ID: 923183128

View in Genome Browser
Species Human (GRCh38)
Location 1:231542552-231542574
Sequence AGGTAGCCCAAGAGCTATCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923183128 Original CRISPR AGGTAGCCCAAGAGCTATCA GGG Exonic
900601988 1:3506638-3506660 AGGTGGCCCCAGAGCTAGAAAGG + Intronic
901722459 1:11210449-11210471 ATATAGCCCAAGAGCTAAGAAGG + Intronic
901841888 1:11958708-11958730 AGGTAGCCCGAGACCTCTGAGGG + Intronic
906707133 1:47903101-47903123 AGGAAGCCCAAGAGCTCTGAGGG - Intronic
907557824 1:55360098-55360120 AGTTGCCCCAAGGGCTATCATGG - Intergenic
910054787 1:83020452-83020474 TGGTAACCCAAGAGCTCTGACGG - Intergenic
914981659 1:152419933-152419955 ATGAAGCCCAAGAGCTCTAAAGG - Intergenic
915231723 1:154450788-154450810 ACGAAGCCCAAGAGTCATCAGGG - Intronic
915260899 1:154676077-154676099 AGGGACTCCAAGAGCTATCCCGG - Intergenic
915762581 1:158329884-158329906 AGGACGCCCAAGAGATATCGGGG + Exonic
918411637 1:184264809-184264831 TGGTTGCCCAAGACCTCTCATGG + Intergenic
921530575 1:216277561-216277583 AGGTAGCCCAAGAGCGAAAGGGG - Intronic
923183128 1:231542552-231542574 AGGTAGCCCAAGAGCTATCAGGG + Exonic
1063457519 10:6194713-6194735 AGCTGGCCCAAGAGCTTTCAAGG + Intronic
1069011969 10:63384493-63384515 TGGTCACCCAAGAGCTCTCAAGG - Intronic
1069899220 10:71697304-71697326 AGGAAATCCACGAGCTATCAGGG + Intronic
1072151175 10:92685633-92685655 TGGTCACCCAAGAGCTATGATGG + Intergenic
1075042654 10:119120736-119120758 AGGTAGCACAAAAGCAACCATGG + Intronic
1082205442 11:49428180-49428202 AGGTCACCCAAGAGCTCTGATGG + Intergenic
1083699934 11:64469502-64469524 AGGAAGCACAAGAGACATCAAGG - Intergenic
1086649654 11:89272340-89272362 AGGTCACCCAAGAGCTCTGATGG - Intronic
1087635919 11:100701083-100701105 TGGTTACCCAAGAGCTATGATGG - Intronic
1087644931 11:100797656-100797678 TGGTCACCCAAGAGCTATGATGG + Intronic
1089067210 11:115670895-115670917 AGGGAGCCCTAGAGCTGACAAGG - Intergenic
1093114709 12:15195169-15195191 AGATAGCCCACGAGATATGATGG + Intronic
1093427618 12:19046337-19046359 TGGTTACCCAAGAGCTCTCATGG + Intergenic
1096164882 12:49413994-49414016 AGGCAGACCAAGAGCTATGGAGG - Intronic
1097724576 12:63060158-63060180 GGGTAGCCTCATAGCTATCAAGG + Intergenic
1098577931 12:72065321-72065343 TGGTTGCCCAAGAGCTCTGATGG + Intronic
1100517982 12:95346746-95346768 ATGTAGCCCAACAGCTAGAATGG + Intergenic
1100618809 12:96252258-96252280 TGGTTACCCAAGAGCTCTCATGG + Intronic
1101655575 12:106717141-106717163 AGGTACCCCCAGTGCTATTAGGG - Intronic
1103201989 12:119095267-119095289 AGAAAGCCCAAGAGTTATCATGG - Intronic
1105746925 13:23385888-23385910 TGGTCGCCCAAGAGCTCTGATGG - Intronic
1111477969 13:88778796-88778818 AGGGAGCACAAGAGATTTCAGGG - Intergenic
1115882601 14:37936925-37936947 AGGTGGCTGAAGAGCTGTCATGG - Intronic
1116827758 14:49688548-49688570 AGGGAACCCAACAGCTCTCATGG - Intergenic
1116864696 14:50022206-50022228 AGCTGGCCCCAGATCTATCAAGG - Intergenic
1120318571 14:82929576-82929598 TGGTAACCCAAGAGCTCTGATGG - Intergenic
1121061426 14:90913719-90913741 AGGTAGTCTAAGGGCCATCATGG - Intronic
1121876199 14:97455818-97455840 AGGTAGCCAAGGTGTTATCAAGG - Intergenic
1122556022 14:102580525-102580547 AGGGAGCCCAAGGGGTGTCAGGG + Intergenic
1125306505 15:38322375-38322397 AGGTATCCGAAGAGCTATAGAGG + Exonic
1127777373 15:62276064-62276086 AAGGAGCCCACGAGCAATCAAGG - Intergenic
1128513550 15:68327969-68327991 AGGTCGCCCAAGAGCCACCTTGG - Intronic
1130617353 15:85423903-85423925 GGGTCACCCAAGAGCTATGATGG - Intronic
1134178727 16:12030438-12030460 AGGAAGCCCAAGAGCTGTCCAGG - Intronic
1135305473 16:21364181-21364203 AGGAAGCCCAAGAGCTGTCCAGG - Intergenic
1135548710 16:23382292-23382314 AGGTACCCAAAGAGAGATCAGGG + Intergenic
1136302211 16:29343333-29343355 AGGAAGCCCAAGAGCTGTCCAGG - Intergenic
1141776963 16:86130185-86130207 TGGTTGCCCAAGAGCTCTGATGG - Intergenic
1143488497 17:7269315-7269337 ATCTAGCCCAAGAGATAGCAGGG - Intergenic
1144437233 17:15252875-15252897 TGGGAGCCCAAGAGCTAGAAGGG - Intronic
1148666792 17:49380962-49380984 GGGGAGCCCATGAGCTAGCAGGG - Intronic
1153271680 18:3328817-3328839 AGGTCTGCCAAGAGCTTTCAGGG + Intergenic
1154127724 18:11707364-11707386 CGGTAACCCAAGAGCTCTGATGG - Intronic
1157363003 18:47035615-47035637 GGGCAGCCCAAGAGCTAAGAGGG - Exonic
1158324079 18:56295330-56295352 AGGCAGCCCAAGTGGTCTCAAGG + Intergenic
1163571625 19:18085415-18085437 AGGCAGCCCACGAGGTATCCTGG - Intronic
1163913963 19:20222522-20222544 AGTTAACTGAAGAGCTATCATGG + Intergenic
1164577885 19:29416831-29416853 AGGCAGCCCAGGAGCTCTCAAGG - Intergenic
926886509 2:17603579-17603601 AGGTAACCAAAGAAGTATCAGGG + Intronic
927255042 2:21033885-21033907 AGGTTTCCCAAGAGCTCTCAGGG + Intronic
927471368 2:23379909-23379931 ATTTATGCCAAGAGCTATCAGGG + Intergenic
927861691 2:26563901-26563923 AGGGAGCTCAAAAGCTACCAGGG + Intronic
928791986 2:34968429-34968451 TGGTAACCCAAGAGCTCTGATGG - Intergenic
930160779 2:48154602-48154624 AGGTATCCTAACAGATATCAAGG - Intergenic
931498084 2:62833665-62833687 TGGTTGCCCAAGAGCTGTGATGG + Intronic
931499796 2:62853788-62853810 AGGTCGCCCAAGAGCTGTGATGG - Intronic
931549978 2:63432634-63432656 AGGCAGGCCAAGGGCAATCAGGG + Intronic
932286537 2:70538225-70538247 GGGTCGCCCAAGAGCTCTGATGG + Intronic
933626654 2:84608508-84608530 TGGTAACCCAAGAGCTCTTATGG - Intronic
940399936 2:153236709-153236731 TGGTGACCCAAGAGCTATGATGG + Intergenic
1170418428 20:16168912-16168934 AAGGAGGCCGAGAGCTATCAAGG + Intergenic
1173941994 20:46918964-46918986 TGGTCACCCAAGAGCTCTCATGG - Intronic
1177401472 21:20611238-20611260 AGGTCACCCAAGAGCTCTGATGG + Intergenic
1178166271 21:29981369-29981391 TGGTAGCACAAGAGCTAAGATGG - Intergenic
950251212 3:11467200-11467222 AGGAAGCCAAAGAGATAGCATGG + Intronic
953016060 3:39077532-39077554 AGGTAGCCCAAGTACCAACAAGG + Intronic
954265663 3:49469139-49469161 AGGGAGCCCCAGAGCTCTCCGGG + Intronic
954684717 3:52364268-52364290 AGGAAGCTCAAGGGCCATCAAGG + Intronic
960269190 3:115656080-115656102 AGGTAGCCCCAGCTCTATCTGGG + Intronic
960540638 3:118858110-118858132 TGGTAACCCAAGAGCTCTAATGG + Intergenic
963278782 3:143360043-143360065 AGGTAGAGTAAGAGATATCATGG + Intronic
964298296 3:155258626-155258648 AGGAAGCCAAAGAGACATCATGG + Intergenic
966070649 3:175873463-175873485 TGGTCACCCAAGAGCTCTCATGG + Intergenic
966467786 3:180251187-180251209 AGATAGCTCAGGAGCTTTCAAGG + Intergenic
966503480 3:180672634-180672656 CGGTCACCCAAGAGCTATGATGG + Intronic
967077439 3:186016543-186016565 TGGTAACCCAAGAGCTCTGATGG - Intergenic
971830948 4:31693698-31693720 TGGTCACCCAAGAGCTCTCATGG + Intergenic
973233795 4:47873500-47873522 TGGTTACCCAAGAGCTATAATGG - Intronic
974685387 4:65220755-65220777 AGAAAGCCCAAGACCTAACAGGG + Intergenic
974954074 4:68617198-68617220 GTGTAGCCCAAGACCTAGCAAGG + Intronic
984058885 4:174966562-174966584 AGGTAGTCCAAAACCTAGCAAGG + Intronic
986691618 5:10317979-10318001 AGGTGGCCCAAGAGAAATCAAGG - Intergenic
987716017 5:21572136-21572158 TGGTCACCCAAGAGCTCTCATGG + Intergenic
988294030 5:29331128-29331150 AGATAGCCATCGAGCTATCAAGG - Intergenic
991394213 5:66186708-66186730 TGGTTGCCCAAGAGCTCTGATGG + Intergenic
992127856 5:73660712-73660734 TGGTAACCCAAGAGCTCTGATGG - Intronic
994466920 5:100147729-100147751 CGGTCACCCAAGAGCTCTCATGG - Intergenic
999688083 5:154120506-154120528 TGGTAACCCAAGAGCTTTGATGG + Intronic
1004188428 6:13442802-13442824 TGGTCACCCAAGAGCTTTCATGG + Intronic
1004437552 6:15611381-15611403 TGGTCACCCAAGAGCTCTCATGG + Intronic
1005900258 6:30211242-30211264 AGGGAGGCCAAGAGATATCTAGG - Intronic
1009832618 6:68957753-68957775 AGGTATTCTAAGAGCTATCCAGG + Intronic
1017806206 6:157947631-157947653 AGGTAGGCCATGGGCTATTAAGG + Intergenic
1018291461 6:162296158-162296180 AGAAAGACCAAGAGCTGTCAAGG + Intronic
1018514793 6:164567664-164567686 AGGTACACCAAGAGTTATAAGGG + Intergenic
1018744782 6:166753793-166753815 GCGTTGCCCATGAGCTATCACGG + Intronic
1021678199 7:23102565-23102587 TGGTCACCCAAGAGCTATAATGG + Intergenic
1024778359 7:52816051-52816073 AGGAAGTCCAAGAGCTAGTAGGG + Intergenic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1031921470 7:127604523-127604545 AGGTAACCCAAGAGCTCTGATGG - Intergenic
1032553533 7:132807762-132807784 AGGTGGCCAAAGAGTTATGAAGG + Intronic
1032859442 7:135863292-135863314 AGCTAGCCCAGGAGCTGTCAGGG + Intergenic
1033107498 7:138541395-138541417 TGGTCACCCAAGAGCTCTCATGG - Intronic
1036040393 8:5073162-5073184 AGGCAGCCAAAGAGCAAGCAGGG - Intergenic
1037579043 8:20233896-20233918 AGGTAGCCCAAGAGGTAATGTGG + Intergenic
1038426664 8:27468378-27468400 CTGTAACCCAGGAGCTATCAGGG - Intronic
1038921362 8:32088424-32088446 AGGTAGCCCATTAACTATGATGG - Intronic
1040425579 8:47282014-47282036 TGGTCACCCAAGAGCTATGATGG - Intronic
1040972943 8:53157141-53157163 AAGTGGACCAATAGCTATCAGGG - Intergenic
1041670043 8:60482870-60482892 AGGAAACCCAAGAGCTACCCAGG + Intergenic
1043251260 8:78076546-78076568 AGCTAGCTCAGAAGCTATCATGG - Intergenic
1047009826 8:120659899-120659921 TGGTCACCCAAGAGCTATGATGG - Intronic
1048964196 8:139603582-139603604 AGGAAGACCAAGAGCAAACAGGG + Intronic
1048964493 8:139605485-139605507 AGGAAGACCAAGAGCAAACAGGG + Intronic
1054990564 9:71320744-71320766 AGGTACCTCTAGAGCTATGAGGG - Intronic
1056083565 9:83122569-83122591 AGGTACCTCAAGAGCCATTATGG + Intergenic
1056093713 9:83229782-83229804 TGGTCGCCCAAGAGCTCTGATGG - Intergenic
1058438470 9:104986003-104986025 AGGCAGCCCAGGAGCTCTAAGGG - Intergenic
1059370149 9:113823988-113824010 AGCAAGCCCAAAACCTATCAAGG - Intergenic
1059488378 9:114645159-114645181 AGATAGGCCAAGGGCTATGAGGG - Intronic
1061477023 9:130874824-130874846 AGGTTGGCCAGGAGCTCTCATGG + Intronic
1186255939 X:7719714-7719736 TGGTCACCCAAGAGCTCTCATGG - Intergenic
1188538570 X:31224063-31224085 ATGTAGCCCAGTATCTATCAAGG - Intronic
1189454254 X:41170517-41170539 AGGAATCAGAAGAGCTATCAGGG - Exonic
1190032044 X:46983383-46983405 AGGTAACGCCAGAGCAATCAAGG + Intronic
1197619076 X:128726798-128726820 AGGCAGGCCAAGAGAAATCAGGG + Intergenic
1198621282 X:138513230-138513252 AGGTCACCCAAGAGCTCTGATGG - Intergenic
1201327714 Y:12782433-12782455 TGGCAACCCAAGAGCTCTCACGG - Intronic