ID: 923173994

View in Genome Browser
Species Human (GRCh38)
Location 1:231445667-231445689
Sequence GCTGCAGCAAACCCCACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923173986_923173994 0 Left 923173986 1:231445644-231445666 CCACCCCGTCATCCCCTACGGTG No data
Right 923173994 1:231445667-231445689 GCTGCAGCAAACCCCACCCAAGG No data
923173982_923173994 30 Left 923173982 1:231445614-231445636 CCTGGGAACATAACTCCATTGGC No data
Right 923173994 1:231445667-231445689 GCTGCAGCAAACCCCACCCAAGG No data
923173983_923173994 15 Left 923173983 1:231445629-231445651 CCATTGGCCTTAGAACCACCCCG No data
Right 923173994 1:231445667-231445689 GCTGCAGCAAACCCCACCCAAGG No data
923173989_923173994 -4 Left 923173989 1:231445648-231445670 CCCGTCATCCCCTACGGTGGCTG No data
Right 923173994 1:231445667-231445689 GCTGCAGCAAACCCCACCCAAGG No data
923173990_923173994 -5 Left 923173990 1:231445649-231445671 CCGTCATCCCCTACGGTGGCTGC No data
Right 923173994 1:231445667-231445689 GCTGCAGCAAACCCCACCCAAGG No data
923173988_923173994 -3 Left 923173988 1:231445647-231445669 CCCCGTCATCCCCTACGGTGGCT No data
Right 923173994 1:231445667-231445689 GCTGCAGCAAACCCCACCCAAGG No data
923173984_923173994 8 Left 923173984 1:231445636-231445658 CCTTAGAACCACCCCGTCATCCC No data
Right 923173994 1:231445667-231445689 GCTGCAGCAAACCCCACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923173994 Original CRISPR GCTGCAGCAAACCCCACCCA AGG Intergenic