ID: 923151858

View in Genome Browser
Species Human (GRCh38)
Location 1:231240935-231240957
Sequence AAGCAGAGGCCAACCCAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 1, 2: 4, 3: 38, 4: 315}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923151853_923151858 23 Left 923151853 1:231240889-231240911 CCAGGTGGGACGAAGGGTGCTTG 0: 1
1: 0
2: 0
3: 5
4: 136
Right 923151858 1:231240935-231240957 AAGCAGAGGCCAACCCAGGACGG 0: 1
1: 1
2: 4
3: 38
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923151858 Original CRISPR AAGCAGAGGCCAACCCAGGA CGG Intronic
900480283 1:2894858-2894880 AGGCTGAGCACAACCCAGGAAGG - Intergenic
900592425 1:3465976-3465998 AAGCAGAGGCCAAGAGAGGTGGG - Intronic
900608874 1:3536059-3536081 AAGCCGAGGCCACCAGAGGACGG - Intronic
901023652 1:6267780-6267802 ATGAAGAGACCATCCCAGGAAGG - Intronic
903226063 1:21894779-21894801 TAGCATAGGCCATTCCAGGACGG + Intronic
903253010 1:22070414-22070436 AGGCAGAGGACAACAAAGGAAGG - Intronic
903333676 1:22611032-22611054 GTGCACATGCCAACCCAGGATGG + Intergenic
903938558 1:26913348-26913370 AAGCAGGGGCCAGCCAGGGAAGG - Intronic
904497864 1:30897456-30897478 GGGCAGAGGCTAACCCAGGCTGG - Intronic
904713528 1:32449358-32449380 AACCAGAGACCATCCCTGGAGGG + Intergenic
905014817 1:34770499-34770521 TAGCAGAGTCCAACACAGGGTGG - Intronic
905211096 1:36374654-36374676 ATGGAGAGGCCAAGCCAGTACGG - Intronic
907278847 1:53331943-53331965 AAACAGAAGCCAACCCATGCGGG - Intergenic
907373590 1:54018268-54018290 AAGCAGAGGCAAAGGCAGGAGGG + Intergenic
908617781 1:65941937-65941959 AAGCAGAGACTATCGCAGGAAGG - Intronic
909872788 1:80764306-80764328 ATGCAGAGGCCAAATCAGAAAGG - Intergenic
913036278 1:114969383-114969405 AAGCAGAGCCCACCACAGCATGG - Intronic
914322737 1:146580926-146580948 AAGGAGAGACCACCCCAGGGTGG + Intergenic
915354954 1:155250479-155250501 AAGCAGGGTCCCACCCAGGGCGG + Exonic
915486710 1:156226432-156226454 ATGCAGAAACCAACCCAGCAGGG - Intronic
916479387 1:165201501-165201523 AGGCAGATGCCTAGCCAGGATGG - Intergenic
916508582 1:165450849-165450871 AAGGTGAGGCAAAGCCAGGAAGG - Intergenic
917077867 1:171224519-171224541 AAGCAGAGGAGAACAAAGGAAGG - Intergenic
917790219 1:178494633-178494655 AAGAAGAGGCCAATCCAAGCCGG + Intergenic
918243805 1:182642111-182642133 ACCCAGAGCCCAACCTAGGAAGG + Intergenic
919739888 1:200975062-200975084 CAGCACAGGCCACCCCAGCATGG - Intronic
919796121 1:201322540-201322562 AAGCAGAAGCCTACCAGGGATGG + Intronic
919803815 1:201369037-201369059 AAGCAGAGGGCTAGCGAGGAAGG + Intronic
919918914 1:202156728-202156750 AGGCAGAGGACACTCCAGGAGGG + Intronic
920196174 1:204228701-204228723 AAGTAGAGGCTCACCCAGGCTGG + Intronic
920250165 1:204618021-204618043 TGGCACAGGCCAACCCAGGAAGG - Exonic
920893424 1:210018044-210018066 TAGGAGAGGCTAATCCAGGATGG + Intronic
922098439 1:222462208-222462230 AAACAGAAGACAGCCCAGGAAGG - Intergenic
923151858 1:231240935-231240957 AAGCAGAGGCCAACCCAGGACGG + Intronic
924317256 1:242811179-242811201 AGGCAGAAACCAACCCTGGATGG + Intergenic
924623891 1:245684927-245684949 AGGCAGAGGCCAAGCCAGGATGG + Intronic
1063248496 10:4248769-4248791 GAGCAGAAGCCAACAGAGGACGG - Intergenic
1064090740 10:12381227-12381249 AAGCTGTGACCACCCCAGGAAGG - Intronic
1064134643 10:12740205-12740227 ACCCAGAGGCCACCCCATGAAGG + Intronic
1065261589 10:23929082-23929104 ATGCAGAGGCCAAATCAGGTAGG + Intronic
1065625353 10:27624224-27624246 GAGCAGATGGTAACCCAGGAAGG + Intergenic
1067816476 10:49481562-49481584 AGGCACAGGCCCACCCAAGAAGG + Intronic
1067902699 10:50258602-50258624 AAGATGAGGCCAGGCCAGGATGG + Intergenic
1068097978 10:52515874-52515896 TAGCAGAGGCTAAACTAGGATGG + Intergenic
1069213635 10:65792473-65792495 AAGCAGAGGAGAACAAAGGAAGG + Intergenic
1071375562 10:84998837-84998859 AAGCAGATGCCAAGCGATGATGG + Intergenic
1072097982 10:92201157-92201179 GAAATGAGGCCAACCCAGGAAGG + Intronic
1072871410 10:99124607-99124629 AAGCACATGCCAACCCAGCCAGG + Intronic
1073488055 10:103834185-103834207 GAGCAGAGGCCAGCCCTGCAAGG + Intronic
1073971943 10:109053791-109053813 ACACAGAGGCCAAGCCAGGGTGG - Intergenic
1074190158 10:111128599-111128621 TAGCAGAGGCTCACCCAGGATGG + Intergenic
1075654185 10:124150662-124150684 AAGCAGAGCCCAGCCCACCAAGG + Intergenic
1076597248 10:131631718-131631740 AAGCAGAAGGAAAACCAGGAAGG - Intergenic
1076598497 10:131641289-131641311 ATGCTGAGGTCACCCCAGGAGGG + Intergenic
1076770541 10:132660973-132660995 AAGTAGGGTCAAACCCAGGAGGG + Intronic
1077190069 11:1252249-1252271 AGGCAGAGGTCAGCGCAGGAGGG - Intronic
1077327520 11:1970102-1970124 AAGCAGACGCCAGGCCGGGAAGG - Intronic
1077998566 11:7474841-7474863 AAGCACAGGCTAACTCTGGAGGG + Intergenic
1081201663 11:40223571-40223593 AAGAAGAGACCAACCAAGGCTGG + Intronic
1083479084 11:62932299-62932321 AAGCAGTGGGCAGCCGAGGAAGG + Intergenic
1083644583 11:64165151-64165173 CAGGACAGGCCAGCCCAGGAAGG + Intronic
1083822986 11:65182979-65183001 TAGCCGAGTCCCACCCAGGATGG - Intronic
1083933581 11:65859123-65859145 AGTCAGAGGCAAACCCAGAAAGG + Intronic
1084712449 11:70852417-70852439 ATGCAGAGGCCAGGGCAGGAGGG + Intronic
1085150631 11:74250438-74250460 AAGCAGGGGCCAAACCATTAAGG - Intronic
1085272827 11:75280464-75280486 GAGCACAGCCCGACCCAGGAGGG + Intronic
1086220082 11:84432355-84432377 AAGCAGAGGCCATATCATGATGG + Intronic
1088102844 11:106174081-106174103 AGGCAGAGGAGAACCAAGGAAGG + Intergenic
1088148090 11:106708468-106708490 AAACAAAGGCCAAGACAGGAAGG + Intronic
1089365664 11:117919491-117919513 AGGCCCAGGCCACCCCAGGAGGG - Intronic
1090818851 11:130322510-130322532 AAGCAGAGGAGAACAAAGGAAGG + Intergenic
1090883121 11:130852052-130852074 ATGCAAGGGCCAGCCCAGGAAGG + Intergenic
1202810502 11_KI270721v1_random:25282-25304 AAGCAGACGCCAGGCCGGGAAGG - Intergenic
1094484670 12:30915035-30915057 TGGCAGAGCCGAACCCAGGAGGG - Intergenic
1096521393 12:52186690-52186712 AGGCAGAAGCCAGCCCATGAAGG - Intronic
1096604115 12:52752803-52752825 AAGCGGGGGCCAAGACAGGAAGG - Intergenic
1097721839 12:63030059-63030081 AAGCCGAGGACCAGCCAGGAGGG - Intergenic
1098041958 12:66361724-66361746 AAGCAGAGGCTGAGTCAGGAGGG - Intronic
1098503050 12:71216746-71216768 AAGGAAAGGCCAAGCCACGATGG + Intronic
1100719452 12:97342308-97342330 TAGCAGAGGCCTAACCAAGATGG + Intergenic
1101084080 12:101217434-101217456 AGGCAGAGGCAGACCCAGAATGG + Intergenic
1101201198 12:102438190-102438212 AAGCTGAGGCAAAGTCAGGAAGG + Intronic
1101399891 12:104378177-104378199 CTGGAGAGGCCACCCCAGGAGGG - Intergenic
1101838440 12:108311161-108311183 AAGCAGAGGCCCACACACAAAGG + Intronic
1101910378 12:108856948-108856970 AGACAGAGGTCAACCCAAGATGG + Intronic
1102242663 12:111334744-111334766 AAGTAGGAGCCAACCCAGGTGGG - Intronic
1102396320 12:112589165-112589187 AAGTGGGGGCCAACCCAGGAGGG + Intronic
1102605569 12:114064982-114065004 AACCAGAGACCACCCCTGGAGGG - Intergenic
1103563098 12:121802913-121802935 AAGGAGAGGCCAACAGATGAGGG - Intronic
1104933188 12:132351255-132351277 AAGCAGAACCCAACCCAAGGTGG - Intergenic
1108697818 13:52918208-52918230 AAGCAAGGGCCAAACCAGGTGGG + Intergenic
1111259750 13:85721551-85721573 AAGCAGTGGACATCCCAGCATGG - Intergenic
1111651374 13:91094738-91094760 AAACAGAGACCAAGCCAGGTAGG + Intergenic
1111873413 13:93863032-93863054 AAGGAGAGGCCAAAACTGGAAGG - Intronic
1113364493 13:109663560-109663582 CATCAGCTGCCAACCCAGGAGGG + Intergenic
1113524694 13:110965871-110965893 AACCAGAGACCACCCCCGGAGGG - Intergenic
1114814606 14:25942737-25942759 GAGTAGAGGCCCACCAAGGACGG + Intergenic
1115388803 14:32829885-32829907 AACCAGAGGCCAGCCCAGGGCGG - Exonic
1115657059 14:35453430-35453452 AAGCAGAAACCCACCCTGGACGG - Intergenic
1117175638 14:53143615-53143637 AGGCAGAGGACAACAAAGGAAGG + Intronic
1117179927 14:53181333-53181355 AACCAGAGACCACCCCTGGAGGG + Intergenic
1117313159 14:54548493-54548515 AAACAGAGGCAAAATCAGGAAGG - Intergenic
1118797202 14:69153610-69153632 AGGCAGAGGCCAGCAGAGGAAGG - Intergenic
1118810319 14:69268466-69268488 TAGCAAAGGCCTAGCCAGGAAGG + Intronic
1119133259 14:72193886-72193908 ATGCAAAGGCCAAAACAGGAGGG + Intronic
1120789015 14:88562527-88562549 AGGCAGAACCAAACCCAGGAGGG + Intergenic
1120830740 14:88995496-88995518 AGGCCGAGGCCAAGCCAGGAAGG - Intergenic
1120890347 14:89485613-89485635 AAGCAGTGGCCAAGCCAGGGTGG + Intronic
1121445808 14:93978048-93978070 AGGCAGAGGGCAACCTAGGAGGG - Intergenic
1122795750 14:104205357-104205379 AAGCAGAGGACATCTCAGCATGG - Intergenic
1124238296 15:28008462-28008484 AGGCAGAGGACAACAAAGGAAGG - Intronic
1125318625 15:38458714-38458736 AAGCAGTGGTCATCCCAGTAAGG - Intronic
1125744501 15:41989340-41989362 AATCAGGGGCCAACCCAGGGTGG + Intronic
1125766899 15:42142218-42142240 AAGCAGAGGAGAGGCCAGGATGG + Intronic
1127836117 15:62792618-62792640 CTGCAGAGGCAAGCCCAGGATGG - Intronic
1128150759 15:65362263-65362285 AACTAGAGGCCCACCCAGTAGGG + Intronic
1128392104 15:67189326-67189348 AAGTAGAGGCCAAGCAAGGAGGG + Intronic
1128730295 15:70016050-70016072 AAGCAGAGGCCAAGCCAGGCTGG - Intergenic
1128776072 15:70321617-70321639 AAGCAGAAGCCAACCCAGAAAGG + Intergenic
1129157313 15:73726671-73726693 CAGCAGAGGCCAGGCCACGAGGG + Intergenic
1130879116 15:88039907-88039929 AAGCAGAGGAGAACCAAGGAAGG + Intronic
1131070347 15:89461825-89461847 AAGCAGGGGCCAAGGCAGGAGGG + Intergenic
1131150160 15:90042787-90042809 TAACAGAGGCCCAACCAGGAAGG + Intronic
1132507930 16:321699-321721 AGGCGGATGCCAACCCACGAAGG + Intronic
1132881885 16:2165947-2165969 AAGCCAAGGCCAGCCCAGGCTGG + Intronic
1134029736 16:10982278-10982300 AGACAGAGGCAAACCCAGGTGGG - Intronic
1135172002 16:20192872-20192894 AGACAGAGGCAAACACAGGATGG - Intergenic
1135394221 16:22118834-22118856 CTGCAGGGGTCAACCCAGGAAGG - Intronic
1136125348 16:28175404-28175426 GGGCAGAGGCCAGGCCAGGAAGG - Intronic
1136371827 16:29841503-29841525 AAGCAGAGCCCATCCAGGGAAGG - Intronic
1137359315 16:47798283-47798305 TAGCAGATGCACACCCAGGAAGG - Intergenic
1138139936 16:54559452-54559474 GAGCAGAGGCCAGGGCAGGATGG + Intergenic
1138412230 16:56849728-56849750 CAGCAGAGGCAAGCCCAGGTAGG - Intronic
1138548746 16:57735770-57735792 AAGCAGCGGCCAATCAAGGCAGG + Exonic
1139523345 16:67497869-67497891 GAGCTGTGGCCAACCCAGGGAGG + Intergenic
1140456844 16:75110758-75110780 AAGAAGAGTCCTACCCAGGAGGG + Exonic
1140813637 16:78601138-78601160 ATGGAGAGGCAAACCCAGGTTGG + Intronic
1141424118 16:83934500-83934522 AAGCCGAGGCCGAGACAGGAGGG - Intronic
1141688835 16:85585293-85585315 AACCAGAGGCCCATCCAGGATGG + Intergenic
1141998387 16:87649030-87649052 AGGCAGAGTCCAGCCCAGCAAGG + Intronic
1143090371 17:4446278-4446300 TAGGAGAGGTCAAACCAGGAGGG + Intronic
1143750903 17:9026943-9026965 ATTAAGAGGCCAACCCAGCACGG - Intronic
1143791432 17:9299109-9299131 AAGCAGATGTGAACCCAAGATGG - Intronic
1144627458 17:16851638-16851660 AAGCATGGCCCAACCCAGGGAGG + Intergenic
1145971229 17:28957583-28957605 AAGCAGAGGCCAATCCACCCTGG + Intronic
1147581586 17:41630332-41630354 AAGCACAGCCCAGCCCAGGGAGG + Intergenic
1149229862 17:54520246-54520268 AAGCAGATACCAATCCTGGATGG + Intergenic
1150213711 17:63455639-63455661 AGGCAGAGGCCACGCCAGGAAGG + Intergenic
1150655499 17:67036596-67036618 AAGCAGAGGACATCCCTAGAAGG - Intergenic
1151420260 17:73992485-73992507 AGGAGAAGGCCAACCCAGGAAGG + Intergenic
1151551813 17:74826714-74826736 AGGCAGGTGCCACCCCAGGAAGG + Intronic
1152223867 17:79083710-79083732 CAGCAGAGGCCAACAGAGCAGGG - Intronic
1152480967 17:80552276-80552298 AGGCAGAGGCCAAATCATGAAGG - Intronic
1152549847 17:81023797-81023819 ATGCAGGGGCCAGCACAGGACGG + Intergenic
1152647312 17:81475379-81475401 AAGCAGAGGCCAACACACACAGG + Intergenic
1153724763 18:7943298-7943320 GAGCAGAGGCCAGACCAGGAAGG - Intronic
1153826844 18:8882743-8882765 AACCAGAGACCATCCCAAGAGGG + Intergenic
1154298653 18:13173705-13173727 AAGCAGGCCCCAAACCAGGAAGG + Intergenic
1154482728 18:14851835-14851857 AAGCAGAAGCCAGTCTAGGATGG - Exonic
1155239148 18:23848514-23848536 AGTCAGAGGCCAGGCCAGGATGG + Intronic
1155986521 18:32236247-32236269 CAGCACATGCCACCCCAGGAGGG + Intronic
1156997106 18:43481929-43481951 AAGCATAGGCCTAGCCAGGCAGG + Intergenic
1157818347 18:50747474-50747496 GTGAATAGGCCAACCCAGGAAGG - Intergenic
1160874770 19:1291857-1291879 AGGCAGAGGCTCACCCAGCAGGG - Intronic
1161331745 19:3691896-3691918 CAGCAGACGCCAAGCCAGGCTGG + Intronic
1162514922 19:11142205-11142227 GAGAAGAGGCCAAGCCAGGGTGG - Intronic
1162931754 19:13961052-13961074 AGGAAGAGGCCACCCCAGGAAGG - Exonic
1163927548 19:20360451-20360473 AACCAGAGACCACCCCTGGAGGG - Intergenic
1165245157 19:34494403-34494425 AAGAAGAGGCCAGTACAGGAAGG + Intronic
1167525438 19:49980873-49980895 AAGGAGAAGCCACCCCAAGATGG + Intronic
1168608245 19:57776915-57776937 AGGCAGAGGACAACCAAGGTGGG - Intronic
926389703 2:12376438-12376460 AGGCAGAGGACAACTCATGATGG - Intergenic
927045438 2:19273475-19273497 GAGCAGAGGCAGATCCAGGATGG + Intergenic
927276011 2:21262999-21263021 AGGCTGAGGCCAACTCATGAAGG - Intergenic
929101238 2:38316328-38316350 AAGCAGAGGCCCACATAGGTTGG - Intronic
929597588 2:43186094-43186116 AAGAAGAAACAAACCCAGGAAGG - Intergenic
929886013 2:45879246-45879268 AAGAAGAGTCCAGCCGAGGATGG + Intronic
929998908 2:46847741-46847763 AGGCAGGAGCCAACCGAGGAGGG - Intronic
930250937 2:49033499-49033521 ATGAAGAGGCCAACGCAGGAGGG + Intronic
931437603 2:62262478-62262500 AAGGAGAGGTGAACCCAGGTTGG - Intergenic
931636044 2:64341530-64341552 AAGTAGAGGCCAGGCCAGGTAGG - Intergenic
931686676 2:64799979-64800001 AAGCACATGCCAATCCAGGGAGG + Intergenic
932672865 2:73753390-73753412 AAGCAAATCCCAGCCCAGGAGGG - Intergenic
933580102 2:84116361-84116383 AAGCAGGGGCCCGCCCAGGCAGG - Intergenic
935047700 2:99497209-99497231 AACCAGAGACCGTCCCAGGAGGG - Intergenic
936020775 2:108993347-108993369 CAGCTGAGCCCAGCCCAGGAAGG + Intergenic
937452181 2:122010750-122010772 CAGCGGAGGCAAACCCTGGAGGG + Intergenic
937959061 2:127440747-127440769 AAGCAAAGTCCTCCCCAGGAAGG - Intronic
938042244 2:128085238-128085260 AAGCAGAGGGTAACCCAGAGGGG - Intergenic
938930718 2:136084295-136084317 AGGCAGAGGCGAACTCAGGCAGG - Intergenic
939858486 2:147389654-147389676 AAGCAGAGGCATATCCAGCATGG + Intergenic
939975186 2:148709207-148709229 AAACAGAGGCCAAATCATGAGGG + Intronic
940292380 2:152089925-152089947 AAGCAGAGGCCAAACACAGAGGG + Intronic
940678531 2:156754543-156754565 AAGAAGAGGGAAACCCAGGATGG - Intergenic
942080719 2:172397187-172397209 AAGCTGAGGCCAGCCAATGATGG - Intergenic
942933123 2:181520381-181520403 AAGCAGGGGCCAACTCTGGAGGG + Intronic
945023346 2:205596199-205596221 AAGAAGAGACCAAGGCAGGATGG + Intronic
946013440 2:216584885-216584907 AAGCAGGGGTGAAGCCAGGAAGG + Intergenic
946831136 2:223729246-223729268 AGGCCGAGGCCACCCCTGGAAGG + Intergenic
947232343 2:227901222-227901244 AAGAAAAGGGGAACCCAGGATGG + Intronic
947556799 2:231100113-231100135 AACCAGAGACCATCCCGGGAGGG + Intronic
947669842 2:231929220-231929242 AGGCTGAGGCCACCCAAGGAGGG + Intergenic
947996554 2:234532837-234532859 AGGCAGAGGCGAACAAAGGAAGG - Intergenic
948108564 2:235435380-235435402 AAGCAGAGGGCACCACAGGAAGG - Intergenic
948386195 2:237582414-237582436 ATGGAGAGGCCACTCCAGGAAGG + Intronic
948561537 2:238857032-238857054 AAGCAGAGGCCCCCAGAGGAAGG + Intronic
948734363 2:239990668-239990690 ATGCTGAGGCCAACATAGGATGG + Intronic
1169248316 20:4041489-4041511 ATGCAGAGGCCAAGACAGAAAGG + Intergenic
1170261759 20:14416251-14416273 AAATAGAGGCCAACAGAGGATGG - Intronic
1170798387 20:19569940-19569962 AAGCAGAAGCCAACTCAAAAGGG - Intronic
1170872090 20:20215180-20215202 AACCAGAAGCCAAGCCTGGACGG - Intronic
1172025689 20:31946696-31946718 CATCAGAGGCCAACTGAGGAAGG + Intronic
1172563146 20:35906889-35906911 ACCCAGATACCAACCCAGGATGG - Intronic
1172724555 20:37027995-37028017 TTTCAGAGGCCAAGCCAGGAGGG - Intronic
1172828716 20:37813246-37813268 AAGCAGAAGCCAGACCTGGAAGG + Intronic
1172845785 20:37929332-37929354 AGGCAGAGGCCAACACTGGAGGG + Intronic
1172904674 20:38360180-38360202 AGGCAGAGGTTCACCCAGGAGGG + Intronic
1173372570 20:42450935-42450957 AAGCAGAGAACAACCTAGAATGG + Intronic
1173994995 20:47331134-47331156 GGGCAGAGGCCAGCACAGGAGGG + Intronic
1174276808 20:49409889-49409911 GAGGAGAGGCCACCCCAGGCAGG - Intronic
1174793056 20:53498067-53498089 AGGCAGGGGACAAACCAGGAAGG - Intergenic
1175217995 20:57401470-57401492 AAGCAGAGGCCATTCCACGGGGG + Intronic
1175222408 20:57425066-57425088 AGCCAGAGTCCAACCCAGGATGG - Intergenic
1175755806 20:61528966-61528988 CAACAGAGGCCAAAGCAGGAAGG + Intronic
1175844310 20:62050664-62050686 CAGCAGAGGCCCGCCCGGGAGGG + Intronic
1175952404 20:62590546-62590568 CAGCAGAGGCCAACCCAGACAGG + Intergenic
1176269074 20:64226121-64226143 GAACAGCTGCCAACCCAGGAAGG + Intronic
1176797874 21:13384812-13384834 AAGCAGAAGCCAGTCTAGGATGG + Intergenic
1178252735 21:31020176-31020198 AAGAAGAGGGCAACTAAGGACGG - Intergenic
1180741507 22:18056220-18056242 AATCAGGGGCAAAGCCAGGAAGG - Intergenic
1180844936 22:18975784-18975806 AAGCAAGGGACAATCCAGGAAGG - Intergenic
1181048008 22:20224656-20224678 AAGGACAGGCGAGCCCAGGAGGG + Intergenic
1181056523 22:20262925-20262947 AAGCAAGGGACAATCCAGGAAGG + Intronic
1182074916 22:27488735-27488757 AAACTGAGGCCCACCCAGCAGGG - Intergenic
1183688771 22:39376522-39376544 AAGCAGAGGCCTAGACAGGAAGG + Intronic
1183706732 22:39478965-39478987 AGGCTGAGGCTGACCCAGGATGG - Intronic
1184902394 22:47456067-47456089 AAGCTGTGGCCACCCTAGGATGG + Intergenic
1185023935 22:48396905-48396927 AAGCAGAGGCCACCGCTGCAGGG + Intergenic
949327248 3:2880622-2880644 CAGCAGAGGCTAGCCCAGAAAGG + Intronic
949509628 3:4756975-4756997 AAGCTGGGGCCCACCCAGCAAGG - Intronic
950024167 3:9809493-9809515 AAGCAGAGGTGAAACCAGGAAGG - Intronic
950084141 3:10245302-10245324 AAGCAGAGGAGAACAAAGGAAGG - Intergenic
950143762 3:10633362-10633384 AAGGAGCGGCAAATCCAGGATGG - Intronic
950170832 3:10838123-10838145 AAGATGAGGCCACCCCAGGCTGG + Intronic
950435381 3:12976262-12976284 CAGCAGTGGCCGCCCCAGGAGGG + Intronic
950796505 3:15514698-15514720 AGGCAGAGGCCAAGCCAGCAGGG + Intronic
951061908 3:18218722-18218744 AAGCAGAGCCCAACTCAAGCTGG - Intronic
951806689 3:26652299-26652321 AAGCAGAGCCCAACCCTTTATGG + Intronic
954034022 3:47840869-47840891 TAGCAGACCCCAACCCTGGAGGG - Exonic
954153155 3:48669270-48669292 ACTCAGAGGCCAAGACAGGAGGG - Intergenic
954441661 3:50525527-50525549 CAGCTGAGGCCATCCCAGCAGGG + Intergenic
954604380 3:51897464-51897486 AACCAGAGACCACCCCCGGAGGG - Intronic
954791984 3:53140034-53140056 GGGCTGAGGCCAAGCCAGGATGG - Intergenic
955106510 3:55903943-55903965 GAACAGAGGGCAGCCCAGGAAGG + Intronic
962695647 3:137944762-137944784 CAGCTGAGGCCAACCCTTGAAGG + Intergenic
963127731 3:141830771-141830793 AAGCAGAGGCCAAGCCTGGAGGG - Intergenic
963650829 3:147977854-147977876 AAGCAGAGGCCAGTCCATGCAGG + Intergenic
964669590 3:159210108-159210130 AAGCAGAGCCCAACCAAGGGTGG + Intronic
964974114 3:162599641-162599663 CAGCCTAGGCCAGCCCAGGAAGG - Intergenic
967195894 3:187025460-187025482 AAGCAGAGGAGAGCGCAGGAAGG - Intronic
967631885 3:191753508-191753530 AAGCAGAAGCCAAAACAGGGAGG - Intergenic
969140262 4:5064966-5064988 AAGCAGGGGGCAACCTTGGAGGG - Intronic
969466599 4:7360938-7360960 AGGCAGGGGCGAACCCAGCATGG - Intronic
969469079 4:7376146-7376168 AAGCAGAGTCCTGCCCAGGCAGG - Intronic
971871373 4:32244154-32244176 GAGCATAGGCCAATTCAGGATGG - Intergenic
972396138 4:38661422-38661444 AGGCAGAGGCCAGGCCAGCAGGG + Intergenic
978313672 4:107413612-107413634 AACCAGAGACCATCCCTGGAGGG - Intergenic
979345429 4:119580996-119581018 AAGCATAGGCTTACCCCGGACGG + Intronic
980175055 4:129334462-129334484 AAGCAGAGGCCAAAAGAGGATGG + Intergenic
981582692 4:146266310-146266332 AAGCACAGTGCAATCCAGGAGGG + Intronic
984325043 4:178241390-178241412 AAGCAGAGCTCTACCCAGGGTGG + Intergenic
985559909 5:579846-579868 AAGCTGGGGCCAAACCCGGACGG - Intergenic
986992968 5:13575423-13575445 CAGCACAGGCCTACCCAGGATGG + Intergenic
987037538 5:14033165-14033187 GAGCTGAGGCCAGCTCAGGAAGG - Intergenic
987118632 5:14746101-14746123 AAGCACAGGACGGCCCAGGACGG + Intronic
988142972 5:27267006-27267028 TAGCAGAGGCCAGGACAGGAAGG - Intergenic
988413189 5:30912750-30912772 AAGCAGAGGTCAACACAGCTAGG + Intergenic
991281291 5:64917242-64917264 ATGCAGAGGCCTACCGAAGATGG - Intronic
992174026 5:74132490-74132512 CAGCAGAGGTAAACACAGGAAGG - Intergenic
995492333 5:112706541-112706563 AGGCAGAGGCCAAATCAGGTAGG - Intergenic
997247995 5:132367495-132367517 AAGCAGAGAGCAACCTAAGATGG - Intergenic
997751264 5:136348029-136348051 AAGAAGAGACCCTCCCAGGAAGG - Intronic
998465624 5:142341580-142341602 AGGCAGAGGCCAAGCCAGCGTGG + Intergenic
999143874 5:149380057-149380079 GAGCGGAGACCACCCCAGGAGGG - Intronic
999439105 5:151587619-151587641 AAACACAGGCAAACCCAGGCTGG - Intergenic
1000272937 5:159703948-159703970 AAACAGAAGCCATCTCAGGATGG - Intergenic
1001086393 5:168702887-168702909 GAGCAGGGGCTAACCCAGGCAGG - Intronic
1002130461 5:177078408-177078430 CAGCAGAGGCCAGTCCTGGAGGG + Intronic
1006589182 6:35141572-35141594 AAGCCGAGCCACACCCAGGAGGG + Exonic
1007507447 6:42346879-42346901 AAGAAGTGGTCAACCCAGGGAGG + Intronic
1008856588 6:56095550-56095572 AGATAGAGGCCAAACCAGGAAGG - Intronic
1013310328 6:108887928-108887950 AAGCAAAGGCCCAACCTGGATGG + Intronic
1015484136 6:133749176-133749198 AAGCAGAAGACAACGAAGGATGG + Intergenic
1017168324 6:151431279-151431301 AAGCAGGGGACAATCCAGAAGGG + Intronic
1017463353 6:154672089-154672111 TTGCAGAGGCTGACCCAGGAGGG + Intergenic
1017755760 6:157527659-157527681 AAGCAGAGGTCCACCAAGCAAGG - Intronic
1018346067 6:162900239-162900261 AAGCAGAGGCCAGCCCTGCCAGG - Intronic
1019889775 7:3937164-3937186 ATGCGGAGGTCTACCCAGGAAGG + Intronic
1023445648 7:40228960-40228982 ACGCAGAAGCCAACCCGGAAAGG - Intronic
1023798550 7:43813761-43813783 AACCAGAGACCACCCCCGGAGGG - Intergenic
1025922310 7:65924966-65924988 AAGCAAAGGACCAACCAGGAGGG - Intronic
1026852745 7:73735315-73735337 AAGCCGAGGCCAAGGCGGGAGGG + Intergenic
1027050106 7:75016482-75016504 AAGAAGAGGCAACTCCAGGAGGG - Intronic
1029112751 7:98222171-98222193 ACACAGGGGCCACCCCAGGAAGG + Intronic
1029991588 7:104967410-104967432 AAGCAGAGCCCCAGCCAGTAGGG + Intergenic
1030770017 7:113463076-113463098 GAGAAGAGGCTAACACAGGAGGG - Intergenic
1030903410 7:115151873-115151895 AAGCAGAGGTCAGGTCAGGATGG - Intergenic
1033806482 7:144959909-144959931 AAGCAGAGGGAAACACAGAAGGG - Intergenic
1034288827 7:149911103-149911125 AACCAAGAGCCAACCCAGGATGG + Intergenic
1034405855 7:150902047-150902069 AAGAAGAGGCACATCCAGGAAGG + Intergenic
1036121271 8:6020388-6020410 ACGCAGAGCCTCACCCAGGAAGG + Intergenic
1036408590 8:8477877-8477899 AAGTAGAGCCCAGCCCAGCATGG + Intergenic
1037273368 8:17153983-17154005 AGGCAGAGGCCTAGCGAGGATGG + Intergenic
1037496184 8:19443173-19443195 AAGCAGTGGCTAACCTGGGAAGG + Intronic
1037751142 8:21683192-21683214 AAACAGAGCCCTCCCCAGGAGGG + Intergenic
1039045655 8:33446908-33446930 AAAGAGAGGCACACCCAGGAGGG - Intronic
1039711647 8:40061546-40061568 AAACACAGCCCAGCCCAGGAGGG + Intergenic
1041972001 8:63754110-63754132 ATGCAGGGGCAAGCCCAGGATGG + Intergenic
1044557449 8:93579090-93579112 AAGCAAAGGCCAAGGCAGGAAGG + Intergenic
1045109227 8:98924165-98924187 AGGCAGAGGCCTGCCAAGGACGG - Intronic
1045502745 8:102755914-102755936 AAGCAGAGGCCCACCCATGGGGG + Intergenic
1046339132 8:112828508-112828530 AAGCAAAGGGGAAGCCAGGATGG - Intronic
1047978996 8:130160287-130160309 CGGCAGAGGCAAACACAGGAGGG + Intronic
1048215581 8:132491448-132491470 AAGCAGAGGCGAACATATGAGGG + Intergenic
1049208970 8:141376599-141376621 AAGCAGAGGCCCGAGCAGGATGG - Intergenic
1049379257 8:142303870-142303892 CAGCACCGGCCACCCCAGGAGGG + Intronic
1049400047 8:142421445-142421467 AAACAGAAGCCAACTCAAGATGG + Intergenic
1049599430 8:143500143-143500165 GTGCTGAGGCCCACCCAGGATGG - Intronic
1049646146 8:143736657-143736679 AGGCAGAGGGCAGCACAGGATGG - Intergenic
1050057135 9:1667489-1667511 AAACAGAGGCCAAGCCATAAGGG - Intergenic
1050794042 9:9514209-9514231 ATGCAGAGCCCTAACCAGGAGGG - Intronic
1053053882 9:34982246-34982268 GATCACAGGCCAACCCATGATGG - Exonic
1054748680 9:68882027-68882049 AAGCAGAGCACAACCCAGCTGGG - Intronic
1055944006 9:81676586-81676608 AAGCAGTGGCCAAGACAGGAAGG + Intronic
1057205480 9:93169504-93169526 CAGCAGAGGCCAGGCCAAGAAGG + Intergenic
1059420112 9:114185492-114185514 AAGCAGAGGCCTTCCCTGGATGG + Intronic
1059571352 9:115439812-115439834 AAACAGACGTAAACCCAGGATGG - Intergenic
1060188503 9:121577978-121578000 AAGCACAGGCCTTCCCAGGAGGG - Intronic
1061423339 9:130484022-130484044 CCCCAGAGGCCCACCCAGGATGG + Intronic
1061633659 9:131891043-131891065 AAGGAGAGGCAAACCCAGGTCGG + Intronic
1061728916 9:132598112-132598134 AAGCTCAGGCCAACCCTGCAGGG + Intronic
1061884198 9:133583411-133583433 AACCAGAGGCAAAGCCAGGCTGG - Intronic
1062309573 9:135928736-135928758 AAGCAGAGGCCAGCCCAGGATGG + Intergenic
1062339520 9:136087776-136087798 CAGCTGAGGACAGCCCAGGACGG + Intronic
1062443413 9:136583553-136583575 AGGCAGGGCCCAACCCAGGCCGG - Intergenic
1062547831 9:137071519-137071541 CAGCTGAGGCCTGCCCAGGAGGG - Intergenic
1203365408 Un_KI270442v1:251028-251050 AAGAAGAAGCAAACACAGGAAGG - Intergenic
1187820020 X:23277605-23277627 AAGCAGAGACCAGCCCATCATGG + Intergenic
1188207274 X:27375890-27375912 AAGCAGAGGAAAACAAAGGAAGG - Intergenic
1192169318 X:68844519-68844541 CAGCAGGGTCCAACCTAGGATGG - Intergenic
1194712346 X:97251331-97251353 AAGCTGGGGGCAACCCATGAAGG + Intronic
1195830028 X:109046690-109046712 GAGCAGAGGCCACCCCATGGAGG - Intergenic
1195847327 X:109242180-109242202 AACCAGAGACCATCCCTGGAGGG + Intergenic
1197272734 X:124443274-124443296 GAGCAGAAGACAACCAAGGAAGG + Intronic
1197435755 X:126425883-126425905 CAGCTGATGCCAACCCATGAAGG - Intergenic
1198320752 X:135516658-135516680 AGGCAGGGGGCAACACAGGAGGG + Intergenic
1198675785 X:139128505-139128527 AGGCAGAGGCCAGACCAGGAAGG - Intronic
1198742036 X:139852339-139852361 AACCAGAGACCACCCCAGGAGGG - Intronic
1201220753 Y:11767689-11767711 AGGCAGAAACCAACCCTGGATGG + Intergenic