ID: 923149672

View in Genome Browser
Species Human (GRCh38)
Location 1:231221741-231221763
Sequence GTAATCACCCTGAGATTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923149672_923149674 -1 Left 923149672 1:231221741-231221763 CCAGGAAATCTCAGGGTGATTAC 0: 1
1: 0
2: 1
3: 8
4: 82
Right 923149674 1:231221763-231221785 CATATGACTCTAAACTAGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 82
923149672_923149675 0 Left 923149672 1:231221741-231221763 CCAGGAAATCTCAGGGTGATTAC 0: 1
1: 0
2: 1
3: 8
4: 82
Right 923149675 1:231221764-231221786 ATATGACTCTAAACTAGGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 128
923149672_923149676 8 Left 923149672 1:231221741-231221763 CCAGGAAATCTCAGGGTGATTAC 0: 1
1: 0
2: 1
3: 8
4: 82
Right 923149676 1:231221772-231221794 CTAAACTAGGCTGGGTGCTGTGG 0: 1
1: 4
2: 44
3: 441
4: 3119
923149672_923149673 -5 Left 923149672 1:231221741-231221763 CCAGGAAATCTCAGGGTGATTAC 0: 1
1: 0
2: 1
3: 8
4: 82
Right 923149673 1:231221759-231221781 ATTACATATGACTCTAAACTAGG 0: 1
1: 0
2: 2
3: 12
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923149672 Original CRISPR GTAATCACCCTGAGATTTCC TGG (reversed) Intergenic
900923987 1:5691710-5691732 CTAAGCACCCTAAGATTCCCAGG - Intergenic
901648966 1:10732564-10732586 GTAATTCCCCTCAGATATCCTGG - Intronic
904264801 1:29312046-29312068 CTAATCACACGGAGCTTTCCAGG - Intronic
906713165 1:47947804-47947826 GTAATCACCCTGTGAGCTGCGGG - Intronic
912234173 1:107830746-107830768 GTTGTCACCCTGTGATTGCCTGG - Intronic
923149672 1:231221741-231221763 GTAATCACCCTGAGATTTCCTGG - Intergenic
923298479 1:232618131-232618153 GTGATTACACTGAGATTTACTGG + Intergenic
923805072 1:237248463-237248485 GTCATCACCCAGAGATTCCCAGG + Intronic
1063786257 10:9387390-9387412 CTATTCACCCTGACATTTCATGG + Intergenic
1064471761 10:15642491-15642513 TTAATCACCCTGACATTTTTGGG + Intronic
1065054630 10:21831970-21831992 ATAGTCATCCTGTGATTTCCAGG + Intronic
1069105950 10:64383552-64383574 GCAATCCCCCTAAGCTTTCCTGG - Intergenic
1083777190 11:64899828-64899850 GGAAGCATCCTGACATTTCCAGG - Intronic
1090553908 11:127853152-127853174 GCAAGAAGCCTGAGATTTCCAGG + Intergenic
1090562066 11:127943081-127943103 GTCATCAGCCTGAGATTCCCAGG - Intergenic
1092181910 12:6451967-6451989 GAAATCACCAGGGGATTTCCGGG + Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1103518133 12:121520693-121520715 GAAAGCACCGTGAGATTTCAGGG - Intronic
1112950188 13:104985492-104985514 GCTATTACCCAGAGATTTCCAGG + Intergenic
1115487507 14:33926230-33926252 GAAAACAAACTGAGATTTCCTGG + Intronic
1117761325 14:59031751-59031773 TCAATCATCCTGAGACTTCCGGG + Intergenic
1121697287 14:95924206-95924228 TGAATCACCATGAGATCTCCTGG - Intergenic
1122852834 14:104546199-104546221 GGAATCACCCTGGGATGGCCTGG + Intronic
1122906926 14:104805889-104805911 GTAAACAGCTTGAGGTTTCCTGG - Intergenic
1126594714 15:50373832-50373854 GAAATCACTCTGGGTTTTCCAGG + Intergenic
1127766146 15:62187136-62187158 GTGATCTCCCCCAGATTTCCAGG - Intergenic
1128233391 15:66050844-66050866 GCACTCACCCTGGGATTGCCGGG + Intronic
1132787367 16:1665139-1665161 GTAAGGACCCTGAGCTTTTCTGG + Intronic
1133210422 16:4260546-4260568 GCAATCACCTTGAGCTTTTCCGG + Exonic
1134260947 16:12650393-12650415 GAAATCACCCAGTGATTTCCTGG - Intergenic
1139236172 16:65341732-65341754 TTAATCACTCTGAGCTTTACTGG - Intergenic
1141215769 16:82021558-82021580 GTAATCACCTGGAGTTATCCTGG - Intergenic
1148196506 17:45717024-45717046 GCAGTCTCCCTGAGCTTTCCTGG - Intergenic
1151177643 17:72301858-72301880 GTTGTCACCCTGAGAGTTCTGGG + Intergenic
1159026303 18:63184885-63184907 GAAACGACCCTGAGTTTTCCAGG + Intronic
1159147805 18:64477560-64477582 GTACTCACCTTGAGTCTTCCTGG + Intergenic
1164610596 19:29628996-29629018 GAAATCACCCTGAGAATCTCAGG + Intergenic
926373012 2:12199234-12199256 GTTAACACCCTCAGAATTCCAGG - Intergenic
932663611 2:73678805-73678827 GGAATCTCCATGAGATTTCCAGG - Intergenic
934904443 2:98186571-98186593 GGAATGACCCTGAGGTTTTCAGG - Intronic
935555327 2:104503388-104503410 GTGATCGTCCTGAGGTTTCCTGG + Intergenic
938244338 2:129765479-129765501 GGCATCACCCTGGGCTTTCCTGG + Intergenic
938792830 2:134691990-134692012 GTGATGACCCTGAGTTATCCAGG + Intronic
940541857 2:155030396-155030418 ATAATCTCCCTGATATTTGCTGG + Intergenic
940872898 2:158874514-158874536 GTAATAACTCTGAGATTTTTGGG + Intergenic
942900215 2:181107465-181107487 GAAATCACTCTGAAATTTCCAGG + Intergenic
947387124 2:229601772-229601794 GCAATTACCTTGAGATTTCAAGG - Intronic
948724383 2:239922786-239922808 GTAAGCACCCTAAGAATCCCCGG + Intronic
1176268672 20:64224014-64224036 GCAAGCACCCAGAGGTTTCCAGG + Intronic
952755395 3:36861318-36861340 GTAATGACCTTGAGACTTCATGG + Intronic
958851426 3:99330571-99330593 GAAATCACCATGTGCTTTCCAGG - Intergenic
959981759 3:112525319-112525341 GTAATAATTCTGAGATTTCTGGG - Intergenic
961614275 3:128166605-128166627 GTCATCTTCCTGAGATGTCCTGG + Intronic
964704586 3:159604275-159604297 ATAAGCAGCCTGAGAATTCCAGG + Intronic
966568800 3:181416168-181416190 TTAAACACACTGAGATTTCTTGG - Intergenic
969653747 4:8484029-8484051 GTTATTTCCTTGAGATTTCCAGG + Intronic
970600697 4:17639159-17639181 CCAATGACCCTGGGATTTCCTGG - Intronic
971633691 4:29029543-29029565 GTAATCACGATGAGGTTTCCGGG + Intergenic
972002256 4:34053184-34053206 GTAATCACTGTGAGTATTCCTGG + Intergenic
972264194 4:37443330-37443352 GTAGTCATCGTGAGATTTCTAGG + Exonic
975080986 4:70280495-70280517 GTACCCACTCTGAGATTTGCTGG + Intergenic
975355084 4:73393013-73393035 GTAATTACCTAGAGATTTTCTGG - Intergenic
978971929 4:114818892-114818914 GTAAAAACTCTGTGATTTCCAGG + Intergenic
980780462 4:137485490-137485512 GGAATCACCCTGATAATTTCTGG + Intergenic
983371749 4:166868561-166868583 GTCATCCTCCTGAGATTACCTGG - Intronic
986521234 5:8620378-8620400 GCATTTTCCCTGAGATTTCCTGG - Intergenic
993854552 5:93057130-93057152 GCAGACACCCTGAGATTTTCAGG + Intergenic
995950366 5:117705356-117705378 CTAAACTGCCTGAGATTTCCTGG + Intergenic
996013946 5:118510238-118510260 GTAATTATCCTGAGAGTCCCAGG + Intergenic
996236680 5:121139486-121139508 GTAATTACCCTGAGATTGAATGG - Intergenic
1008081286 6:47196923-47196945 TCAATCATCCTGAGAGTTCCTGG - Intergenic
1008469386 6:51866161-51866183 GGAAGCACGCTGAGACTTCCAGG + Intronic
1008645046 6:53505136-53505158 GTAATCAACCTGGGATTTTGTGG + Intronic
1013793362 6:113859185-113859207 GTGATCCCCCTGGGAATTCCTGG + Intronic
1021674611 7:23067739-23067761 GTCTTCACCTCGAGATTTCCTGG + Intergenic
1023639954 7:42247472-42247494 GTAAACATCCTGAGATCTCAGGG + Intergenic
1024184451 7:46935780-46935802 GTATTCACACTTATATTTCCTGG + Intergenic
1025721822 7:64023372-64023394 GTATTCACCCTGAGATATTCAGG - Intergenic
1032962232 7:137049530-137049552 GTAATCATCCTAAAACTTCCAGG - Intergenic
1033537559 7:142326087-142326109 GTCCTCACCCTAAGATTTCCAGG - Intergenic
1033563247 7:142554176-142554198 ATATTCACCCTGATATTTTCAGG + Intergenic
1041524585 8:58790957-58790979 GTATTCACACTGCTATTTCCTGG - Intergenic
1047324203 8:123820764-123820786 GTAAGCACCGAGAGATTTCATGG + Intergenic
1049390206 8:142363794-142363816 GTCTTCACCCTGAGATCTCTGGG - Intronic
1059044497 9:110851024-110851046 GGGAGCACTCTGAGATTTCCTGG - Intergenic
1186008081 X:5096498-5096520 GTACTCACCCTGAGATTCCCTGG - Intergenic
1190832303 X:54070125-54070147 GTAATGAACCTTAGTTTTCCTGG + Exonic
1191224717 X:58031194-58031216 GTAGTGGCTCTGAGATTTCCTGG - Intergenic
1191731741 X:64343655-64343677 TTAACCACCCTGAGCTCTCCAGG + Exonic
1202231367 Y:22662530-22662552 GTCATCACCCTGAGAAGTCAGGG - Intergenic
1202311791 Y:23533635-23533657 GTCATCACCCTGAGAAGTCAGGG + Intergenic
1202559011 Y:26136959-26136981 GTCATCACCCTGAGAAGTCAGGG - Intergenic