ID: 923151659

View in Genome Browser
Species Human (GRCh38)
Location 1:231238933-231238955
Sequence CTATTGTTCTTTAGGGAAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923151653_923151659 -6 Left 923151653 1:231238916-231238938 CCACTTCTACTTGTTCCCTATTG 0: 1
1: 0
2: 2
3: 26
4: 233
Right 923151659 1:231238933-231238955 CTATTGTTCTTTAGGGAAGAGGG 0: 1
1: 0
2: 2
3: 14
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923151659 Original CRISPR CTATTGTTCTTTAGGGAAGA GGG Exonic
901268281 1:7929624-7929646 CTTTTGTTATTTAAGGAATATGG - Intronic
902159839 1:14520938-14520960 GCATTGTTCTATTGGGAAGAAGG + Intergenic
902929789 1:19722925-19722947 CTATTGCTCCTATGGGAAGAGGG + Intronic
906417144 1:45629249-45629271 CTCTTGGTCTTTAAGGAAGCAGG - Intronic
906539399 1:46573524-46573546 CTACTGTTTTTTAGGGGGGATGG + Intronic
908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG + Intergenic
908663203 1:66460937-66460959 CTTTTGTTCCTTAGGGTAGAAGG + Intergenic
908692909 1:66802913-66802935 CTGTTCTTCTGTAGGGAAGCTGG + Intergenic
911044542 1:93617623-93617645 GCATTGATCTTTAGGGGAGAGGG - Intronic
912657434 1:111499662-111499684 TTATTCTTCTATTGGGAAGAAGG + Intronic
912865792 1:113255160-113255182 CTTTTCTTCTTTAGTGGAGAGGG + Intergenic
913091696 1:115480461-115480483 CTATTCTTCCTTAGGGGACAGGG + Intergenic
914844395 1:151273791-151273813 TTCTTGTTCTTTAGGGGCGAGGG + Intergenic
915287757 1:154863702-154863724 TTATTGTGCTTTTAGGAAGAGGG - Intronic
915322471 1:155063280-155063302 CTAAGGCTCTTTAGGGAAGGTGG + Intergenic
915721633 1:157990199-157990221 CAATTAATCTTTAGGGATGAGGG + Intergenic
916414892 1:164583367-164583389 CCATTCTTTTTTAGGGAAGAGGG + Intronic
918210235 1:182343912-182343934 CTGGTGTTCTTAAAGGAAGAGGG + Intergenic
920204385 1:204281173-204281195 CTGTTGTTTTTTAGTGACGAGGG - Intronic
920532977 1:206717997-206718019 GTTTTGTTTTTTAGGGAAGAGGG - Intronic
923151659 1:231238933-231238955 CTATTGTTCTTTAGGGAAGAGGG + Exonic
923379290 1:233398920-233398942 ATATTTTTCTCTAGGGGAGAAGG - Intergenic
924019802 1:239769140-239769162 CAATTGTTCTATAGGGAAAGTGG + Intronic
924208915 1:241744581-241744603 CTTTCGTTCTTTAGGGTAGAAGG + Intronic
924939760 1:248804869-248804891 CTGCTGTGGTTTAGGGAAGAAGG - Intergenic
1065240806 10:23702204-23702226 GTACAGTTCTTTAGGGAAGAGGG + Intronic
1068897244 10:62219437-62219459 ATAATGTTCTTTATGGCAGAGGG - Intronic
1068897494 10:62223080-62223102 CTTTTCTCCTTTGGGGAAGAGGG + Intronic
1074002242 10:109385040-109385062 CGATGGTTAATTAGGGAAGAGGG + Intergenic
1074513546 10:114141943-114141965 CTTTTGTTTTTTAAGGTAGAAGG + Intronic
1076486548 10:130823364-130823386 CTATTGCTCTTTAGTGAACTTGG + Intergenic
1080620425 11:33982544-33982566 TTTTTGTTTTTTAGGGATGAGGG + Intergenic
1082787635 11:57325499-57325521 CTTTTGTTCTTACGGGAAGAAGG - Intergenic
1084343719 11:68528368-68528390 ATATATTTCTTTAGAGAAGAGGG - Intronic
1084955857 11:72691211-72691233 CTACTGTTCTCTGAGGAAGAGGG - Intronic
1085466684 11:76728745-76728767 TTTTTGTTCTTTAGGAGAGAGGG + Intergenic
1086080070 11:82894805-82894827 CTATTGTTATCAAGAGAAGAAGG + Intronic
1086093814 11:83030625-83030647 CTTTTGTTTTTTAGTGGAGATGG - Intronic
1087883340 11:103446059-103446081 TTGTTGTTGTTTAGGGAGGAGGG + Intronic
1088343716 11:108798678-108798700 TTTTTGTTTTTAAGGGAAGAGGG + Intronic
1091269786 11:134299970-134299992 CTTTTGTTCCCTAGAGAAGATGG + Intronic
1092606242 12:10122803-10122825 CTATTCTTGTTTATGGAAAATGG + Intronic
1093717105 12:22395402-22395424 CTACTGTTTATTAGGGAAGAAGG - Intronic
1095142598 12:38684643-38684665 GTAATATTCATTAGGGAAGATGG + Intronic
1097396763 12:59084695-59084717 AAATTGTTCTTCAGGAAAGATGG - Intergenic
1099543629 12:83947842-83947864 ATGTTGTTCTTAGGGGAAGAAGG + Intergenic
1101006219 12:100403549-100403571 CAATTGTGTTTTAGGGAGGAAGG + Intronic
1102644910 12:114397555-114397577 TTGTTTTTCTTTGGGGAAGAGGG + Intronic
1103059891 12:117850093-117850115 TTATTATTTTTGAGGGAAGAAGG + Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1107421923 13:40255207-40255229 CTGTTGCTCTTTAGGGAGAAAGG + Intergenic
1109601110 13:64629741-64629763 CTATTGTTCTTCAGTGGAAAAGG - Intergenic
1111651203 13:91092977-91092999 TTTTTGTTCTTGAGGGCAGAGGG - Intergenic
1111808720 13:93070536-93070558 CAATTGTTTTGAAGGGAAGAGGG + Intergenic
1112121317 13:96415118-96415140 CTATGGTTCTTTGGGGAATGGGG + Intronic
1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG + Exonic
1113129354 13:107018292-107018314 GTATTAGGCTTTAGGGAAGAAGG + Intergenic
1115988970 14:39131944-39131966 GAATTTTTTTTTAGGGAAGATGG + Exonic
1116405493 14:44560704-44560726 CTATTGTTCACTAGTCAAGAAGG - Intergenic
1117580614 14:57147991-57148013 CTACTTTTCTTTTGGGATGATGG - Intergenic
1117657696 14:57973434-57973456 CTATTATAATTTTGGGAAGAAGG - Intronic
1118353002 14:64987341-64987363 TTCTCGTTCTTTAGGGCAGAGGG - Intronic
1120862459 14:89267075-89267097 CTTTTTTCCTGTAGGGAAGAAGG - Intronic
1121072587 14:91037988-91038010 CTATTGTTCTGGAGGAAATAGGG + Intronic
1127211209 15:56776789-56776811 CTGGTTTGCTTTAGGGAAGAGGG - Intronic
1127853843 15:62938734-62938756 CTAACGTTCCCTAGGGAAGAAGG + Intergenic
1129798098 15:78393274-78393296 CTATTGTTTTATAGAGATGAGGG + Intergenic
1131167261 15:90151462-90151484 GCAGTGTTCTTTGGGGAAGAAGG - Intergenic
1132036546 15:98489897-98489919 CTGTTGGTCTCTAGGGAGGAGGG - Intronic
1132397477 15:101484865-101484887 CTATTCTACTTCAGGGAAGGTGG + Intronic
1133352843 16:5113647-5113669 TTTTTGTTCTTTAGGGAGGTGGG - Intergenic
1135460040 16:22634367-22634389 CTATTTTCCTTTATGGAAGTTGG - Intergenic
1135636202 16:24077729-24077751 CTACTGTTGTTCAGGGATGAAGG - Intronic
1138232751 16:55351212-55351234 CTATTATTCTTTAGAGATGGGGG - Intergenic
1138284175 16:55795170-55795192 ATTTTGTTCTTTAGGGGTGAAGG - Intergenic
1138284827 16:55801817-55801839 ATTTTGTTCTTTAGGGGTGAAGG + Intergenic
1140348635 16:74240240-74240262 TTATTTTTTTTTAAGGAAGATGG - Intergenic
1152971919 18:170128-170150 CTATTTTTATTTAGTGGAGATGG - Intronic
1155646610 18:28085946-28085968 TTATTCTCCTTTAGAGAAGATGG - Intronic
1157766936 18:50305790-50305812 TTATTGTTTTTTAGTGGAGAAGG + Intergenic
1158024264 18:52877346-52877368 CTATTGGTCTAGAGGGAGGAGGG + Intronic
1158518726 18:58152470-58152492 CAAGTTTTCTTTGGGGAAGAGGG + Intronic
1159184911 18:64957114-64957136 CTAATGTTCTTTAGGGTATTTGG + Intergenic
1159371063 18:67528289-67528311 TTATTGTTCTTTCTGGAGGAAGG + Intergenic
1159697618 18:71580167-71580189 CTATTATTTCCTAGGGAAGAAGG - Intergenic
1164006251 19:21152188-21152210 CTTTTGGTCTCTAGGCAAGATGG + Intronic
1164550627 19:29208928-29208950 CTATTGCCCTTTACTGAAGAGGG - Intronic
1165604651 19:37091328-37091350 CCTTTGTTCATCAGGGAAGATGG - Intronic
1166751399 19:45165448-45165470 CCATTGTTCCTGAGGGAAGGGGG - Intronic
1166887032 19:45967979-45968001 CAATTGTTATTTATGGAAGGGGG - Intronic
926447199 2:12957438-12957460 CTTTTGTTCTGTAGGGAAGATGG + Intergenic
926465988 2:13189175-13189197 CTATTTTTTTTCATGGAAGAAGG - Intergenic
926522031 2:13927483-13927505 CTATTGTTCGTAGGGGAATAAGG - Intergenic
927925121 2:27006829-27006851 GTATTGTTCTTTTCTGAAGATGG - Intronic
928734242 2:34267181-34267203 ATTATGTTCGTTAGGGAAGATGG + Intergenic
929040007 2:37735468-37735490 CTTTTTTTTTTTAGGGAAGATGG - Intronic
930787817 2:55287761-55287783 CGATAGTTCTCTAGGGAAAATGG + Intergenic
930919972 2:56741509-56741531 CTATTGTTATTTTGGGAATACGG + Intergenic
935411570 2:102770103-102770125 CAATTATTCTTAGGGGAAGAAGG + Intronic
935885266 2:107611708-107611730 TTATTGTTCTTTGTAGAAGATGG - Intergenic
936656203 2:114490431-114490453 CTAATTTCCTTGAGGGAAGAAGG + Intronic
938654790 2:133420074-133420096 CTAATATCTTTTAGGGAAGATGG + Intronic
938687807 2:133757426-133757448 TTAATGATATTTAGGGAAGATGG - Intergenic
939623581 2:144449442-144449464 TTGTTGTTTTTTAGGGATGAGGG - Intronic
939867994 2:147496053-147496075 ATGTTGTTTTTTAGGGAAAATGG + Intergenic
941230808 2:162910192-162910214 CTACTGTTTTTTATGGAATACGG + Intergenic
944271848 2:197793031-197793053 CTTCTGTTGTTTATGGAAGAGGG - Intergenic
945927163 2:215817516-215817538 CTGTTGTTCTATGGGGAACAGGG - Intergenic
946456750 2:219832709-219832731 CCATTGTTCATTGGTGAAGAAGG + Intergenic
946803583 2:223447547-223447569 CAATTGTTCCTCAGGAAAGATGG - Intergenic
947023691 2:225712694-225712716 CTATTCTTCCCTAGGGAAGGAGG + Intergenic
947079762 2:226383068-226383090 ATTTAGTTCTGTAGGGAAGAGGG + Intergenic
1170017568 20:11798943-11798965 TTATTATTTTATAGGGAAGAGGG - Intergenic
1170434918 20:16316481-16316503 CTTTTTTTCTTTTTGGAAGATGG - Intronic
1171014914 20:21531316-21531338 CTATTTTCCCTGAGGGAAGATGG + Intergenic
1172597234 20:36157784-36157806 CCATTGGCTTTTAGGGAAGATGG + Intronic
1178932140 21:36828501-36828523 CTATTCTTCTTTTGGAAAAAAGG - Intronic
1180391503 22:12287454-12287476 CTAATGTGCTTTATAGAAGATGG + Intergenic
1180408239 22:12577300-12577322 CTAATGTGCTTTATAGAAGATGG - Intergenic
1181487746 22:23242166-23242188 TTATTGTTCTTTATCGAAAAAGG - Intronic
1181886912 22:26028720-26028742 CTATTTTTTTTTAGTGGAGATGG - Intronic
1181933328 22:26420717-26420739 CTATTTTTCTTTAGGAATGTTGG - Intergenic
1182085381 22:27557597-27557619 CTTTTCTTCTTTAGGGAGGAAGG - Intergenic
1182395084 22:30029620-30029642 CTATTGATCTTTTGGGAATGAGG + Intronic
1183133401 22:35862417-35862439 CTGTAGTGTTTTAGGGAAGACGG - Intronic
952242236 3:31543657-31543679 ATATTATTCTTTATAGAAGAAGG + Intronic
952868340 3:37873474-37873496 CTATTGTTCTTTAGGATTCAAGG + Intronic
955141878 3:56277779-56277801 CTAATTTTCTTTAGGGAAACTGG + Intronic
958712677 3:97737139-97737161 CTGGACTTCTTTAGGGAAGATGG - Intronic
958993343 3:100873326-100873348 ATTTTCTTCTTTAGGGAATAGGG - Intronic
959148622 3:102580611-102580633 ATAGTTTTCTCTAGGGAAGATGG + Intergenic
961221519 3:125204648-125204670 CTAGTGTTCTATAGCAAAGAAGG + Intronic
962431132 3:135321019-135321041 GTATTGTTTTTTCCGGAAGAAGG - Intergenic
963397004 3:144747962-144747984 CTGTTGTTCTTTAGTGCAAAGGG + Intergenic
963419868 3:145048108-145048130 CTCCTGTTCTACAGGGAAGAAGG + Intergenic
964700664 3:159562427-159562449 CTAATGTTCTTCAGGGAGGGAGG + Intronic
965136315 3:164774562-164774584 CTATTATTCTGTAGAGCAGATGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967639502 3:191844382-191844404 CTATTGCAATTTAAGGAAGAGGG - Intergenic
971195045 4:24465036-24465058 TTATTGTTCTTTAGAGATGGGGG + Intergenic
971393604 4:26208474-26208496 CTATTGTTCTTTGTGATAGATGG - Intronic
971397614 4:26243281-26243303 CTATTGTTATTCAGAGATGATGG + Intronic
971583056 4:28367935-28367957 CCATTGTTTTTTATGGAACAAGG - Intronic
971638560 4:29098038-29098060 CTCTTGTTCTTTACAGAAAAGGG + Intergenic
971779463 4:31013183-31013205 CTCTTTTTCTTTAGAGAACAGGG - Intronic
971839990 4:31838566-31838588 CTATATTTCTTTAGGGAACTAGG - Intergenic
972062463 4:34894252-34894274 TTATTGTTCTTAGAGGAAGAGGG - Intergenic
972736168 4:41843689-41843711 CTTATGTTCTTTCAGGAAGATGG + Intergenic
973217323 4:47683956-47683978 CTATTGTTTTATAGGTGAGAAGG + Intronic
975092017 4:70415133-70415155 TTATTGTTTCTTAGGGAATAGGG + Intergenic
976646650 4:87394355-87394377 CTTTTTTGCGTTAGGGAAGAAGG - Intergenic
977101395 4:92820166-92820188 TTATTGGTTTTTAGGGGAGAGGG + Intronic
977202925 4:94138198-94138220 CTACTGTACTATAGGGAATAAGG + Intergenic
977749874 4:100596468-100596490 CTATAGGTCTGTAGTGAAGATGG - Intronic
980015863 4:127649701-127649723 TTAATATTCTTTGGGGAAGATGG - Intronic
981019008 4:140005646-140005668 CTAATCTTCTTTTGGGAGGATGG - Intronic
981764250 4:148229854-148229876 CTAGAGTTCTTTAGGGAAGGGGG - Intronic
988046203 5:25957964-25957986 CTATCTTTCTTTAGGGAATGAGG + Intergenic
988602801 5:32655302-32655324 ATATTCTTCTTTAGGGATAAGGG - Intergenic
990772490 5:59264892-59264914 CTGTTGTTCTTTAGAAATGATGG + Intronic
991142399 5:63259950-63259972 CTTTTGTTCCACAGGGAAGAAGG + Intergenic
991277464 5:64866467-64866489 CTCTAGTTTTTTAGGGTAGAAGG + Intronic
991416252 5:66396043-66396065 TCACTGTTCTTTAGGGAAGGGGG - Intergenic
992053763 5:72966797-72966819 TTATTCTTCTTTAGTGAAAATGG - Intronic
993680059 5:90866008-90866030 CTGTGGTTCTTTAGCTAAGAGGG + Intronic
994164767 5:96597276-96597298 CTTTTCTTTTTTAGGGCAGATGG - Intronic
995180252 5:109224292-109224314 GCTTTGTTGTTTAGGGAAGATGG + Intergenic
996892988 5:128444666-128444688 CCTATGTTCTTTAGGAAAGAGGG - Intronic
996919020 5:128745649-128745671 CTATGATTGTTTAGGAAAGAAGG + Intronic
998857520 5:146407708-146407730 CTATTCTTTCTTAGGTAAGAAGG + Intergenic
1000366440 5:160495583-160495605 CTTTAGATCTTTAGGGAAGTAGG + Intergenic
1000642788 5:163723024-163723046 CTATTTTTCAGTAGGCAAGATGG - Intergenic
1000979181 5:167798477-167798499 ACACTGCTCTTTAGGGAAGAAGG + Intronic
1002885370 6:1289323-1289345 CTGTCCTGCTTTAGGGAAGATGG - Intergenic
1002978030 6:2105359-2105381 CACTTCTTCTCTAGGGAAGATGG + Intronic
1003379663 6:5611936-5611958 CTTTTGTTCCTTATGGAAAATGG - Intronic
1003521616 6:6863105-6863127 TGAGTTTTCTTTAGGGAAGAGGG - Intergenic
1004305397 6:14497421-14497443 CTATTGTTGTTTCGGAAAGGAGG + Intergenic
1004843652 6:19614683-19614705 CTGTTGTTCTTAGGGTAAGATGG - Intergenic
1005112558 6:22299387-22299409 CTAGCGTTCTTTAGAAAAGATGG - Intergenic
1005203878 6:23378779-23378801 TGATTCTTCTTTAGGGAAAAAGG + Intergenic
1007629914 6:43267601-43267623 CTATTGTTCTTTGGTGATGGTGG + Intronic
1007735749 6:43981338-43981360 CTATTCTTCTTTATGGGAGAGGG + Intergenic
1008692349 6:53993702-53993724 CTATCTTTGTTTAGGAAAGATGG - Intronic
1009738061 6:67704976-67704998 CATGTTTTCTTTAGGGAAGATGG - Intergenic
1010148889 6:72706848-72706870 GTATTGTTCTTTTGACAAGAGGG - Intronic
1010886894 6:81254942-81254964 CTAGTGGTCTTTCTGGAAGAAGG + Intergenic
1013007718 6:106089440-106089462 ATACTGTTCCTTAGGGAAGGGGG - Intronic
1014002306 6:116378130-116378152 CTTCTTTTCTTCAGGGAAGATGG - Intronic
1014806072 6:125831186-125831208 CTACTTTTCTTAAGGTAAGATGG - Intronic
1017953143 6:159154996-159155018 CTATTGTTCAGCAGGGAAAATGG - Intergenic
1019405221 7:879881-879903 CGATTGTTCTTCAGGGATCAAGG + Intronic
1019882429 7:3874696-3874718 CTTTCATTCCTTAGGGAAGATGG + Intronic
1020090883 7:5339967-5339989 TTGTTGTGCTTTAGGGAATAGGG - Intronic
1020287150 7:6692542-6692564 CTATTTTTCTTGAAGGAACAGGG + Exonic
1021474118 7:21041612-21041634 CTATTTTTTTTTAGGGAGGGGGG - Intergenic
1021481035 7:21117329-21117351 CTTTTTGTCTTTAGGGGAGAAGG - Intergenic
1022778983 7:33558970-33558992 CAATTGTACTTAGGGGAAGAAGG - Intronic
1024293733 7:47826517-47826539 GGATTGTTTTTTAAGGAAGATGG + Intronic
1026798505 7:73381514-73381536 CGATTCTTCTTTACAGAAGAAGG + Intergenic
1028144182 7:87303823-87303845 CTATTGTTCTTTAATGAGAAAGG + Intergenic
1029044060 7:97608715-97608737 TTATTGTTCCTTTGGGCAGATGG - Intergenic
1030827000 7:114170332-114170354 TCGTTGTTTTTTAGGGAAGAGGG - Intronic
1031760561 7:125708204-125708226 CTATTGTTCTTTATGGAACAGGG - Intergenic
1032994578 7:137431015-137431037 CTAGTTCTCTTTGGGGAAGAGGG - Intronic
1036026667 8:4916442-4916464 CAATTGTTTGTCAGGGAAGATGG + Intronic
1039747679 8:40444495-40444517 TTATTTTGCTTTAGGGAGGAAGG + Intergenic
1040387592 8:46924075-46924097 CTCTCCTCCTTTAGGGAAGATGG - Intergenic
1041656680 8:60358817-60358839 AAATTGTTCTTCAGGGAAAATGG - Intergenic
1043912649 8:85880954-85880976 CTAAAGCTCTGTAGGGAAGATGG + Intergenic
1044882056 8:96733493-96733515 CTATCGTTACTTAGTGAAGACGG + Intronic
1045974146 8:108112319-108112341 CTAATATTCTTAAGGTAAGAGGG + Intergenic
1046568364 8:115930650-115930672 TTATGGTCCTTTAGGAAAGATGG - Intergenic
1046858674 8:119065929-119065951 CAATTTTTCTATGGGGAAGATGG - Intronic
1047828010 8:128599069-128599091 CAATTGTGATTTAGGGAAGAAGG + Intergenic
1048888065 8:138924547-138924569 CTGGTTTTCTTTAGGGAACAGGG + Intergenic
1048977592 8:139681664-139681686 CTCTTGTTCCTTATGGCAGAGGG - Intronic
1049390684 8:142368760-142368782 CTTTTATTCTTCAGGGGAGAGGG - Intronic
1050297732 9:4222970-4222992 CTGTTGTTCCTTAGGGAATTAGG + Intronic
1056072189 9:82999243-82999265 CTATTGTTCTGTTGTGAAGGTGG + Intronic
1057029376 9:91762374-91762396 TTATTGTTATTTGAGGAAGATGG - Intronic
1059084459 9:111285007-111285029 CTATTGTTTTCTTGTGAAGATGG - Intergenic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1062693300 9:137856842-137856864 CTATTGGCCCTTAGGGCAGAAGG + Intronic
1187465735 X:19526058-19526080 CTTTTGTTCCTTAAGGGAGAAGG + Intergenic
1187905844 X:24065638-24065660 TTATTTTTCTTTATGGAAGTGGG + Intronic
1188456578 X:30373185-30373207 CTACAGTTCTATAGAGAAGAGGG + Intergenic
1188613757 X:32132037-32132059 TCATTGTTATTTAGGGATGAAGG + Intronic
1189526061 X:41823251-41823273 CTTTTGGTCTTGATGGAAGAGGG + Intronic
1194234537 X:91365963-91365985 TTATTTTTAATTAGGGAAGAAGG + Intergenic
1195724810 X:107903630-107903652 CTGCTGTTCTTTTGGAAAGAGGG - Intronic
1195920010 X:109974366-109974388 CACTTCTGCTTTAGGGAAGATGG - Intergenic
1196583351 X:117400850-117400872 AAATTGTTCTTTAGAGATGAAGG - Intergenic
1198771034 X:140130306-140130328 CTTTTTTTCTGTAGGGAAGGGGG + Intergenic
1200371800 X:155734290-155734312 CTGTTGTATTTTAGGGAATAGGG + Intergenic
1201914852 Y:19171021-19171043 GTATTCTTCTTTGAGGAAGAGGG - Intergenic
1201973637 Y:19822257-19822279 CTTTTGTACTTTAGTGGAGATGG - Intergenic