ID: 923160204

View in Genome Browser
Species Human (GRCh38)
Location 1:231308506-231308528
Sequence TCCCCCTGGCCTTACTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923160197_923160204 -2 Left 923160197 1:231308485-231308507 CCTTTGCCTACACCCCTGGCCTC No data
Right 923160204 1:231308506-231308528 TCCCCCTGGCCTTACTTTCCTGG No data
923160195_923160204 0 Left 923160195 1:231308483-231308505 CCCCTTTGCCTACACCCCTGGCC No data
Right 923160204 1:231308506-231308528 TCCCCCTGGCCTTACTTTCCTGG No data
923160191_923160204 29 Left 923160191 1:231308454-231308476 CCAATCTGGCTGTAATTCTTTGG No data
Right 923160204 1:231308506-231308528 TCCCCCTGGCCTTACTTTCCTGG No data
923160196_923160204 -1 Left 923160196 1:231308484-231308506 CCCTTTGCCTACACCCCTGGCCT No data
Right 923160204 1:231308506-231308528 TCCCCCTGGCCTTACTTTCCTGG No data
923160198_923160204 -8 Left 923160198 1:231308491-231308513 CCTACACCCCTGGCCTCCCCCTG No data
Right 923160204 1:231308506-231308528 TCCCCCTGGCCTTACTTTCCTGG No data
923160193_923160204 6 Left 923160193 1:231308477-231308499 CCTTGTCCCCTTTGCCTACACCC No data
Right 923160204 1:231308506-231308528 TCCCCCTGGCCTTACTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923160204 Original CRISPR TCCCCCTGGCCTTACTTTCC TGG Intergenic