ID: 923163750

View in Genome Browser
Species Human (GRCh38)
Location 1:231339582-231339604
Sequence ATCGCGGGAGGCGCCCGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923163738_923163750 5 Left 923163738 1:231339554-231339576 CCTTCCTTGCCCGGCGGGGATCG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 923163750 1:231339582-231339604 ATCGCGGGAGGCGCCCGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 101
923163741_923163750 -4 Left 923163741 1:231339563-231339585 CCCGGCGGGGATCGGAGCCATCG 0: 1
1: 0
2: 0
3: 0
4: 50
Right 923163750 1:231339582-231339604 ATCGCGGGAGGCGCCCGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 101
923163740_923163750 1 Left 923163740 1:231339558-231339580 CCTTGCCCGGCGGGGATCGGAGC 0: 1
1: 0
2: 0
3: 7
4: 80
Right 923163750 1:231339582-231339604 ATCGCGGGAGGCGCCCGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 101
923163742_923163750 -5 Left 923163742 1:231339564-231339586 CCGGCGGGGATCGGAGCCATCGC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 923163750 1:231339582-231339604 ATCGCGGGAGGCGCCCGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923163750 Original CRISPR ATCGCGGGAGGCGCCCGCGG GGG Intronic
905212779 1:36385871-36385893 ATGGAGGGAGGCGGCGGCGGCGG - Exonic
909629856 1:77759857-77759879 ATCGCCGGAGACGCCTGCGGCGG - Intergenic
922739373 1:228006884-228006906 GCCGCGGGGGGCGCCCGCCGGGG - Intergenic
923119702 1:230978756-230978778 ACGCCGGGCGGCGCCCGCGGCGG + Exonic
923163381 1:231337299-231337321 GTCGCGGGAGGCACCCCCGGGGG + Exonic
923163750 1:231339582-231339604 ATCGCGGGAGGCGCCCGCGGGGG + Intronic
1062890504 10:1056579-1056601 TTCGCGGGAGGTGGCCTCGGGGG - Intronic
1073297643 10:102450781-102450803 GTCGCTGCAGGCGCCCGCGGCGG - Exonic
1075106381 10:119542637-119542659 ATCGCCGCGGGCGCCCGAGGAGG + Exonic
1083659843 11:64246893-64246915 AGCTCGGGCGGCGGCCGCGGGGG - Exonic
1092163660 12:6329705-6329727 AGCGCGGGAGGCGCTCCCAGAGG - Intronic
1095852466 12:46825921-46825943 ATCGCGGGAGGCTGCCGCCTCGG - Exonic
1102025525 12:109712371-109712393 GCCGGGAGAGGCGCCCGCGGCGG - Intergenic
1102026883 12:109718696-109718718 GCGGCGGGCGGCGCCCGCGGAGG - Intronic
1105378498 13:19864738-19864760 ATCGCGGGGCGCACCCGCTGCGG + Intergenic
1106720080 13:32427778-32427800 GCCGCGGCAGGCACCCGCGGCGG + Intronic
1112216366 13:97434432-97434454 GTCGCGGGCGGCGGCGGCGGCGG + Exonic
1112693054 13:101917171-101917193 AGAGCGGGCGGCGCCGGCGGCGG - Intronic
1115545497 14:34462199-34462221 ATCGCGGGAGGCGCATGGCGGGG - Exonic
1117803105 14:59464974-59464996 AGCGCGGGAGGCGGGGGCGGCGG - Exonic
1119003839 14:70907333-70907355 TCGGCAGGAGGCGCCCGCGGCGG + Intergenic
1122905833 14:104801039-104801061 CTCGGGGCAGGTGCCCGCGGCGG + Exonic
1124291309 15:28455930-28455952 ATCGAGGGTGGCGGCTGCGGGGG + Intergenic
1126738156 15:51751925-51751947 CGGGCGGGAGGCGCCCGCCGGGG + Intronic
1127588392 15:60398516-60398538 TTCCCGGGGGGCGCCCGGGGAGG + Intronic
1128119240 15:65133563-65133585 GCCGCGGGAGGCCTCCGCGGAGG + Exonic
1131061190 15:89405695-89405717 AAGGCGGGAGGTGCCCGCGCGGG + Intergenic
1138179793 16:54933382-54933404 ACCGCAGGAGGCGGCGGCGGAGG - Exonic
1138439590 16:57026095-57026117 ATCGCGGGAGGGGGCCCTGGTGG + Exonic
1142752769 17:1998428-1998450 CTCGCGGGAGCCGCCGGCCGGGG + Intronic
1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG + Exonic
1152921369 17:83068173-83068195 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921384 17:83068208-83068230 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921398 17:83068242-83068264 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921409 17:83068276-83068298 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921422 17:83068310-83068332 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921434 17:83068344-83068366 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921445 17:83068378-83068400 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921458 17:83068412-83068434 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921472 17:83068446-83068468 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921483 17:83068480-83068502 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921496 17:83068514-83068536 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921510 17:83068548-83068570 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921521 17:83068582-83068604 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921534 17:83068616-83068638 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921547 17:83068650-83068672 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921561 17:83068684-83068706 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921575 17:83068719-83068741 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921589 17:83068754-83068776 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921603 17:83068789-83068811 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921616 17:83068823-83068845 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921631 17:83068858-83068880 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1161080596 19:2308162-2308184 AGCCCGGGAGGCGGCGGCGGCGG - Intronic
1161332649 19:3695615-3695637 ATCCCGGGAGGCGGCCAGGGCGG + Intronic
1162032653 19:7924145-7924167 ATCTGGGGAGGCGCCGGGGGTGG - Intergenic
1162079147 19:8208684-8208706 TTCGCCCGAGGCGCGCGCGGGGG - Intronic
1163106330 19:15125030-15125052 AGCGGGGGCGGCGGCCGCGGGGG + Exonic
1163663003 19:18589572-18589594 CTCGCGGGAGGTGCTGGCGGTGG + Exonic
1165775673 19:38403174-38403196 AGCGTGGGAGGGGGCCGCGGTGG + Exonic
1166043902 19:40218305-40218327 AGGGCGGGAGGCGGGCGCGGCGG + Exonic
1167960966 19:53103650-53103672 ACCGCGGGAAGGGACCGCGGGGG + Intergenic
929778340 2:44942231-44942253 GGCGCGGGAGGCGGCAGCGGCGG + Exonic
931052306 2:58428496-58428518 AGCGGGGGTGGCGCGCGCGGCGG - Intergenic
935196195 2:100818613-100818635 AGCGCGCCAGGCCCCCGCGGTGG - Intergenic
944070008 2:195657621-195657643 CTCGCGGGCCGCGCCCGGGGTGG + Intronic
947472483 2:230412026-230412048 AACGCGGGAGGCGGACACGGGGG + Intergenic
948102292 2:235384714-235384736 AGCAGGGGAGGCGCTCGCGGGGG - Intergenic
948207006 2:236167778-236167800 AGCGCGGGCGGCGGCGGCGGCGG + Exonic
1171292141 20:23988560-23988582 ATGGCGGGAGGCGGACGTGGGGG - Intronic
1176005768 20:62861634-62861656 ACCGCGGGAGCCGCCGCCGGAGG - Exonic
1176952665 21:15064957-15064979 AACTCGGGAGGCGGCGGCGGAGG - Exonic
1180823204 22:18846321-18846343 ATGGCGGGAGGCGGACGTGGGGG - Intergenic
1181123630 22:20689420-20689442 ATGGCGGGAGGCGGACGTGGGGG - Intergenic
1181189540 22:21128225-21128247 ATGGCGGGAGGCGGACGTGGGGG + Intergenic
1181209662 22:21282270-21282292 ATGGCGGGAGGCGGACGTGGGGG - Intergenic
1181399851 22:22644674-22644696 ATGGCGGGAGGCGGACGTGGGGG + Intronic
1181649560 22:24251394-24251416 ATGGCGGGAGGCGGACGTGGGGG - Intergenic
1181707811 22:24659352-24659374 ATGGCGGGAGGCGGACGTGGGGG + Intergenic
1183671958 22:39278242-39278264 ATCCCGGGAGGCGGCGGCCGAGG - Intergenic
1203217286 22_KI270731v1_random:13163-13185 ATGGCGGGAGGCGGACGTGGGGG + Intergenic
1203273344 22_KI270734v1_random:72227-72249 ATGGCGGGAGGCGGACGTGGGGG - Intergenic
950012314 3:9732094-9732116 ATCGCCGGGGGCGCCCGCCGGGG - Exonic
950618081 3:14178421-14178443 TTCGCGGGAGACGCCGCCGGTGG - Exonic
954152417 3:48664044-48664066 ATCGCGGGAGCCGCACCCTGTGG - Intergenic
968235660 3:197029076-197029098 ATCGCGGGCGGCGACCGCCGAGG - Intronic
968621733 4:1606418-1606440 GTCCCGCGAGGAGCCCGCGGCGG - Intergenic
975166767 4:71186775-71186797 CTCACGGAAGGCGGCCGCGGCGG - Intergenic
975763033 4:77636320-77636342 ATCACGGGACGAGCCCACGGTGG + Intergenic
975778730 4:77818770-77818792 GTCCCGGGAGGCGTCCGGGGAGG + Intronic
978438348 4:108709448-108709470 ATGGCGGGAGGAGCCTGAGGTGG - Intergenic
978741829 4:112145681-112145703 ATCCCGGGGCGAGCCCGCGGCGG + Exonic
981070002 4:140524424-140524446 TTCGCGGGCGGCGCGCGAGGGGG + Intronic
982745809 4:159103385-159103407 ATGGGGGGAGGCGGCGGCGGCGG + Intergenic
983577060 4:169271173-169271195 AGCGCGGGAGGCCGGCGCGGCGG - Intergenic
986330545 5:6713733-6713755 AGCGCCGGAGCCGCCCGCCGCGG + Intergenic
996765453 5:127030734-127030756 CTGGCGGGACGCGCCGGCGGCGG + Exonic
1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG + Exonic
1002526711 5:179819358-179819380 ATCGCGGGAAGTTTCCGCGGGGG - Intronic
1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG + Intergenic
1019153415 6:170023688-170023710 ATCCTGGGAGGCGCTCGGGGAGG + Intergenic
1039454608 8:37698430-37698452 ATGGCAGGAGGCGGCGGCGGCGG - Exonic
1040564855 8:48556194-48556216 CGCGCGGGAGGGGACCGCGGAGG - Intergenic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1043463954 8:80486952-80486974 AGCGCGGGCGGCGCTGGCGGCGG - Exonic
1049663130 8:143829320-143829342 AGAGTGGGAGGCGCGCGCGGAGG - Exonic
1055321638 9:75088371-75088393 AGCGCGGGCGGCGCGCACGGCGG - Intergenic
1061889303 9:133609241-133609263 AGCCCGGGAGGCCCCCGGGGAGG + Intergenic
1200086509 X:153609884-153609906 ATCCCAGGAGGGGCTCGCGGCGG - Intergenic