ID: 923160981

View in Genome Browser
Species Human (GRCh38)
Location 1:231314352-231314374
Sequence CAGTGTGGCCTGAGTGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923160976_923160981 13 Left 923160976 1:231314316-231314338 CCATAAATATTTATGAAGCACCT No data
Right 923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG No data
923160978_923160981 -7 Left 923160978 1:231314336-231314358 CCTCTCTTGTGCAAGGCAGTGTG No data
Right 923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923160981 Original CRISPR CAGTGTGGCCTGAGTGGAGA TGG Intergenic
No off target data available for this crispr