ID: 923165298

View in Genome Browser
Species Human (GRCh38)
Location 1:231355841-231355863
Sequence AGTGTTTAACAGATGTAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923165298 Original CRISPR AGTGTTTAACAGATGTAGTA AGG (reversed) Intergenic
903863628 1:26381372-26381394 AGTGTTGAATAGAAGTGGTAAGG - Intergenic
909388635 1:75091321-75091343 AGTGTATAAATGATGCAGTAAGG + Intergenic
910341281 1:86190916-86190938 AGCATTTAACAGATTTAGAAGGG - Intergenic
913523309 1:119666847-119666869 AATGTTCAACAGAAGTAGAATGG - Intronic
915843403 1:159236666-159236688 GGTGTCTAACAGTTGTTGTAAGG - Intergenic
915877483 1:159627097-159627119 AGTGTTTAACACATGTTAAAGGG + Intergenic
917401490 1:174653951-174653973 AGTGTGTAAGAAATGTATTATGG + Intronic
918290488 1:183102770-183102792 AGTGTTTGAGAGATGTAGCAGGG - Intronic
922184910 1:223265652-223265674 AGTGTTTCACAGAAGGAGTGTGG - Intronic
923165298 1:231355841-231355863 AGTGTTTAACAGATGTAGTAAGG - Intergenic
923547230 1:234931683-234931705 TGTGTTTAAAACATGTAGTTAGG + Intergenic
923586062 1:235272120-235272142 AGTGTTTAATACATGTTGTGTGG - Intronic
924524310 1:244833257-244833279 ATTGTTTAACAGTTATAGAAAGG - Intergenic
1065595523 10:27307033-27307055 AGTTTTTAACAGAGGTATAATGG + Intergenic
1065653970 10:27927063-27927085 AGTTTTTAAAAGAAGTAGTCTGG + Intronic
1068863600 10:61871247-61871269 ATTGCTTAAAAGATGTATTATGG - Intergenic
1069757875 10:70784924-70784946 AGTGTGCATCATATGTAGTACGG - Intronic
1072093387 10:92151798-92151820 AGTGTTTAACAGATGGTGTCAGG - Intronic
1075364097 10:121867552-121867574 AGTGTTTGACAGGTGTACAACGG - Intronic
1077345124 11:2044376-2044398 AGTGAATAACATATGGAGTATGG - Intergenic
1078671460 11:13369456-13369478 AGGCTTTAACAGATGCAGCATGG - Intronic
1082377674 11:51894390-51894412 AGTGTTTGAAAGCTGTACTATGG - Intergenic
1083648603 11:64186949-64186971 AGTGTTTTACAAATGTATTGCGG + Intronic
1085962612 11:81480469-81480491 AGTGTTTAGCAGATTTAGTAAGG - Intergenic
1086225162 11:84499117-84499139 AGTGGTTAAGAGCTGAAGTAGGG + Intronic
1086376854 11:86209774-86209796 AGTGTTTAACACATTCTGTAAGG + Intergenic
1087434828 11:98101602-98101624 AGTGATTAACAGATGTACAGAGG + Intergenic
1087565357 11:99849039-99849061 AGTGTTTAATAAACGTAGGATGG + Intronic
1090823355 11:130364849-130364871 ACTGTTCAACACATGTTGTAAGG - Intergenic
1093829195 12:23735094-23735116 AGTGTTTCACAAATGGAGAAGGG + Intronic
1093857636 12:24125620-24125642 ATGGTTTAACAGATGTGTTAAGG + Intergenic
1094017718 12:25882637-25882659 TGTCTTTAAAAGATGTTGTAGGG - Intergenic
1094039397 12:26106961-26106983 AGAGAATAACAGATTTAGTAAGG + Intergenic
1095369934 12:41454920-41454942 ACTGTTGAACAGTTGAAGTATGG + Intronic
1097911173 12:64971055-64971077 AGAATTTGCCAGATGTAGTAAGG + Intergenic
1098713478 12:73799026-73799048 ATTGTTTAACATATACAGTAAGG - Intergenic
1100373915 12:93994761-93994783 AGTGTTTTACAGATGTCATGTGG - Intergenic
1111866732 13:93778120-93778142 AGAGGTTAACAGATTTAGCAGGG - Intronic
1114591503 14:23869191-23869213 AGTTTTTAAGAGATGGGGTAGGG + Intergenic
1114976237 14:28103981-28104003 ATTGTTTAATAGATGTGGTATGG - Intergenic
1117190004 14:53280048-53280070 AGTGTTTAACTGAAGTAGAGTGG + Intergenic
1117864387 14:60130533-60130555 AATGTTTAATAGAAGTGGTAAGG - Intronic
1119105808 14:71922541-71922563 AGTTTTTGACAAATGTACTATGG - Intergenic
1121859249 14:97300925-97300947 AATGTTTAAAAGATGTATTTGGG + Intergenic
1124828864 15:33128141-33128163 AGAGTGTAACAGAAGTAGGATGG + Intronic
1125116369 15:36096807-36096829 AATGTTTAATAGAAGTGGTAGGG - Intergenic
1127930420 15:63592890-63592912 AGTGTTTAGCAGATGTGTTCTGG - Intronic
1128244758 15:66125688-66125710 AGTGTTTAATAGATGTTGACAGG + Intronic
1130815107 15:87423360-87423382 ATGGTTTAACAGAAATAGTATGG + Intergenic
1131163389 15:90124761-90124783 GGTGTTTAAAAGCTGTAGTCAGG + Intergenic
1137451219 16:48576481-48576503 GGAGATTTACAGATGTAGTAGGG - Intronic
1137784915 16:51130524-51130546 AGAGTATACCACATGTAGTAAGG - Intergenic
1139753551 16:69124337-69124359 AATGTTTACCACCTGTAGTATGG + Intronic
1141144453 16:81519140-81519162 ATTTTTTAACAGAAGTAGCAGGG + Intronic
1145221933 17:21096633-21096655 AGTGATTAACAGTTGTAATGGGG - Intergenic
1156423643 18:36984214-36984236 AATGTTGAATAGATGTGGTAAGG - Intronic
1157060393 18:44281465-44281487 AGTGTTTAGCAAATGGAGTGAGG + Intergenic
1158037976 18:53057381-53057403 AGTGTTTATCATATTTAGAAAGG - Intronic
1159128361 18:64251750-64251772 AGTTTTGAACAGAAATAGTAAGG + Intergenic
1159659606 18:71077689-71077711 AGTGTTTCACAGAAATAGGAAGG - Intergenic
1160245159 18:77152439-77152461 AGTGTTTAACAAAGGAAGGACGG + Intergenic
1164103391 19:22079733-22079755 AGTTTTTAACAGAAATAATATGG - Intronic
927439966 2:23107459-23107481 AGTGTTTAACAGTTGGAATGGGG + Intergenic
927457617 2:23270210-23270232 AGTGTTTAAGACCAGTAGTAAGG - Intergenic
931183914 2:59931066-59931088 AGTGTGTAAAGGATGTAGTATGG + Intergenic
933667272 2:84973522-84973544 AGTCTTCAACAGATGTATTTAGG - Intronic
934537546 2:95148136-95148158 TGTGGTTCACAGCTGTAGTATGG - Exonic
936225311 2:110644133-110644155 AATGTATAACAGATGTAGAATGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937559227 2:123200621-123200643 TTTGTTTAAAAGATGTAGTTTGG + Intergenic
939152867 2:138493851-138493873 AGTATTTAACAAATGAAGCATGG + Intergenic
940640454 2:156340881-156340903 ACTGATTAATAGATGAAGTATGG - Intronic
941536044 2:166723189-166723211 AGAGATTTACAGAAGTAGTAAGG - Intergenic
943382800 2:187172075-187172097 AGTGTTTCTAATATGTAGTAGGG + Intergenic
943837861 2:192537775-192537797 AGTGTTTATCTGATGAATTATGG - Intergenic
944419739 2:199516873-199516895 AATGTTTATCAACTGTAGTATGG - Intergenic
947509326 2:230736247-230736269 AGTATTTAACAAATTTAGCATGG + Intronic
1169001858 20:2173666-2173688 AGTGTTAAATAAATGTATTATGG + Intronic
1177295375 21:19166665-19166687 TGTGATTAACATCTGTAGTAGGG + Intergenic
949560525 3:5197704-5197726 AGGCTTTAACAGATGTGCTAGGG + Intronic
949636915 3:5992729-5992751 AGTATTTTACATATGTAGAAAGG - Intergenic
952648696 3:35695687-35695709 AGACTTAAACAAATGTAGTAAGG + Intronic
952998691 3:38909883-38909905 AGTTTCTAACAGAATTAGTAAGG + Intronic
955795851 3:62636362-62636384 AGTCTTTAACAGCTGCAGTCTGG - Intronic
955946782 3:64202801-64202823 AATGTTCAACAGAAGTAGCAAGG + Intronic
957837782 3:85620684-85620706 ATTGTTTAAAAGATGTTTTAAGG - Intronic
958016934 3:87948922-87948944 AGTGTTTAACAGATTCAAGAGGG - Intergenic
961134438 3:124496646-124496668 AGAGTTTAACAGAAGTGGGAAGG + Intronic
962625450 3:137221280-137221302 AGTGTTAAATAGCTGTAATATGG + Intergenic
964427837 3:156571870-156571892 ACTAGTTAACAGATGTGGTAAGG - Intergenic
964884897 3:161470894-161470916 ACTGTTTAAAAGATTTACTAAGG + Intergenic
965560095 3:170053623-170053645 AATGTTGAGTAGATGTAGTAAGG + Intronic
966526607 3:180925912-180925934 AATATTTAACTGATGTAGTTGGG + Intronic
971008135 4:22398536-22398558 AGTGATGAACAGAGGTTGTAGGG - Intronic
973291444 4:48474916-48474938 ACTGTTTTGCAGATGTAGTGGGG + Intergenic
973843589 4:54888111-54888133 AATGTTTAAAACATTTAGTAAGG - Intergenic
975760031 4:77610826-77610848 ATTGCTTATCAGATGGAGTAGGG + Intronic
976530446 4:86146157-86146179 AGTGAATAACAGATGTAGAAAGG + Intronic
977967960 4:103177575-103177597 TCTGTTAAAAAGATGTAGTAAGG - Intronic
978228620 4:106369592-106369614 TGTGTTTATCAGATGAAGGAAGG - Intergenic
979037307 4:115738374-115738396 AAGCTTTAAAAGATGTAGTAAGG - Intergenic
981465072 4:145058627-145058649 ATTATTTAAGAGATGTAGTCTGG - Intronic
984360937 4:178730970-178730992 AGTGTTTAACATATCCAGTTTGG - Intergenic
991124193 5:63051159-63051181 AGTGTTTTATAGATGTTGTGAGG - Intergenic
996000944 5:118362863-118362885 AGTGTGTAACAGCTATAGCAAGG - Intergenic
999635205 5:153614606-153614628 AGTGCTTAACAGGAGTAGCATGG - Intronic
1009725884 6:67535475-67535497 AGTTTTTAATAGATGTTGTATGG + Intergenic
1010443171 6:75921570-75921592 TGTGTTTATCAGACGTAGTGTGG + Exonic
1011854916 6:91677832-91677854 AGTGTTTAACATTTATATTAAGG - Intergenic
1011995074 6:93576347-93576369 AGTGCTAAACAGATGGAGTACGG + Intergenic
1013350319 6:109299872-109299894 AGTGCCTAACAGATATACTAAGG + Intergenic
1014701201 6:124690983-124691005 AGTGTTTAAGATTTGTAGGAAGG + Intronic
1015182828 6:130379144-130379166 AGTTTTTAACACATGAAGTTTGG + Intronic
1017201996 6:151764305-151764327 TGTGTTAAACATATGGAGTATGG + Intronic
1018774760 6:167003067-167003089 AGTAATTAACAGTTGTAGAATGG + Intronic
1018976188 6:168568931-168568953 AGTGGTAAACAGATGAACTATGG - Intronic
1021295146 7:18895283-18895305 AGTGATTATCTGATGTACTAAGG + Intronic
1021392634 7:20112789-20112811 AGTGTTTAGCACATGCAGTGAGG - Intergenic
1028083689 7:86610259-86610281 AGTTTTTAACAGCTTTATTAAGG - Intergenic
1028318701 7:89435355-89435377 AGTTTTTAAGAGCTGGAGTAGGG - Intergenic
1029139154 7:98397637-98397659 AGTCTTTAACAGTTCTAGGAAGG + Intronic
1030757186 7:113301320-113301342 AGGGTTGAACAGATGAAGCACGG - Intergenic
1030928210 7:115484374-115484396 AGTGTTTAACAAATTTAATGGGG + Intergenic
1031486484 7:122332641-122332663 ATTTTTTAAAAGATGAAGTATGG - Intronic
1031956572 7:127948511-127948533 AGTGTTTATCTGATGAACTACGG - Intronic
1033889888 7:145998914-145998936 AGTGTTTAACATATGCAGAATGG - Intergenic
1034440726 7:151084537-151084559 ATTTTTTAAAAGATGTACTATGG + Intergenic
1035438924 7:158879672-158879694 CGTGTTTTACAGCTGCAGTACGG + Exonic
1042118977 8:65463468-65463490 AATGTCTAACAGATGTATTCAGG + Intergenic
1042145252 8:65721574-65721596 AGTGTTGTACAGATCTAGAATGG - Intronic
1042713940 8:71751140-71751162 GGTGTTTAACAAATGAAGTAAGG - Intergenic
1042969812 8:74395991-74396013 AGTGTCTCACATGTGTAGTAAGG + Intronic
1043636409 8:82389074-82389096 AGTGTTTAATAGATGTATATTGG + Intergenic
1045131092 8:99153840-99153862 AGAATTTAACACATCTAGTAAGG + Intronic
1045237049 8:100361351-100361373 AGTGTAGAACAGATGTAGGAAGG + Intronic
1045668321 8:104515875-104515897 AGTAATTAAGAGATGTATTAAGG - Intronic
1045997297 8:108378167-108378189 AGTTTTAAAAAGATGTATTAAGG + Intronic
1046023272 8:108691752-108691774 AGTGTTCTACAGTTGTAGTAAGG + Intronic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1049987357 9:964026-964048 AGTGTTTAACATATAGAGGAAGG + Intronic
1051316995 9:15848831-15848853 AATGTGTAACAGTTGTAGTAAGG + Intronic
1051805004 9:20982622-20982644 GGTGCTTAACAAATGTTGTATGG + Intronic
1052384551 9:27808093-27808115 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1052517114 9:29496508-29496530 AGAGTTTAAAAGAAATAGTATGG - Intergenic
1053369220 9:37546421-37546443 AGACTTCATCAGATGTAGTAGGG + Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055174660 9:73302325-73302347 AGTGTTCAACAAATTTAGTATGG + Intergenic
1055515301 9:77027533-77027555 ACTATTTAATAGATGCAGTACGG + Intergenic
1056249317 9:84731945-84731967 AGTGATTAACAGATGGGGAAGGG - Intronic
1192828015 X:74718805-74718827 TGTGCTTAACAGGTGTATTAGGG - Intergenic
1192873490 X:75206465-75206487 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1193702602 X:84780892-84780914 AGTTTTAAACTAATGTAGTATGG + Intergenic
1194936629 X:99957934-99957956 ATTGTTTAACTAATGTAGCATGG - Intergenic
1197521438 X:127502712-127502734 ATTGTTTAAAAGATATAATATGG - Intergenic
1199093733 X:143717651-143717673 AGTTTTTAAAAGCTGGAGTAGGG - Intronic