAGGCAGAGGCGGGCAGATGG + Intronic
1006367139 6:33622250-33622272 GAATGGGAGAGGCGGGGAGAAGG - Intronic
1006373565 6:33659607-33659629 GGGTGGAGAAGGCAGGAAGAGGG - Intronic
1006544936 6:34772765-34772787 GGGAGGGGAGGGCAGGCAGAGGG - Intronic
1006555561 6:34863144-34863166 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1006699412 6:35959683-35959705 GGTTGAGAAAGGCGGGCAGGAGG + Intronic
1006855989 6:37133648-37133670 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1007277878 6:40689046-40689068 GGATGGGAATGGTGGGGAGATGG - Intergenic
1007625183 6:43242484-43242506 GGGAGGCCAAGGTGGGCAGATGG + Intergenic
1007679579 6:43625090-43625112 GGGTTGGAAGGGCTGGCAGGAGG - Intronic
1008315143 6:50030519-50030541 GGGAGGGACTGGCGGGCAGGCGG - Intergenic
1010560775 6:77347176-77347198 GGGAGGCAAAGGTGGGCAGATGG - Intergenic
1011451100 6:87493087-87493109 GGGAGAGAAAGGGGGGAAGAAGG - Intronic
1011469201 6:87690731-87690753 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1011623185 6:89261796-89261818 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1011980802 6:93375374-93375396 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1012641401 6:101621211-101621233 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1012913328 6:105141319-105141341 GGGTGGGAAAACCGGGGAGGTGG - Intergenic
1012957446 6:105586634-105586656 GGGAGGCTGAGGCGGGCAGATGG - Intergenic
1013099463 6:106974831-106974853 GGGCGGGGAAGGCGGGGAGGCGG - Intronic
1013542544 6:111124600-111124622 GGAAGGCCAAGGCGGGCAGATGG - Intronic
1013562347 6:111318369-111318391 GGGAGGTTCAGGCGGGCAGATGG - Intronic
1013576017 6:111483730-111483752 GGGAGGGAAGGGCGGGCGGGCGG + Intergenic
1013658026 6:112265653-112265675 GGGAGGCTGAGGCGGGCAGATGG + Intergenic
1014677013 6:124379207-124379229 GGGAGGGAAAGGAGGGAAGAGGG + Intronic
1014935478 6:127380469-127380491 GGGTGGGAGGGGTGGGCGGATGG - Intergenic
1015561985 6:134525760-134525782 GGGTGGGAAATGCAGGTAAATGG + Intergenic
1015657495 6:135535882-135535904 AGGAGGCAGAGGCGGGCAGATGG - Intergenic
1015774961 6:136804662-136804684 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1015818338 6:137233525-137233547 GGGAGGGCAAGGCAGGCGGATGG - Intergenic
1015823208 6:137284445-137284467 GGCTGGGAAAGGAGGGAAGATGG + Intergenic
1015934021 6:138390410-138390432 GGGAGGCTGAGGCGGGCAGATGG + Intergenic
1016426271 6:143939027-143939049 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1016637363 6:146309157-146309179 GGGAGGCTAAGGTGGGCAGATGG + Intronic
1016946522 6:149539617-149539639 GCGGGGGCAAGGCAGGCAGATGG - Intronic
1017168592 6:151434086-151434108 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1017408697 6:154147075-154147097 AGGTGGGGAAGGGGAGCAGAAGG + Intronic
1017812918 6:157997008-157997030 GGGTGGGGTAGGTGGGGAGACGG - Intronic
1018596302 6:165484836-165484858 GTGTGGGAAAGAGGTGCAGATGG - Intronic
1018678410 6:166242747-166242769 GAAAGAGAAAGGCGGGCAGAAGG - Intergenic
1018766124 6:166934304-166934326 GGGTGGGGAAGGCGGGGACTGGG - Intronic
1019048134 6:169163482-169163504 GGGTGGGAACTGCTGGCCGAGGG + Intergenic
1019266818 7:121710-121732 GGGAGGGAAAGGGGTGGAGAGGG + Intergenic
1019268589 7:133423-133445 GGGTGGGGGATGCGGGGAGAGGG - Intergenic
1019294982 7:269284-269306 TGGTGGGAAAGGCAGGGAGGGGG + Intergenic
1019397133 7:827263-827285 GGGAGGCCAAGGCGGGCAGGAGG - Intronic
1019414118 7:919726-919748 GGGTGGGAGAGACGGGGAGAGGG + Intronic
1019537778 7:1538006-1538028 GGCCGGGACGGGCGGGCAGAAGG - Intronic
1019575611 7:1736259-1736281 GTGTGGGGGAGGCGGGGAGATGG - Intronic
1019715116 7:2534918-2534940 GGGGGGCCAAGGCGGGCAGCTGG + Intergenic
1020171805 7:5850877-5850899 GGGAGGCCAAGGCGGGCAGGAGG - Intergenic
1020262120 7:6536471-6536493 GGCTGGGAAAGGCGGGCATGGGG + Intronic
1021114202 7:16730277-16730299 GGGAGGCAGAGGCAGGCAGATGG + Intergenic
1021979970 7:26044726-26044748 GGGTGGGGAATGCGGGGAGATGG - Intergenic
1022125155 7:27349301-27349323 GGGTTGGAGAGGGGGGCAGCTGG + Intergenic
1022984422 7:35636887-35636909 GGGTGGTCAAGGCAGGCAGATGG + Intronic
1023009916 7:35917472-35917494 GGAGGGGAAAGGAGGGGAGAAGG - Intergenic
1023548641 7:41345141-41345163 AGGTGGGAAAGGGGGGCTCAGGG + Intergenic
1023747368 7:43333755-43333777 GACAGGGAAATGCGGGCAGAGGG + Intronic
1023781928 7:43663869-43663891 GGGCGGCCAAGGCAGGCAGATGG + Intronic
1026155651 7:67823472-67823494 GGGAGGCCAAGGCAGGCAGAGGG - Intergenic
1026187388 7:68092498-68092520 GGGTGGGGAAGTCGGCCAAAAGG - Intergenic
1026571938 7:71538880-71538902 GGGAGGGAAAGAGGGACAGAGGG + Intronic
1026600345 7:71772374-71772396 GGGAGGTTAAGGCGGGAAGATGG + Intergenic
1026989000 7:74572660-74572682 GGGTGGGGAAGGCTGAGAGAGGG - Intronic
1027165257 7:75829723-75829745 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1027165879 7:75834021-75834043 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1027377452 7:77566480-77566502 GGGAGGCTAAGGTGGGCAGATGG + Intronic
1028470820 7:91204707-91204729 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1029159837 7:98543799-98543821 GGCTGGGAAAGGATGGCTGAGGG - Intergenic
1029201430 7:98841863-98841885 CGGGGGGCATGGCGGGCAGAGGG - Intergenic
1029249474 7:99225779-99225801 GGGTGGAAAAGGATGGCAGGTGG - Intergenic
1029700987 7:102246807-102246829 GGGAGGCTGAGGCGGGCAGATGG - Intronic
1029743091 7:102502284-102502306 GGGGGGGAAGGGCGGGAAGGGGG + Intronic
1029761081 7:102601445-102601467 GGGGGGGAAGGGCGGGAAGGGGG + Intronic
1029840614 7:103359235-103359257 GGGAGGCCAAGGTGGGCAGATGG - Intronic
1030166989 7:106565124-106565146 GGGGGGCTGAGGCGGGCAGATGG - Intergenic
1031234916 7:119162763-119162785 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
1031694274 7:124829935-124829957 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1032130036 7:129220401-129220423 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1032425634 7:131820207-131820229 GAGTGGGAGGGGCAGGCAGAGGG - Intergenic
1032707167 7:134431496-134431518 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
1032777895 7:135134075-135134097 GGATGGGAAAGGAGGGAAGCAGG + Intronic
1032849588 7:135782658-135782680 GGATGGGAAAGGAGGGAAGTGGG - Intergenic
1033414034 7:141146791-141146813 GGGTGGGAAAGGATGGTAGAAGG - Intronic
1034158291 7:148973480-148973502 GCGTGGAAAAGGCAGGCAAATGG - Intergenic
1034242156 7:149618859-149618881 GGGTGGCCGAGGCGGGCAGATGG + Intergenic
1034258584 7:149739051-149739073 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1034448764 7:151126444-151126466 GGCTGGGAGAGGCTGGGAGAGGG + Intronic
1034467762 7:151239814-151239836 GGGTGGGAAGGGGAGGGAGAGGG + Intronic
1034545240 7:151784927-151784949 CGGTGGGAAAGCCAGGCGGAGGG + Intronic
1034946047 7:155262697-155262719 GGGAGGCTGAGGCGGGCAGAAGG + Intergenic
1035361795 7:158318254-158318276 GAGTGGGAAAGGGGGGAGGAGGG + Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413834 7:158667512-158667534 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413864 7:158667598-158667620 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413902 7:158667712-158667734 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413975 7:158667917-158667939 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414044 7:158668119-158668141 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414095 7:158668262-158668284 AGGTAGGTAAGGAGGGCAGAGGG - Intronic
1036176098 8:6539824-6539846 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1036222157 8:6929869-6929891 GGCTGGGAAAGGCAGACAAAGGG - Intergenic
1036229040 8:6983886-6983908 GGCTGGGAAAGGCAGACAAAGGG - Intergenic
1036231493 8:7002991-7003013 GGCTGGGAAAGGCAGACAAAGGG - Intronic
1036233954 8:7022085-7022107 GGCTGGGAAAGGCAGACAAAGGG - Intergenic
1036386492 8:8286262-8286284 GGCGGGGAGAGGCTGGCAGAAGG + Intergenic
1036453974 8:8892602-8892624 GGGCGGGCAGGGCGGGCAGCTGG + Exonic
1036505376 8:9350022-9350044 GGGTGGGAGAGGAGAGAAGAGGG + Intergenic
1036912018 8:12765601-12765623 GGGCGAGAGAGGAGGGCAGAAGG - Intergenic
1037812234 8:22093954-22093976 GTGAGGCAAAGGTGGGCAGACGG - Intronic
1037901585 8:22692234-22692256 GTGTGGGGACGGCGGGGAGAAGG - Intronic
1038261253 8:25997329-25997351 GGGAGGCCAAGGCAGGCAGACGG + Intronic
1038404527 8:27311472-27311494 AGGCGGGAACTGCGGGCAGAAGG - Exonic
1038599548 8:28926057-28926079 GGGAGTGCAAGGCAGGCAGATGG + Intronic
1039346200 8:36708321-36708343 ATGTGGGAAAGAGGGGCAGAAGG + Intergenic
1039447286 8:37642971-37642993 GGAAGGCTAAGGCGGGCAGATGG - Intergenic
1039458848 8:37726920-37726942 GGGTGGGAAGGGCAGGGAAAAGG + Intergenic
1039615374 8:38951087-38951109 GGGTGGGAGTGGGGGGCAGCTGG + Intronic
1039771732 8:40694494-40694516 TGTTGGGAAAGCCTGGCAGATGG - Intronic
1040288634 8:46113069-46113091 GGGTGGCATGGGCGGGCAGCAGG - Intergenic
1040315067 8:46256639-46256661 GGGTGGCATGGGCGGGCAGCAGG + Intergenic
1040325856 8:46341151-46341173 GGGTGGCATGGGCGGGCAGCAGG + Intergenic
1040337835 8:46425110-46425132 GGGACGGCAAGGCAGGCAGAGGG + Intergenic
1040340760 8:46439441-46439463 GGGTGGCATAGGCTGGCAGCAGG - Intergenic
1040846477 8:51847385-51847407 GGGAGGCCAAGGCGGGCAGATGG + Intronic
1041089473 8:54288552-54288574 GGGAGGCAAAGGCAGGAAGAGGG + Intergenic
1041688055 8:60662445-60662467 GGGTGGGAAATGGGGACAGTTGG - Intergenic
1041797067 8:61756597-61756619 AGCTGGGAAAGGCTGGCAGCAGG - Intergenic
1041906860 8:63042383-63042405 GGGAGGCCAAGACGGGCAGATGG - Intergenic
1042238493 8:66639222-66639244 GGGAGGCCAAGGCGGACAGATGG - Intronic
1042280195 8:67048034-67048056 GGGAGGCCAAGGTGGGCAGAAGG + Intronic
1042454638 8:68986594-68986616 GGGAGGCTAAGGTGGGCAGATGG + Intergenic
1042617027 8:70660880-70660902 GGGAGGCTAAGGTGGGCAGATGG - Exonic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1044462053 8:92457191-92457213 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
1044789437 8:95832692-95832714 GTGTGGGAGAAGGGGGCAGATGG + Intergenic
1044999675 8:97868959-97868981 GGATGGGGAAGGCGCGGAGAGGG - Intronic
1045112522 8:98948313-98948335 GCGCGGGAAAGGCGGCCACAGGG + Exonic
1045494117 8:102693883-102693905 GTGTGAGCAAGCCGGGCAGAAGG + Intergenic
1045631993 8:104135355-104135377 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1046457853 8:114491181-114491203 GGAGGGGAAAGGAGGGCAGGAGG + Intergenic
1046768735 8:118098000-118098022 GTGTGGGGAAAGCGGGGAGAAGG + Intronic
1047026898 8:120834115-120834137 GGGTGGGGAAGGCGGCCAGGAGG + Intergenic
1047508379 8:125497581-125497603 GTGTGGGAGAGGCAGCCAGAAGG + Intergenic
1047547618 8:125834573-125834595 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
1047602821 8:126443696-126443718 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1047903613 8:129449724-129449746 GGGTGGGAGAGGCAGGGAGTGGG - Intergenic
1048363136 8:133715241-133715263 GGGAGGGAAAGGAGAGAAGACGG - Intergenic
1048947921 8:139467505-139467527 GGGAGGCCGAGGCGGGCAGATGG - Intergenic
1049238461 8:141524590-141524612 GGGTGGGGAGCCCGGGCAGAGGG + Intergenic
1049241858 8:141541856-141541878 TGGTGGGACAGGAGGGCAGAGGG - Intergenic
1049393304 8:142382978-142383000 TGGGGGGAAAGGAGGGCAGGGGG + Intronic
1049541700 8:143211700-143211722 GCGTGGGGGAGGCGGGCCGAGGG + Intergenic
1049578808 8:143401557-143401579 GGAGGGGAAGGGAGGGCAGAGGG + Intergenic
1049586389 8:143434497-143434519 GGGTGGGAACGCTGGGCAGGGGG + Intergenic
1049599033 8:143498688-143498710 GGATGGGAACCGGGGGCAGAGGG + Intronic
1049842627 8:144783058-144783080 GGGAGGCCAAGGCGGGAAGATGG + Intronic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1049968075 9:797350-797372 GGGAGGCTGAGGCGGGCAGATGG + Intergenic
1049996048 9:1035046-1035068 GGGTGCCCAAGGCAGGCAGATGG - Intergenic
1050094646 9:2051437-2051459 GGGTGGGAACCCCGGGGAGATGG - Intronic
1051214101 9:14778369-14778391 GGCTGGCCAAGGCGGGCAGATGG + Intronic
1051421385 9:16892870-16892892 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
1051505984 9:17828310-17828332 AGGTGGGAAAGGAGGGCTGTAGG - Intergenic
1051593500 9:18800135-18800157 GGGAGGCTGAGGCGGGCAGATGG + Intronic
1051691879 9:19722815-19722837 GGCTGGGAAGGACAGGCAGAAGG + Intronic
1051792876 9:20827931-20827953 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1052274614 9:26663341-26663363 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1052475700 9:28956638-28956660 GGGAGGGAAAGAAGGGAAGAAGG - Intergenic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1053692106 9:40591805-40591827 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1053886837 9:42650027-42650049 GGGTGGGGAGGGGGTGCAGAAGG - Intergenic
1054225856 9:62457477-62457499 GGGTGGGGAGGGGGTGCAGAAGG - Intergenic
1054272694 9:63045680-63045702 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1054303364 9:63392771-63392793 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1054402144 9:64719281-64719303 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1054435749 9:65203596-65203618 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1054494644 9:65818091-65818113 GGGAGGCCAAGGCAGGCAGATGG - Intergenic
1055206112 9:73732475-73732497 GGATGGGCAAGGCCGGTAGAGGG + Intergenic
1055295080 9:74825914-74825936 GGGTAGGAATGGCTGGGAGAAGG - Intronic
1055408997 9:76007557-76007579 GGGTGTGAGAGGAGGGTAGATGG + Intronic
1055555884 9:77473215-77473237 GGGAGGCTAAGGCAGGCAGATGG + Intronic
1055611544 9:78030730-78030752 GGGGTGGAAAGGTGGGCAGAGGG - Intronic
1056071889 9:82995683-82995705 GGGTAGTCAAGGCAGGCAGATGG - Intronic
1056136269 9:83632189-83632211 GAGTGGGAATGGCGGGGAGATGG - Intronic
1056381703 9:86062449-86062471 GGGAGAGAAAGGAGGACAGAGGG + Intronic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1057458132 9:95233117-95233139 AGGCGGGAAAGGAGGGGAGATGG + Intronic
1057800891 9:98191198-98191220 GGGCAGGAAAGGCCTGCAGAGGG + Intronic
1057912794 9:99033389-99033411 GGGTGGGAGGGGAGGGGAGATGG + Intronic
1058646544 9:107136217-107136239 AGCTGGAAAAGGCGGGGAGACGG + Intergenic
1059041083 9:110816109-110816131 GGGTGGGAAAAGAGAGTAGAAGG + Intergenic
1059354307 9:113687345-113687367 GGTGGGGAAAGGAGGGAAGAGGG + Intergenic
1059427713 9:114231469-114231491 GAGTGGGAAGGGCGTGCAGCAGG + Intronic
1059743913 9:117181955-117181977 GGGTGGGGAAGGAGGGCACTGGG - Intronic
1059767304 9:117395634-117395656 GGGAGGCAAAGGCTGGGAGAAGG - Intronic
1060091800 9:120749552-120749574 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
1060470415 9:123943463-123943485 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1060569767 9:124627810-124627832 GGGAGGCCAAGGCAGGCAGATGG - Intronic
1060789844 9:126478586-126478608 GGATGGGTAAGCCGGGAAGAGGG + Intronic
1060851052 9:126876183-126876205 GGGGGGGAAAGGAGGGAAGGGGG - Intronic
1060859084 9:126939074-126939096 AAGTGGGAGAGGGGGGCAGAGGG + Intronic
1061113891 9:128596081-128596103 GGGAGGGCAAGCTGGGCAGACGG - Intronic
1061196485 9:129109864-129109886 GGGTGGGGAAGGGGGCTAGAGGG + Intronic
1061279575 9:129589605-129589627 GGGAGGCCAAGGCGCGCAGATGG - Intergenic
1061328837 9:129879847-129879869 GGGTGGGCAAGGCCAGCAGCAGG - Intronic
1061422445 9:130479690-130479712 GGGTGGGAAGAGAGGGCAGTGGG - Intronic
1061437091 9:130570777-130570799 GGGAGGCCGAGGCGGGCAGATGG + Intergenic
1061452922 9:130678317-130678339 GGCAGGGAGAGGGGGGCAGAGGG + Intronic
1061739205 9:132687360-132687382 GGGTGGAACATGCTGGCAGAGGG + Intronic
1062186882 9:135223059-135223081 GGGTGGCAAAGCATGGCAGAAGG + Intergenic
1062408303 9:136408641-136408663 AGGTAGGAAAGTCGGGAAGAGGG - Intronic
1062483616 9:136763584-136763606 GGGCGGGGAGGGCGGGCAGGGGG + Intronic
1062497448 9:136838430-136838452 TGGTGGGAGGGGCTGGCAGATGG - Intronic
1062549598 9:137079889-137079911 GGGTGGGACAGGATGGCAGAAGG - Intronic
1062551783 9:137090984-137091006 GGGTGGTCTAGCCGGGCAGAGGG + Intronic
1203622767 Un_KI270749v1:137942-137964 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1185447549 X:267371-267393 GGGAGGCCAAGGCGGGCGGATGG - Intergenic
1185621734 X:1454084-1454106 GGGTGGGAAGGGCGGGGAGATGG + Intergenic
1186115243 X:6298510-6298532 GGGAGGCCAAGGCAGGCAGAAGG - Intergenic
1186190420 X:7062483-7062505 GGGTGAGAAATGCAGGCAGAGGG + Intronic
1186207219 X:7213456-7213478 CGGTGGGAAAGGCAGGCAGGAGG + Intergenic
1186660040 X:11660319-11660341 GGGAGGGTGAGGCAGGCAGATGG + Intronic
1186751069 X:12621580-12621602 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1186751197 X:12622768-12622790 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1186852661 X:13595957-13595979 GGGAGGGCAAGGCGGGAGGATGG - Intronic
1187238217 X:17488052-17488074 GGGAGGAAAAGGCAGGCAGGTGG - Intronic
1187931080 X:24294154-24294176 TGGAGGTCAAGGCGGGCAGATGG - Intergenic
1188425832 X:30045667-30045689 GGGAGGCAAAGGCGGGTGGATGG - Intergenic
1189286105 X:39853600-39853622 GGGTGGGGAAGGAGAGGAGAAGG + Intergenic
1189328283 X:40126613-40126635 GGGAGGCCAAGGTGGGCAGATGG + Intronic
1189377100 X:40474652-40474674 GGGCGGGGGGGGCGGGCAGAGGG + Intergenic
1190201797 X:48368126-48368148 GGGAGGCCAAGGCGGGCAGATGG - Intergenic
1190208742 X:48427285-48427307 GGGAGGCCAAGGCGGGCAGATGG + Intergenic
1190220994 X:48512224-48512246 TGGTAGGAAAAGCGGGCACAAGG - Intronic
1190664810 X:52687132-52687154 GGGGAGGAAAGGGGGGGAGAAGG + Intronic
1190668642 X:52718742-52718764 GGGAGGCCAAGGCGGACAGATGG - Intergenic
1190670775 X:52739662-52739684 GGGAGGCCAAGGCGGACAGATGG + Intergenic
1190674612 X:52771287-52771309 GGGGAGGAAAGGGGGGGAGAAGG - Intronic
1190859539 X:54330703-54330725 GGGAGGCCAAGGCAGGCAGATGG + Intronic
1190874091 X:54447370-54447392 GGGTGGCAAAGGATGGCACAAGG - Exonic
1190879046 X:54479679-54479701 GGGTGGGGAAAGGGAGCAGAGGG + Intronic
1191178581 X:57534812-57534834 GGCTGGGAGAGGTGGACAGATGG - Intergenic
1191807919 X:65155195-65155217 GGGAGGCCAAGGTGGGCAGATGG - Intergenic
1192274534 X:69616103-69616125 GGGTGGGAAAGGGAGGAGGAGGG - Exonic
1192318084 X:70067281-70067303 GGCTGGGAAAGGCCAGCAAAGGG + Intergenic
1192486772 X:71534022-71534044 GGGTGGGAAATCCAGGCTGAGGG - Intronic
1192497297 X:71624375-71624397 GGGAGGCTGAGGCGGGCAGATGG - Intergenic
1193018817 X:76767701-76767723 GGGAGGGTAAGGTGGGGAGATGG - Intergenic
1193806388 X:86000841-86000863 GGGAAGGAAAGGGGAGCAGAGGG + Intronic
1194861202 X:99000910-99000932 GGGAGGTCAAGGCAGGCAGATGG - Intergenic
1195063303 X:101217260-101217282 GGGTGGGAAAGGGGAGAAGGTGG - Intergenic
1195212149 X:102660415-102660437 GGGTGGGAGAGGTGGGCATATGG + Intergenic
1195218191 X:102721188-102721210 GGGTGGGGGAGGTGGGCATATGG + Intronic
1195779594 X:108447111-108447133 GGGTGGGGAAAGTGGTCAGAAGG - Intronic
1195903666 X:109823543-109823565 GGGGGAGAAAGGCAGACAGAAGG + Intergenic
1196929279 X:120664994-120665016 GGGAGGCCGAGGCGGGCAGACGG - Intergenic
1197033886 X:121851962-121851984 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
1197427457 X:126315063-126315085 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1197575668 X:128208127-128208149 AGGTGGGAAAGACGTGCAGCGGG - Intergenic
1197614892 X:128680012-128680034 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1198019621 X:132645070-132645092 GTGGGGGAAAGGCTGGAAGAAGG - Intronic
1198373639 X:136015989-136016011 GGATGGGGCAGGCGGGCAGCAGG + Intronic
1198381434 X:136087454-136087476 GGGAGGCCAAGGCGGGAAGATGG - Intergenic
1198683190 X:139203525-139203547 TGGTGGGAAAGGAGGGGGGAGGG + Intronic
1200079105 X:153566765-153566787 CAGTGGCACAGGCGGGCAGAGGG - Intronic
1200089124 X:153626201-153626223 GGGTGGGCAAGGCTGGGACATGG - Intergenic
1201146246 Y:11066963-11066985 GGGAGGGAGAGGGAGGCAGAGGG + Intergenic
1201190725 Y:11440335-11440357 GGGAGGCCAAGGCAGGCAGATGG + Intergenic
1201739668 Y:17310520-17310542 GGGTGGCCAAGGCTTGCAGATGG + Intergenic