ID: 923149065

View in Genome Browser
Species Human (GRCh38)
Location 1:231217791-231217813
Sequence GCTGCTCCCTCAAAGGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923149065_923149075 13 Left 923149065 1:231217791-231217813 CCTAACCCCTTTGAGGGAGCAGC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 923149075 1:231217827-231217849 GAGAAGTGGAAAGTGCAGGAGGG 0: 1
1: 1
2: 7
3: 89
4: 714
923149065_923149073 9 Left 923149065 1:231217791-231217813 CCTAACCCCTTTGAGGGAGCAGC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 923149073 1:231217823-231217845 AGGAGAGAAGTGGAAAGTGCAGG 0: 1
1: 0
2: 6
3: 65
4: 648
923149065_923149074 12 Left 923149065 1:231217791-231217813 CCTAACCCCTTTGAGGGAGCAGC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 923149074 1:231217826-231217848 AGAGAAGTGGAAAGTGCAGGAGG 0: 1
1: 0
2: 8
3: 101
4: 743
923149065_923149071 -1 Left 923149065 1:231217791-231217813 CCTAACCCCTTTGAGGGAGCAGC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 923149071 1:231217813-231217835 CATCCAGGTCAGGAGAGAAGTGG 0: 1
1: 0
2: 4
3: 62
4: 506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923149065 Original CRISPR GCTGCTCCCTCAAAGGGGTT AGG (reversed) Intronic
901008785 1:6186094-6186116 GTTGCTGCCATAAAGGGGTTTGG - Exonic
901697398 1:11018751-11018773 ACTGGTCATTCAAAGGGGTTTGG + Exonic
902835726 1:19045479-19045501 TCTGCTCCCTCAGAGCGGTTTGG + Intergenic
902963280 1:19979650-19979672 GCTGCTCCCTCTGGGAGGTTGGG + Exonic
903071660 1:20729810-20729832 GCTGCTCACTGAAAGTGGATCGG - Intronic
903275672 1:22219853-22219875 CCTCCTCCACCAAAGGGGTTGGG - Intergenic
904852599 1:33470125-33470147 GACTCTCCCTCAAAGGGTTTTGG + Intergenic
905434296 1:37946391-37946413 GGAGCTGCCTCAGAGGGGTTGGG + Intronic
905792075 1:40795109-40795131 GCTGGTGCCTCAGAGAGGTTGGG - Intronic
908139642 1:61170821-61170843 GGTGCACCCACAAAGGTGTTTGG + Intronic
911094460 1:94044374-94044396 GCTCCTCCCTCAGAAGGGTGAGG - Intronic
911164891 1:94715657-94715679 CCTGCTCCCTCAGAGGCCTTTGG - Intergenic
912730060 1:112094317-112094339 GCTGCTTGGTGAAAGGGGTTTGG + Intergenic
914680503 1:149935422-149935444 GTTGCCCCCTAGAAGGGGTTGGG - Intronic
915081773 1:153357538-153357560 GCTTCAACCTCAAAGGGGATGGG + Intergenic
918174439 1:182030237-182030259 GCTTCTACCTCAAAGGCTTTAGG + Intergenic
919534480 1:198769955-198769977 TCTGCTCTCTAAATGGGGTTTGG - Intergenic
919740066 1:200975836-200975858 GCTGCTCCTTCTAAGGGACTGGG + Intronic
922466081 1:225846191-225846213 TCTGCTCCCTCCAAGGTGTGGGG - Exonic
923149065 1:231217791-231217813 GCTGCTCCCTCAAAGGGGTTAGG - Intronic
923944189 1:238864493-238864515 GCATGTCCCTCAAAGGGGTCAGG - Intergenic
1062783232 10:236478-236500 GATGTTCCCTCAAAGGACTTAGG + Intronic
1063962035 10:11314676-11314698 GCTGCTCCCTCTCTGGGCTTGGG + Intronic
1067521405 10:47009397-47009419 GCAGCTGCCTCAAGGGGGTGAGG + Intergenic
1067525589 10:47036427-47036449 GCTGCTCCTTGAGAGGGGTGTGG + Intergenic
1068726830 10:60312463-60312485 GTTCCTACCTTAAAGGGGTTTGG + Intronic
1069074941 10:64029410-64029432 GCTGCTGCTTCAAAGGAGTATGG + Intergenic
1069479059 10:68764008-68764030 TCTGTTCACTGAAAGGGGTTGGG - Intronic
1072041107 10:91607863-91607885 GCAGCTCACTCAGAGGGGCTGGG + Intergenic
1075817131 10:125273085-125273107 GCTGCTGCCTCAGAGGGCTTGGG - Intergenic
1076292728 10:129360240-129360262 CCTGACCCCTCACAGGGGTTCGG - Intergenic
1076774707 10:132688267-132688289 GCTGCTCCCTCAGAGGCGCAGGG - Intronic
1077198069 11:1291449-1291471 GCCGTTCCCTCAGAGGGGGTCGG - Intronic
1078406411 11:11073969-11073991 GCTGCTGCCTCACATGGGTGAGG + Intergenic
1079350570 11:19688382-19688404 GCTTCTCACTCAGTGGGGTTAGG - Intronic
1086021319 11:82233405-82233427 GCTCCTTCCTCACAGTGGTTTGG + Intergenic
1090386693 11:126361475-126361497 GCTGCCCCCTCACATGGCTTGGG + Intronic
1096195879 12:49648505-49648527 GCTGATCCCTCACAGGGGGAGGG + Intronic
1096775798 12:53963342-53963364 AATGCTTCCCCAAAGGGGTTGGG - Intergenic
1101521796 12:105490536-105490558 GGTGCTCACTCAAAGCGTTTTGG - Intergenic
1103826848 12:123745758-123745780 GCTGAGCCCTCGAAGGGGTTGGG - Intronic
1105713077 13:23031923-23031945 GCTGCTCCCTCTGAAGGCTTTGG - Intergenic
1113595674 13:111530211-111530233 GCTGCTGCCTCACCGGGGGTGGG + Intergenic
1114215903 14:20657690-20657712 GCTCCGCCCTGAAAGGGGTGTGG - Intergenic
1118261922 14:64255661-64255683 CCTACTCCCTCAAAGGGGGCAGG + Intronic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1129229095 15:74186797-74186819 GCTGTTCACTCAAAGAGGCTGGG + Intronic
1131526966 15:93160194-93160216 GCTGGTCCCACCTAGGGGTTGGG - Intergenic
1132729167 16:1352146-1352168 GCTGCTCACCCAAACGCGTTGGG - Exonic
1134261525 16:12654912-12654934 GCTGGTCCCTGAAAGAAGTTTGG + Intergenic
1135934337 16:26766943-26766965 GCTGCTTCCTCAAAGGAGGAGGG - Intergenic
1137543186 16:49378455-49378477 CCTGCTCCCTCCAAGGCCTTAGG + Exonic
1140600450 16:76469451-76469473 GCTGCTCCCCATCAGGGGTTGGG - Intronic
1141809756 16:86367998-86368020 GATGCTGCTTCAAAGGGGCTCGG + Intergenic
1143451061 17:7036932-7036954 CCTGCTCCTTCCAAAGGGTTCGG + Intronic
1144335190 17:14262296-14262318 GCTACTCCGTCCATGGGGTTTGG + Intergenic
1147957958 17:44147999-44148021 ACTGCTCCCTCAGAGGCTTTGGG + Exonic
1157790897 18:50529970-50529992 ACTGCTCCCACAGAGGGGGTGGG - Intergenic
1162284662 19:9729275-9729297 GCTGCTCTCTCAGGGGTGTTTGG + Intergenic
1164644135 19:29845428-29845450 GCTGCTGCCTCCAGGGGCTTAGG + Intergenic
1168322900 19:55521042-55521064 GTTTCTCCCTCAAAGGGCTGTGG - Intergenic
926678306 2:15645269-15645291 GATGGTCCCTGAAAGGGATTTGG + Intergenic
929854913 2:45628705-45628727 TCAGCTCCCTAATAGGGGTTAGG - Intergenic
929924455 2:46197046-46197068 GTTGCTCCCTCTAAGGGCTCTGG + Intergenic
934588697 2:95527337-95527359 GATGCTCCCAGAAAGGGGCTGGG + Intergenic
936241721 2:110793559-110793581 GCTGCTCCCTGATTGGAGTTTGG + Intronic
936461953 2:112720917-112720939 ACTCCTCCCTCAAAGGGGCTCGG + Intergenic
938983192 2:136546237-136546259 GCCCCTCCCTCTGAGGGGTTTGG - Intergenic
939376889 2:141380251-141380273 GCTTTTCCCTGGAAGGGGTTTGG + Intronic
939619619 2:144402435-144402457 GCTGGTCCCTCAATGGCGCTCGG - Intronic
945512119 2:210715375-210715397 GCTTCTTCCTCCAAGGGGTTGGG + Intergenic
946708078 2:222478536-222478558 GCTGCTTCTTCAAAGGGGTAGGG + Intronic
1169970218 20:11261778-11261800 ACTGATCCCCCAAGGGGGTTTGG - Intergenic
1173888201 20:46480313-46480335 GCTTGTCCCAGAAAGGGGTTGGG - Intergenic
1176547307 21:8207528-8207550 GCTTCCCCCTCGACGGGGTTGGG + Intergenic
1176555212 21:8251737-8251759 GCTTCCCCCTCGACGGGGTTGGG + Intergenic
1176566258 21:8390575-8390597 GCTTCCCCCTCGACGGGGTTGGG + Intergenic
1176574132 21:8434761-8434783 GCTTCCCCCTCGACGGGGTTGGG + Intergenic
1177355226 21:19998587-19998609 GCTGCTCCCTCAGGGGTGTTTGG + Intergenic
1182127624 22:27827702-27827724 GCTGCTTCCTCAACGGTGGTGGG - Intergenic
1184422368 22:44389504-44389526 GCAGCTCCCTGGCAGGGGTTTGG + Intergenic
1184932809 22:47693643-47693665 GCAGCCCCCGCAAAGGGGCTGGG - Intergenic
1203252180 22_KI270733v1_random:123813-123835 GCTTCCCCCTCGACGGGGTTGGG + Intergenic
1203260234 22_KI270733v1_random:168897-168919 GCTTCCCCCTCGACGGGGTTGGG + Intergenic
967548059 3:190755750-190755772 GCTGCTCAATCAAAGTGTTTTGG + Intergenic
967721395 3:192819960-192819982 GGTGCTCCCTACAAGGGGGTAGG + Intronic
967856869 3:194124637-194124659 GCTGCTGAATCAAAGGGGGTGGG - Intergenic
968730768 4:2268268-2268290 GCTGCTCCCTCGAGGGGCTGTGG + Intergenic
970217836 4:13778299-13778321 GGTGCTCACTCAACTGGGTTTGG + Intergenic
974595352 4:64007776-64007798 TCTGCTTCCTCATAGGAGTTTGG + Intergenic
977355411 4:95940147-95940169 GCTTCTCCCTCACTGGGATTGGG - Intergenic
978261083 4:106760258-106760280 TCTGCTTCCTTAAAGAGGTTGGG - Intergenic
982056809 4:151558735-151558757 GAGGCTCCCTGAAAGGGTTTTGG + Intronic
991034124 5:62110447-62110469 GCTGCTCCCTAATAGGGGCAGGG + Intergenic
991389415 5:66126178-66126200 GCTTGTCCCTCTCAGGGGTTAGG - Intergenic
995650055 5:114361002-114361024 GCGGCTCGCTCAAAGGTGTGGGG - Exonic
997664935 5:135623112-135623134 GCTGCTCCAGCAAAGGGGGATGG + Intergenic
999051482 5:148528403-148528425 GCTGCTGCCTCAAAGGTGCCAGG - Intronic
1002426087 5:179176765-179176787 GCGTCTCCCGCCAAGGGGTTTGG - Intronic
1004304990 6:14492521-14492543 CCTGCTTCCTCAAAGCTGTTTGG + Intergenic
1007736861 6:43987351-43987373 CCTGCTCCCTCTAAAGGATTTGG - Intergenic
1011193312 6:84757020-84757042 ACTGCTGCCTCAGAGTGGTTTGG - Intronic
1013079347 6:106799072-106799094 TCTGCTCCTTCAAAGGAGTGAGG + Intergenic
1013796939 6:113898747-113898769 GTTGCTCCTTAAAAGGGCTTTGG - Intergenic
1014530888 6:122557865-122557887 GCTCCTCCCTCAATTGGGTAAGG + Intronic
1015462033 6:133502507-133502529 GCAGCTCCCTCACAGCAGTTTGG + Intronic
1021267449 7:18542229-18542251 GCTTCTCCTACAGAGGGGTTAGG + Intronic
1022490295 7:30812575-30812597 GCTGCTCCCTCAGCGTGTTTTGG - Intronic
1025294955 7:57769757-57769779 GCTGCTCTTTCAAAGGGGGAGGG + Intergenic
1027435891 7:78164023-78164045 GCTGCTCCTTCAACTGGGTATGG + Intronic
1029078667 7:97955330-97955352 GCTGCTCTCTCAGGGGCGTTTGG + Intergenic
1029274237 7:99394607-99394629 GCTGCTCCCTCAAAAAGGGAGGG + Exonic
1030062540 7:105634324-105634346 TCTGCTTCCTCAAAGTGGTAAGG - Intronic
1030552706 7:110984031-110984053 GATTCTCTCTCAAAGGGATTTGG + Intronic
1033341108 7:140492988-140493010 CCTTCTCCCTCAAAAGGGTTAGG + Intergenic
1033665625 7:143437935-143437957 GCTGCTGGCTCACAGGGCTTTGG + Intergenic
1041320537 8:56607811-56607833 TCTGCTCCCTGTAGGGGGTTGGG - Intergenic
1041915804 8:63137678-63137700 ACTGGTCATTCAAAGGGGTTTGG - Intergenic
1047959279 8:129999205-129999227 GCTGCTCTCTCAGAGGAGTGTGG - Intronic
1049996508 9:1040228-1040250 ATTACTCCCTCAAAGGGTTTAGG - Intergenic
1056445773 9:86665188-86665210 GCTGAGCCCTCAAAGGATTTCGG + Intergenic
1059329188 9:113524354-113524376 GCTCCTCCCTCAAATGTGATGGG - Intronic
1061043696 9:128153335-128153357 CCAGCTCCCTCAATGGTGTTCGG - Intronic
1061484094 9:130911698-130911720 GCTGCTCCCTGAATGGGTTTGGG - Intronic
1062071173 9:134555772-134555794 GCTCCTCCCTGAAAGGAGTCTGG + Intergenic
1062141102 9:134959586-134959608 GCTGGTGCCTCATAGGGGTTGGG - Intergenic
1203468583 Un_GL000220v1:106963-106985 GCTTCCCCCTCGACGGGGTTGGG + Intergenic
1203476404 Un_GL000220v1:150935-150957 GCTTCCCCCTCGACGGGGTTGGG + Intergenic
1189349907 X:40268322-40268344 GCTGCTTCCTCATAGGGGCTTGG - Intergenic
1191607608 X:63079502-63079524 GCTGCTCCCTGAAATGGGATGGG + Intergenic
1193069727 X:77295154-77295176 GCTGCTCCCTCAGGGGTATTTGG - Intergenic
1196025158 X:111034222-111034244 GAAGCTCCCTCAGAGGGGTTGGG + Intronic
1198312442 X:135435608-135435630 GCTGCTCCCTCAGAGAGGCCTGG - Intergenic
1201891642 Y:18949115-18949137 TCGGTTACCTCAAAGGGGTTGGG - Intergenic