ID: 923171280

View in Genome Browser
Species Human (GRCh38)
Location 1:231420380-231420402
Sequence GTTTCAAAACAGTAGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 215}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923171277_923171280 -9 Left 923171277 1:231420366-231420388 CCTTTTTGTAACGGGTTTCAAAA 0: 1
1: 0
2: 2
3: 15
4: 146
Right 923171280 1:231420380-231420402 GTTTCAAAACAGTAGGAACAGGG 0: 1
1: 0
2: 1
3: 24
4: 215
923171270_923171280 30 Left 923171270 1:231420327-231420349 CCTACACTGAGAGGCCTGAAGAC 0: 1
1: 0
2: 1
3: 12
4: 230
Right 923171280 1:231420380-231420402 GTTTCAAAACAGTAGGAACAGGG 0: 1
1: 0
2: 1
3: 24
4: 215
923171275_923171280 -7 Left 923171275 1:231420364-231420386 CCCCTTTTTGTAACGGGTTTCAA 0: 1
1: 0
2: 0
3: 6
4: 79
Right 923171280 1:231420380-231420402 GTTTCAAAACAGTAGGAACAGGG 0: 1
1: 0
2: 1
3: 24
4: 215
923171272_923171280 16 Left 923171272 1:231420341-231420363 CCTGAAGACGGAAATACTTCTTT 0: 1
1: 0
2: 0
3: 6
4: 142
Right 923171280 1:231420380-231420402 GTTTCAAAACAGTAGGAACAGGG 0: 1
1: 0
2: 1
3: 24
4: 215
923171276_923171280 -8 Left 923171276 1:231420365-231420387 CCCTTTTTGTAACGGGTTTCAAA 0: 1
1: 0
2: 0
3: 9
4: 176
Right 923171280 1:231420380-231420402 GTTTCAAAACAGTAGGAACAGGG 0: 1
1: 0
2: 1
3: 24
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923171280 Original CRISPR GTTTCAAAACAGTAGGAACA GGG Intronic
900533082 1:3164333-3164355 GTTTCTAAAAATTAGAAACAAGG - Intronic
900780333 1:4613805-4613827 GGTTCAAAAGAGAGGGAACATGG + Intergenic
904653190 1:32022183-32022205 GTTTCACCATAGTAGAAACAGGG + Intronic
906129329 1:43446762-43446784 GTTACAATACAGTATGAAAAAGG + Intronic
908728307 1:67200000-67200022 TTTTCTAAACAGTAGAGACAGGG - Intronic
910723680 1:90315132-90315154 GTTTGAAAAAAGTAGGCAAAAGG - Intergenic
911048832 1:93652159-93652181 CTTTCAGAACAGAATGAACAAGG - Intronic
912376102 1:109211179-109211201 ATTTCAAAACATGAGGGACAAGG + Intergenic
912399788 1:109380552-109380574 TTTTCAAATCAGTAGGAAACAGG + Intronic
916299448 1:163257519-163257541 GTGTGAAAAAAGTAGTAACATGG - Intronic
916316643 1:163455722-163455744 GTTTTAAAACAGAAGAACCAGGG + Intergenic
916481635 1:165219644-165219666 GTTTCAAAACAGTAGCTACATGG - Intronic
919350038 1:196439796-196439818 GTTCCAAAACAATAGTAATATGG + Intronic
921223530 1:212993590-212993612 TTTTGTAGACAGTAGGAACAAGG - Exonic
922322865 1:224503408-224503430 GGGTCAAAACAGGAGGAAGAAGG - Intronic
922668285 1:227490970-227490992 GTTTCAAAACAGTACAGACAGGG - Intergenic
923171280 1:231420380-231420402 GTTTCAAAACAGTAGGAACAGGG + Intronic
1063843898 10:10103700-10103722 GCTTCAAATCAGTAGCATCAGGG + Intergenic
1063912350 10:10844279-10844301 TTTTCAAAACATTCAGAACAAGG + Intergenic
1073023506 10:100467927-100467949 GGTTCAAAACAGGAAGAAGAGGG + Intronic
1076195583 10:128515326-128515348 GCATCAAAACAGTGGGAATATGG + Intergenic
1080741234 11:35066242-35066264 GTTACCAAAGAGTAGGAAAATGG - Intergenic
1081305310 11:41504656-41504678 GTTTAAAAAAAGTAGTCACATGG - Intergenic
1083612920 11:64012836-64012858 GTCTCAAAAAACAAGGAACAAGG - Intronic
1085826891 11:79857648-79857670 GTTTCACTACAGTAGGCAAATGG + Intergenic
1086367307 11:86120656-86120678 GTTTCAAAAGAGTTGGAACTTGG + Intergenic
1086546055 11:87968889-87968911 GATTCAGAACAGTAGGAGGATGG + Intergenic
1087283969 11:96244145-96244167 ATTTCAAAACATCTGGAACACGG - Intronic
1087317662 11:96622924-96622946 GATTCAAAATAGTTGGAAAAAGG + Intergenic
1088084917 11:105965966-105965988 GTTTTAAAACTGAATGAACAAGG + Intronic
1088124821 11:106411856-106411878 TTTTCAAATCAGTAGGGAGAGGG + Intergenic
1090593516 11:128296246-128296268 GTTTCCAAACATTATGAACAGGG - Intergenic
1090841554 11:130493115-130493137 CTTTCAAAACAGAAAGAACCAGG - Intergenic
1091204782 11:133812729-133812751 GTGTAAAAACAGAAGGAAAATGG + Intergenic
1091506403 12:1073644-1073666 GTCTCAAAACAGAAGGGACTTGG + Intronic
1092696756 12:11180037-11180059 GTTGAAAAACAGTAAGAGCAAGG + Intergenic
1093285089 12:17249353-17249375 GTTTTAAAATGGTAGGAACTAGG - Intergenic
1093300395 12:17446238-17446260 GCTACAACACAATAGGAACAAGG - Intergenic
1093309933 12:17567582-17567604 GTTTGAAAAGAGTAGGAACGTGG + Intergenic
1094678279 12:32643820-32643842 GTTTCCAAAAAGTAAGGACAAGG - Exonic
1094796879 12:33984722-33984744 CTTTCAAAACAGTAAGAAACTGG - Intergenic
1095266060 12:40159262-40159284 TTTTCAAAATGGCAGGAACACGG - Intergenic
1095886510 12:47194043-47194065 GTCTCAACACAGTATGACCAAGG - Intronic
1095918923 12:47509278-47509300 GTTACATAATAGTAGGCACATGG + Intergenic
1100860725 12:98803638-98803660 TTTTCAAAAAAGTCTGAACACGG + Intronic
1102414841 12:112751741-112751763 TTTTCTAAAAAATAGGAACAGGG - Intronic
1102736648 12:115167432-115167454 GATTCAAAGCAGTAGAAATAAGG - Intergenic
1105668192 13:22584080-22584102 ATTTGAAAACAATGGGAACAAGG - Intergenic
1106098920 13:26677491-26677513 GTTTCAAAACAACAGCAACCTGG + Intronic
1107139454 13:36981785-36981807 GTTTAAAAACTGTAAGAACTGGG + Intronic
1107995945 13:45861131-45861153 CTTTCAAAACAGGAGAAACCAGG - Intergenic
1108793705 13:54004803-54004825 GTTTTAAAACAGAAATAACATGG - Intergenic
1111431199 13:88150188-88150210 AGTTCACAACAGTAGGGACAAGG - Intergenic
1112540201 13:100302689-100302711 ATTTCAATAAAGTATGAACAAGG + Intronic
1112773394 13:102817405-102817427 GTTTCACATCAGAAGGCACATGG + Intronic
1112879464 13:104088052-104088074 TCTTCAAAGCAGTAGGAAAATGG - Intergenic
1114071664 14:19114519-19114541 GTATTAAAAAAGTATGAACAAGG + Intergenic
1114090598 14:19285449-19285471 GTGTTAAAAAAGTATGAACAAGG - Intergenic
1115452872 14:33568708-33568730 GTTTCATGACAGAAGTAACATGG + Intronic
1116723584 14:48532227-48532249 TTTTCAAAACAGAAAGCACAAGG - Intergenic
1116812416 14:49552176-49552198 GTTTAAAATGAGTAGGAAAAAGG + Intergenic
1117404431 14:55387960-55387982 GTTTCAAAACTGTAAGAAATTGG - Intronic
1118484116 14:66197714-66197736 AGTTCAAAACAGTAGAAAAAAGG + Intergenic
1119747566 14:77055078-77055100 GTTTCAAAACTTTAAGAAAAGGG - Intergenic
1120651932 14:87144849-87144871 GTTTCAAAATATTAGGAAAATGG - Intergenic
1121801326 14:96776685-96776707 GTTTCACAACAGTGGGAATATGG - Intergenic
1122070975 14:99205132-99205154 CTTTCACAACAGTAGGAAGAGGG + Intronic
1124567033 15:30825617-30825639 GTCTCAAAAAAGTAGAAAAAAGG - Intergenic
1131100698 15:89687599-89687621 CTTACAAGACAGTAGGAACCAGG - Intronic
1131913896 15:97240102-97240124 TTATCAAAACAGAAGGGACAGGG - Intergenic
1132262128 15:100434903-100434925 GTTTAAAAATAATGGGAACAAGG + Intronic
1133379457 16:5317935-5317957 GTTACCAGACACTAGGAACAGGG - Intergenic
1133663750 16:7944916-7944938 CTTTCAAAACAGTGTGAAGATGG - Intergenic
1134177644 16:12020958-12020980 GATTTAAGACAGTAAGAACAAGG - Intronic
1134881901 16:17752282-17752304 CTTTCCAAACAATAGGAATAAGG - Intergenic
1135166058 16:20140175-20140197 GTTTCATAAGAGCAGGAACTTGG + Intergenic
1135305607 16:21365151-21365173 GTTTCAAGACAATAGAAACCAGG - Intergenic
1136302349 16:29344305-29344327 GTTTCAAGACAATAGAAACCAGG - Intergenic
1138636406 16:58342155-58342177 ATTTCAAATCAGTAGGGAAAAGG - Intronic
1138812794 16:60170772-60170794 CTTTCAAGACAGAAGGAATACGG + Intergenic
1139056697 16:63194462-63194484 ATTTTAAAACAGTAAGAAGAAGG + Intergenic
1139641512 16:68295081-68295103 GTTTGAAAACTGTGGGAAAATGG - Intronic
1140237678 16:73173678-73173700 GTTTCAGAACAGTAGCCACATGG - Intergenic
1140803869 16:78514705-78514727 GTTTAAAAACAGTATGTACAGGG + Intronic
1141453690 16:84123399-84123421 TTTTCAAAGCACTAGGTACATGG + Exonic
1141597903 16:85108373-85108395 GTTTCAGGACAGTAGGAAGATGG + Intronic
1146417889 17:32653890-32653912 GTTTCAATTCATTAGCAACAGGG + Exonic
1146619460 17:34386263-34386285 GTCTCCAAGCAGTAGCAACAAGG + Intergenic
1146931798 17:36783009-36783031 GTATCAAGTCAGAAGGAACAAGG - Intergenic
1151452664 17:74208211-74208233 GTTTTTAAAGAGTTGGAACAAGG + Intronic
1151741369 17:75984678-75984700 GCTTCAAAACAATCAGAACAAGG - Intronic
1153211717 18:2773955-2773977 GTAGAAATACAGTAGGAACAAGG + Intronic
1153346155 18:4028438-4028460 GTTTTAAAAAAGCAGGCACAGGG + Intronic
1154427459 18:14283159-14283181 GATTCAAAACAATGGGAAAAAGG + Intergenic
1156671770 18:39479375-39479397 CTTTCAAAACAGGAAGAGCAAGG - Intergenic
1157107589 18:44789097-44789119 GTTTTAAAACAGGAGGAAGCCGG - Intronic
1159212922 18:65350975-65350997 TTTTCACAATAGGAGGAACATGG + Intergenic
1164434189 19:28214850-28214872 GTCTGAAAACAGTAGGAATGAGG - Intergenic
1167859402 19:52270621-52270643 GTTGCCAGACAGTAGGGACAAGG + Intronic
926728854 2:16019568-16019590 GTTTCTAAGCAGAAGGAACCTGG - Intergenic
930373417 2:50533636-50533658 GGTTTAAAAAAGTAGGAACACGG - Intronic
930535803 2:52644719-52644741 ATTTCAAAACAAAAGGAAGAAGG - Intergenic
932491131 2:72121847-72121869 GTATCAACCCAGTAGGACCAGGG - Intergenic
933744706 2:85561954-85561976 GTTTCAAAGCAGTAGGGGCCGGG + Intronic
933940742 2:87243031-87243053 TTTTCAAAATATTAGGAACTTGG - Intergenic
934513021 2:94963308-94963330 GTTTCAACACATTAGGAATTTGG + Intergenic
935081295 2:99798095-99798117 GTTTGACAACAATAGGAAAAAGG + Intronic
936069985 2:109361438-109361460 CTTTCAAAACAGAAAGAACCAGG - Intronic
936352397 2:111722982-111723004 TTTTCAAAATATTAGGAACTTGG + Intergenic
937767932 2:125683368-125683390 GTTTCAAATCAACAGGAGCATGG - Intergenic
939557770 2:143697205-143697227 CTTTCCTAAAAGTAGGAACAGGG - Intronic
940805247 2:158180051-158180073 CTTTCAAAAGAGTAGGCACCTGG + Intronic
942095431 2:172532784-172532806 TTTGCAAAACAGCAGAAACAAGG + Intergenic
942103554 2:172610432-172610454 GTTTCAAAAACCTAGGCACAGGG - Intergenic
943246858 2:185465072-185465094 TTTTCAAAACAGAAAGAACCAGG + Intergenic
943511778 2:188835673-188835695 GGTGCAGAACAGTAGCAACACGG - Intergenic
943593630 2:189829417-189829439 GTTAAAAAGCAGTAGGAACAAGG - Intronic
944050459 2:195462686-195462708 GTTTCTAAAAAGTAGAAACTGGG - Intergenic
944222654 2:197317730-197317752 GCTACAACACAGTGGGAACAGGG + Intergenic
945828744 2:214757179-214757201 GTTTCACAGCAGTATGAAAAGGG + Intronic
947511613 2:230759823-230759845 TTTCAAAATCAGTAGGAACAGGG - Intronic
1172677133 20:36680951-36680973 TCTTCTAAACAGTTGGAACATGG + Intronic
1177352050 21:19955908-19955930 ATTTCAAAATAGTTAGAACAGGG - Intergenic
1178614411 21:34118487-34118509 GCTTTAAAACAGTAGGTAAATGG - Intronic
1178726732 21:35059289-35059311 TTTTAAAAAAAGCAGGAACAAGG - Intronic
1179722785 21:43324930-43324952 CTTGCAAAACATTAGGAACCGGG - Intergenic
1179962848 21:44780192-44780214 GTTTCAAACCAGTAGTAAACCGG - Intronic
1180490105 22:15836850-15836872 GTATTAAAAAAGTATGAACAAGG + Intergenic
1183554405 22:38513975-38513997 GTTTGAAAACAATAGCAGCACGG + Intergenic
952537754 3:34331095-34331117 GTTTCAAAAAATTAAGAGCAAGG - Intergenic
953709386 3:45257380-45257402 GTTACACAGCAATAGGAACAAGG - Intergenic
955541610 3:59982793-59982815 GTTCCAAGACAGTAGGGACTGGG - Intronic
955630865 3:60973311-60973333 CTTTCAAAGAAGTAGGACCATGG - Intronic
956507619 3:69959462-69959484 ACTTCAAGACAGTAGAAACAGGG + Intronic
956596636 3:70974169-70974191 GATTCAAAAAAGTTGGAAGAAGG + Intronic
957750939 3:84414423-84414445 GTTTTACAAAGGTAGGAACAAGG - Intergenic
957898944 3:86462982-86463004 GTTGCAACTCAGTAGGCACATGG - Intergenic
958105912 3:89072773-89072795 TATTAAAAACAGTAGGGACAAGG - Intergenic
958802426 3:98771652-98771674 GTTAAAAAACAGTAATAACAAGG - Intronic
958924956 3:100147566-100147588 GTTAAAAAACATTAGGAACCAGG - Intronic
959871342 3:111331922-111331944 GTTTCCAAGCAGTAATAACATGG + Intronic
960173533 3:114490964-114490986 GGTCCAAAACACCAGGAACAGGG - Intronic
961765115 3:129204083-129204105 TTTTGAAAACAGTCAGAACAGGG + Intergenic
962841653 3:139238305-139238327 CTTTCCAAACAGTATGAACCCGG + Intronic
963493818 3:146034781-146034803 ATTTCAAAACATTAGGCCCAGGG - Intergenic
963574030 3:147036942-147036964 GTTTCAAAACAGAAAGCACCAGG + Intergenic
964778193 3:160304329-160304351 TTTTAAAAACAGTAGCAGCATGG + Intronic
964838707 3:160970303-160970325 GTATAATAACAGTAGGAAGAGGG + Intronic
965097806 3:164256327-164256349 GTTTCAGAACATTAGAATCAAGG - Intergenic
965949591 3:174291153-174291175 GTTTCAAAAAAGAAGGAATAGGG + Intergenic
967319538 3:188181886-188181908 ATTACAAAACAGTATGTACATGG - Intronic
967577140 3:191107555-191107577 TATCCAAAACAGTAGGAATAAGG + Intergenic
968995519 4:3942851-3942873 GAATCAAAATATTAGGAACACGG - Intergenic
970105871 4:12583516-12583538 GTTTCATGACAGTAGAAAGAGGG - Intergenic
970811360 4:20098349-20098371 TTTTCAAGACAGTAGACACAAGG - Intergenic
972459529 4:39287879-39287901 GGTTCAGACCAGTAGGAACCAGG - Exonic
973976018 4:56263294-56263316 GTTACAAAACAGCAGGTCCAAGG + Intronic
980229629 4:130032582-130032604 GTTAGACAACAGTAGGAATAAGG - Intergenic
980919730 4:139071193-139071215 GTTTCAAAGCAGAAGGTATAAGG + Intronic
980998173 4:139801612-139801634 ATTTGAAAAGAGCAGGAACAGGG + Intronic
981425524 4:144598041-144598063 ATTGCAAAACAGCAGGAAAATGG + Intergenic
981963612 4:150573878-150573900 CTTTTAACACAGTAGGAACTTGG + Intronic
982220756 4:153123290-153123312 GTTACAACACAGTACTAACAGGG + Intergenic
982564777 4:156972329-156972351 GTTTCAGAACAGAAGGAAGAAGG + Intergenic
983227995 4:165103287-165103309 TTTTAAAAACTGTAGCAACACGG + Intronic
984117215 4:175696162-175696184 ATTTCAAAACAATAATAACATGG - Intronic
985914345 5:2906266-2906288 GTTTAAAAGCAGAAGCAACATGG - Intergenic
988210038 5:28192120-28192142 GTTTCAAAACAGTTCGCAGAGGG - Intergenic
989641829 5:43590296-43590318 AGTTTACAACAGTAGGAACAGGG + Intergenic
989829821 5:45901859-45901881 GTTTCAAATAAAAAGGAACATGG - Intergenic
991219283 5:64193910-64193932 GTTTGATAACAGTAGGTAAAGGG - Intronic
992309288 5:75478723-75478745 GGTTCAAAACAGAAAGATCAAGG + Intronic
992544621 5:77800009-77800031 CTTTCAAAACAGAAAGCACAAGG + Intronic
993803749 5:92377560-92377582 GTTTCAATATAGTAGGAAATTGG - Intergenic
994131177 5:96229893-96229915 GTTTTATAACAGAAGGAACACGG - Intergenic
995174106 5:109154247-109154269 GTATGAAAACTGAAGGAACAGGG + Intronic
996260685 5:121464043-121464065 ATTTCAAATCAGTGGGAACAGGG - Intergenic
996499395 5:124199935-124199957 GTTTCAAAGCAATAGTAACAGGG - Intergenic
999067940 5:148711606-148711628 GTCTCAACACAGTAGCCACAGGG - Intergenic
1000347652 5:160328251-160328273 TTTTAAACACAGGAGGAACAGGG + Intronic
1001144364 5:169170823-169170845 GTTTCAAAAAAGGGAGAACAAGG + Intronic
1003806751 6:9734158-9734180 GTTCCAAAACAGTAAGAATATGG + Intronic
1004339165 6:14792970-14792992 GTTTGAAATCAGGAGAAACATGG - Intergenic
1005083592 6:21981349-21981371 GTTTCAGAGCAGGAGGAAGAAGG - Intergenic
1005463886 6:26093226-26093248 GGTTCAAGTGAGTAGGAACAAGG + Exonic
1009737449 6:67695199-67695221 GTTTCAAAACAGAATGTACCAGG + Intergenic
1009887806 6:69644992-69645014 GCTTCCAAACAGTTGGACCAGGG + Intergenic
1010628868 6:78173648-78173670 GTTTCAAATAAGTAAGAAAAGGG - Intergenic
1010922028 6:81693686-81693708 GTTTCAAAAAAACAGGGACAAGG + Intronic
1011283668 6:85702268-85702290 GTTTCAAAAAGGAAGGAAGAAGG - Intergenic
1012044008 6:94245833-94245855 GTTTGAAAACAAAAGGACCATGG - Intergenic
1013626283 6:111940527-111940549 GTTTCAACACTGTATGAAAAAGG - Intergenic
1017236633 6:152123271-152123293 GTTCCAAAGCTGTACGAACAAGG + Intronic
1021384716 7:20014840-20014862 ATTTCAAAAAATTAGAAACAAGG + Intergenic
1022288904 7:28982040-28982062 CTATCAAAACAGGAAGAACATGG + Intergenic
1022653406 7:32297551-32297573 GTTTCAAAACAGTCACAGCATGG + Intronic
1023169430 7:37376191-37376213 GTTTAAAAACAGTGGGCACTAGG - Intronic
1023562163 7:41487579-41487601 ATTTCAATACGGTAGGAACTAGG + Intergenic
1024025814 7:45409048-45409070 GTTACAAGTCTGTAGGAACAGGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024894660 7:54243975-54243997 GTATAAACACAGTAGGAATATGG + Intergenic
1025846825 7:65206731-65206753 TTTTAAAAATAGTAGAAACATGG + Intergenic
1027193049 7:76009064-76009086 GTTTAAAAACAGCAGGAAGAGGG - Intronic
1027526126 7:79270898-79270920 GTTTCAAAACAGTGGTAAATTGG - Intronic
1027721354 7:81745772-81745794 TTTTAAAAAGAGTGGGAACATGG - Intronic
1028235409 7:88355217-88355239 GTTACAAAACAATAGTAAAAAGG + Intergenic
1030503283 7:110386759-110386781 GTTTCATAAGATTAGGAGCAAGG - Intergenic
1034072305 7:148198215-148198237 GCTTCAAAAGAGAAAGAACAGGG - Intronic
1036247567 8:7131873-7131895 GTTTCAGGTCAGTAGGATCAGGG - Intergenic
1037088791 8:14886760-14886782 GTTTTAAAAGAGTAGCAACATGG + Intronic
1041576763 8:59406195-59406217 GTTTCAAGCCAGAAGGAGCAGGG - Intergenic
1041576788 8:59406315-59406337 GTTTCAAACCAGGAGGGGCAGGG - Intergenic
1042119524 8:65470342-65470364 TTTTGAAAACAGTAGGCAGATGG + Intergenic
1042942906 8:74125595-74125617 TTTTCAAAAGAGAAGAAACATGG - Intergenic
1043160377 8:76839383-76839405 GTTTCAAAATAATAGAAAGAAGG - Intronic
1045513584 8:102836054-102836076 GTCACAAAACAGTATGAAAAGGG + Intronic
1046272524 8:111915382-111915404 GTTTCAAACCAGTGGAAGCATGG + Intergenic
1047085038 8:121506675-121506697 ATTTTAAAACAATTGGAACAGGG + Intergenic
1048158911 8:131993221-131993243 GTTTCAAACCATTAAGAACTTGG - Intronic
1050329107 9:4527745-4527767 GCTTCAAAACGGTAAGAAAATGG - Intronic
1051685736 9:19656691-19656713 ATTTCAAAAGAGGAGGAACTGGG - Intronic
1051688529 9:19684062-19684084 GTTTAAAAACAGTAGACACAGGG + Intronic
1052333422 9:27295422-27295444 GTTTCACATCAGTAGGGACTTGG + Intronic
1053188015 9:36035817-36035839 TTTTCAAAAAAGGAGGAAAAAGG + Intergenic
1055108939 9:72540563-72540585 ACTTCAAAACAGTAAGGACAAGG - Intronic
1056173783 9:84014146-84014168 GTTTTAAAAAACTATGAACAAGG + Intergenic
1056908675 9:90677584-90677606 GTTTAAAAGCAGTAGCAGCAGGG - Intergenic
1059639545 9:116203309-116203331 GTTTCAAAACAGGATGAGCAAGG - Intronic
1060139233 9:121192104-121192126 CTTTCTAAAAAGTAGAAACATGG + Intronic
1185529879 X:809127-809149 GGTTTAAAACAGCAGGAATATGG - Intergenic
1186211443 X:7254221-7254243 TTATCAAAACAGTGGCAACAAGG + Intronic
1188715927 X:33458803-33458825 TGTTCACAACAGTAGCAACATGG + Intergenic
1194140826 X:90206998-90207020 GTTTCAAGATAGAGGGAACAGGG - Intergenic
1194206429 X:91016601-91016623 CTTTCACAAGAGTAGCAACAAGG + Intergenic
1194726720 X:97407137-97407159 TTTTCTAAACAGTAGAAACTTGG + Intronic
1197156836 X:123279596-123279618 GTTTCAAAACAGCAGGCAGATGG + Intronic
1198193384 X:134333924-134333946 ATTTCTAAACAGTAAGAATATGG + Intergenic
1198261384 X:134968013-134968035 GTTTCACAAAAGAAGAAACATGG - Intergenic
1199239414 X:145528943-145528965 GTCTCAAAACAGTAGGAGCCAGG - Intergenic
1201797579 Y:17915157-17915179 GTTTGCAAACAGTTGGCACAAGG - Intergenic
1201803974 Y:17990802-17990824 GTTTGCAAACAGTTGGCACAAGG + Intergenic