ID: 923183258

View in Genome Browser
Species Human (GRCh38)
Location 1:231543955-231543977
Sequence CAGAAGTACTGGTGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 324}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923183249_923183258 19 Left 923183249 1:231543913-231543935 CCTGTAAAGTGTGACAGATTTGG 0: 1
1: 0
2: 2
3: 7
4: 114
Right 923183258 1:231543955-231543977 CAGAAGTACTGGTGGGAAGAAGG 0: 1
1: 0
2: 2
3: 26
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923183258 Original CRISPR CAGAAGTACTGGTGGGAAGA AGG Intronic
901143332 1:7049906-7049928 CTGATGTTCTGGTGGGAGGAGGG + Intronic
901699836 1:11039391-11039413 TAGAAGGACTGGTAGGCAGAAGG + Intronic
902248309 1:15136532-15136554 CGGAAGTGCTGTTGGCAAGAGGG + Intergenic
903814872 1:26057572-26057594 CAGAGGTCCTGGTGGGAACTAGG + Intronic
904852079 1:33466958-33466980 CAGATGCACTGGTGGGACGGGGG + Intergenic
905108548 1:35577961-35577983 AAGCAGGACTGGTGGGGAGACGG + Intronic
906832084 1:49043711-49043733 GAGAAGCACTGTTGGGAAGAAGG + Intronic
908030550 1:59994738-59994760 CAGAAGCACTGATGTGATGATGG + Intronic
908650574 1:66328705-66328727 CACAAGTGCAGGTGGGAAAAAGG - Intronic
910194419 1:84625388-84625410 CATATGTACTGGAGAGAAGAAGG - Intergenic
911051625 1:93676394-93676416 CAGAAGTCCTGGGGGTGAGATGG + Intronic
913518504 1:119624316-119624338 CTGAAGAACTGGTGGGCAGAGGG - Intronic
915082689 1:153362723-153362745 GATAAGTAGTGGTGGGCAGAGGG - Intergenic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
916206346 1:162319492-162319514 CAGAAGGACTGGTGGGAGATGGG - Intronic
916453786 1:164949240-164949262 CAGGAGAACTGGTGGGCTGAGGG + Intergenic
917469979 1:175318180-175318202 CAGAAGCTCTGGTGGGAGGCTGG + Exonic
919619016 1:199843817-199843839 CAGAAGGATTGGTGGAAGGAAGG - Intergenic
920512180 1:206559496-206559518 AAGGAGAACTGGGGGGAAGAAGG - Intronic
921723321 1:218497707-218497729 TAGAAATACTGTTGAGAAGAGGG - Intergenic
922138356 1:222854988-222855010 CAGTACTACTAGTGGGAATAGGG + Intergenic
923183258 1:231543955-231543977 CAGAAGTACTGGTGGGAAGAAGG + Intronic
924216451 1:241827059-241827081 CAGAAGTATTAGGGAGAAGAGGG + Intergenic
1063346153 10:5313933-5313955 CAACAGTACTGGTGGTCAGAGGG + Intergenic
1063497575 10:6524715-6524737 CACCAGTACTGATGTGAAGAAGG + Intronic
1063701760 10:8391564-8391586 AAGAAGTACTGGTGAGGACATGG - Intergenic
1065011792 10:21427557-21427579 CAGAAATACTGGGTAGAAGAGGG - Intergenic
1065130323 10:22613493-22613515 CAGAACTGATGGAGGGAAGATGG + Intronic
1066118540 10:32261813-32261835 CAGAAGTACAGGTGGCAACCTGG - Intergenic
1067689876 10:48494855-48494877 CAAAGTTTCTGGTGGGAAGAGGG - Intronic
1070793761 10:79205038-79205060 CAGATGGACTGGTGGACAGATGG + Intronic
1071503805 10:86221307-86221329 GAAATGTGCTGGTGGGAAGATGG - Intronic
1071702540 10:87955596-87955618 GAGAAGGAGTGGTGGGGAGAAGG + Intronic
1076302471 10:129438467-129438489 CAGAAGAACAAGTGGGACGATGG + Intergenic
1076435110 10:130435224-130435246 CAGAGCTTCTGGTGGGAACATGG + Intergenic
1077186684 11:1238621-1238643 CAGATGGACAGGTGGGCAGATGG + Intronic
1079389633 11:20010264-20010286 AAGAAGGACTGGGGGGAAAATGG + Intronic
1080291121 11:30672449-30672471 CATATGAATTGGTGGGAAGAGGG - Intergenic
1080371439 11:31649861-31649883 CAGAAGTACAGATGTAAAGAGGG - Intronic
1081662493 11:44896618-44896640 CAGAGGTAGAGATGGGAAGATGG - Intronic
1081988405 11:47324367-47324389 CAGAAGGACTGGTAGAAACAGGG - Intronic
1083581969 11:63830761-63830783 CAGAAGTACAGGTGACAAGCTGG - Intergenic
1083899816 11:65638178-65638200 CAGAGGTACTGGCGGGAGCAGGG + Intronic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1086047638 11:82551437-82551459 CATAAGTAATCATGGGAAGAAGG + Intergenic
1087398666 11:97635534-97635556 CAGAAGGAATGGTGGAAGGAAGG + Intergenic
1087509300 11:99069842-99069864 CAGTAGCACTGGTGTGAACAGGG - Intronic
1088047239 11:105468897-105468919 CTGAAGTACTGGTGGGCAAAGGG - Intergenic
1088633819 11:111799934-111799956 AATAAGTACTGGTGGTAAGGAGG - Intronic
1090566840 11:128003577-128003599 CAGGAGTAAGGGTGGAAAGATGG - Intergenic
1090660038 11:128875644-128875666 CAGAAGGGCAGGTGGGAACAAGG + Intergenic
1091511131 12:1127345-1127367 CAGTATTATTTGTGGGAAGAAGG + Intronic
1092149280 12:6236086-6236108 CGGGAGAACTGGTGGGCAGAGGG - Intronic
1092818348 12:12330563-12330585 CTGAAGCATTGGTGGGTAGAAGG + Exonic
1093864366 12:24207015-24207037 CAGAAGTGCTCGTTAGAAGAGGG - Intergenic
1093949857 12:25152674-25152696 CAGAAGTACAGGTGACAAGCTGG + Intronic
1095992659 12:48047322-48047344 CAGAAGGAATGGTAGGTAGAAGG - Intronic
1098026975 12:66214200-66214222 CAGAAGAATTGGGGGAAAGATGG + Intronic
1098946605 12:76596693-76596715 CAGAAGTAATGGTGTGAAACAGG + Intergenic
1100386749 12:94110914-94110936 CCGGGGTACAGGTGGGAAGAGGG - Intergenic
1101696798 12:107134673-107134695 CACAAGAACTGGGGGGAGGAGGG - Intergenic
1101703414 12:107197024-107197046 CAGAAGGACTTTTAGGAAGAGGG - Intergenic
1102301591 12:111775400-111775422 CTGAAGTCCTGGTGAGGAGAGGG - Intronic
1102502777 12:113364104-113364126 GAGAAGTCCTGCTGTGAAGAAGG + Intronic
1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG + Intergenic
1103401950 12:120649231-120649253 CAGAACTCCTGTTAGGAAGATGG - Intronic
1103787189 12:123441664-123441686 CAGAAGCGCAGCTGGGAAGAGGG - Intergenic
1104845293 12:131843923-131843945 CAGAAGGGCTGGTGGGATGTGGG + Intronic
1106346659 13:28886099-28886121 CAGAGTTGCTGGTGGGGAGAGGG + Intronic
1107697415 13:43013743-43013765 CAGAAGTACAGGTGGAAACCTGG + Intergenic
1107743224 13:43476756-43476778 CAGAAGCACTGTTAGGAAGAAGG + Intronic
1111046785 13:82824054-82824076 CAGAAGAAGTGGTGGGAATAGGG + Intergenic
1111745401 13:92262127-92262149 GAGAAGTACTGGAAGGAAAAGGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG + Exonic
1113024191 13:105922211-105922233 AAGAAGAAATGGAGGGAAGAGGG - Intergenic
1114810795 14:25896741-25896763 CAAAAGTACTATTGGGAAGTTGG - Intergenic
1114879463 14:26766128-26766150 AAGTAGTACTGGTGGCAGGAAGG - Intergenic
1114956756 14:27830810-27830832 CAGAAATAATGGTGGCCAGAAGG - Intergenic
1117748834 14:58899737-58899759 CAGATGTAGTGGTGAAAAGATGG + Intergenic
1119956607 14:78805011-78805033 CACATGTCCTGGTGGGAAGGTGG + Intronic
1119993294 14:79224501-79224523 CCAAAGTAATGGTGGGTAGAGGG + Intronic
1120474527 14:84970189-84970211 GAGAAATACTGGGTGGAAGAGGG - Intergenic
1121666459 14:95676291-95676313 CAGAAATACTGGGTAGAAGAGGG + Intergenic
1121779149 14:96610727-96610749 CAGGAGGACTGGTGGAAAGTTGG - Intergenic
1124979778 15:34559290-34559312 CAGAGGTTCTGTTGTGAAGATGG + Intronic
1125384607 15:39124042-39124064 CAGAAGTAGAAGTGGGAATAAGG + Intergenic
1125466173 15:39955066-39955088 CAGGAGCACTGGTGGAAACAGGG - Intronic
1127698639 15:61475558-61475580 CACAGGTACTTGTGGGAGGAAGG - Intergenic
1128630802 15:69264679-69264701 AAGAAGTACTGGTGAGGATATGG - Intronic
1128744411 15:70103451-70103473 CAGAAGTTGTGGTGGGCAGAGGG + Intergenic
1129368963 15:75076022-75076044 CAGAAAAAATGGAGGGAAGAAGG + Intronic
1129505133 15:76075132-76075154 CTGAAGTTCTGGGGAGAAGATGG + Intronic
1130763667 15:86848184-86848206 CTGAACTTCTGGTGGGAAAATGG - Intronic
1131511005 15:93049453-93049475 CAGCAGCACAGATGGGAAGAGGG + Intronic
1131768294 15:95705332-95705354 CATAAGAAGAGGTGGGAAGAGGG - Intergenic
1136062347 16:27735258-27735280 CAGACGTCTTGGTGGGAACAGGG + Intronic
1136608666 16:31353201-31353223 CAGCTGTCCTGGTGGGAAGAGGG - Intergenic
1138091856 16:54181381-54181403 CAGAAGGACAGCTGGGACGATGG - Intergenic
1138169139 16:54832420-54832442 CAGGGGTAAGGGTGGGAAGAAGG - Intergenic
1138550305 16:57744140-57744162 CAGAAGCACAGCAGGGAAGAGGG + Intronic
1138902305 16:61287587-61287609 CAGAAGTAGAGGTGGGAAAAGGG - Intergenic
1140847102 16:78901415-78901437 CAGAAGTGGTTGTGGGGAGAGGG - Intronic
1140922504 16:79552097-79552119 CAGAATGACTGCTTGGAAGAGGG - Intergenic
1141289325 16:82703297-82703319 CAGAAGGAATGGTGGGGGGACGG - Intronic
1141536513 16:84684894-84684916 CGGAACTAAGGGTGGGAAGATGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142468323 17:148262-148284 CAGAACTCCTGCTGGCAAGAAGG + Exonic
1142498216 17:317621-317643 CAAAAATACTGGAGGGGAGATGG - Intronic
1142560007 17:804221-804243 CAGAAGAACTGGTGGTGAGCGGG + Intronic
1144841075 17:18186165-18186187 AAGACGTCCTGGTGGGAAGGTGG + Intronic
1145882643 17:28363719-28363741 CAGAACTACGGATGTGAAGAGGG - Intergenic
1146561617 17:33874908-33874930 CAGGAATACTGCTGGGAAGGAGG - Intronic
1148383090 17:47214328-47214350 CAGACTTCATGGTGGGAAGAGGG - Intronic
1148645677 17:49218570-49218592 GAGAACTACTGGTGGGAAGGAGG - Intronic
1150826064 17:68476541-68476563 CAGAAGGACTGGTAAGAAGCTGG - Intergenic
1151496644 17:74462030-74462052 TAGAGGTGGTGGTGGGAAGAGGG - Intergenic
1151981132 17:77509758-77509780 CAGAAATAATGATGGGATGATGG - Intergenic
1152229509 17:79107403-79107425 CCCAAATACTGGTGGGCAGATGG + Intronic
1152379676 17:79935880-79935902 CAAAAGTGCTGGAGGAAAGATGG + Exonic
1152527355 17:80896244-80896266 GAGAAGCACTGGCGGGAGGACGG - Intronic
1152641452 17:81451006-81451028 CGGAAGGACTGATGGGCAGATGG + Intronic
1153887111 18:9476362-9476384 CAGAATTACTTCAGGGAAGACGG - Intronic
1154377146 18:13819924-13819946 GAGGAGTTCAGGTGGGAAGAAGG - Intergenic
1157545563 18:48544140-48544162 CAAAACTACTGGTAGGGAGAAGG + Intronic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1158929957 18:62314259-62314281 CAGAAGTACTGGTAGCTGGAAGG + Intergenic
1159355927 18:67337417-67337439 CAGAAGTGGTGGAGGGTAGAAGG + Intergenic
1160467664 18:79095222-79095244 CAGAAGTCCACATGGGAAGAAGG - Intronic
1160799366 19:960660-960682 CTGAGGCCCTGGTGGGAAGAGGG - Intronic
1162728992 19:12706360-12706382 CAAAAGCACTGGTGGGAGGGAGG + Exonic
1162800012 19:13105074-13105096 CAGGTGCCCTGGTGGGAAGATGG + Exonic
1166009828 19:39934167-39934189 CCAAAGTACTGGGGGGAGGATGG - Intronic
1166599599 19:44082256-44082278 CAGATGTCAGGGTGGGAAGAGGG - Intronic
1166851072 19:45761609-45761631 AAGCAGTACTGGGGGGATGAAGG + Intronic
1167387604 19:49173178-49173200 CAGATGGACAGGTGAGAAGATGG - Intronic
1167555187 19:50190283-50190305 CAGCATTACGGGTGGGAATAGGG - Intronic
1167809581 19:51816676-51816698 CAGAAGTACAGGTGGCCACATGG + Intronic
1167898779 19:52602454-52602476 GAGAAGTAATAGAGGGAAGAAGG + Intronic
1167921256 19:52785182-52785204 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1167940306 19:52941400-52941422 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
1168118136 19:54236937-54236959 CAGAAATACAGGTGGAGAGAAGG + Intronic
1168521118 19:57051288-57051310 CAGAAGTTCTGGAAGGTAGAGGG - Intergenic
925812405 2:7713215-7713237 CAGAAGTCTGGGTGGCAAGATGG - Intergenic
926056424 2:9776555-9776577 CAGGAGTACTGAGGGGAGGAGGG + Intergenic
926819910 2:16840647-16840669 CAGCAGTACCTGGGGGAAGAAGG - Intergenic
927486548 2:23492040-23492062 CAGAGGAACTGGAGGGAAAAAGG - Intronic
927653788 2:24928655-24928677 CAGCAGTACTGGAGGGGAGGCGG + Intergenic
929172945 2:38949523-38949545 CAGAAGTAAGGAAGGGAAGAAGG - Intronic
929825478 2:45306463-45306485 CAGAAGTACAGGTGGCAAGTTGG - Intergenic
930079587 2:47434812-47434834 AAGAAGTGCGGGTGGGATGATGG - Intronic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
931701521 2:64913081-64913103 CAGCAGTAGTGGCAGGAAGAAGG + Intergenic
932330144 2:70894135-70894157 GAGAACTACTGGGGAGAAGAAGG + Intergenic
932606550 2:73169503-73169525 CAGGAGGTCTGGTGGGGAGAGGG + Intergenic
932736910 2:74260662-74260684 TTGAAGTACTGGTGGGAAGTAGG - Intronic
932764746 2:74462487-74462509 AAGAGGTACGGGTGGAAAGAGGG + Exonic
933925876 2:87090932-87090954 CAGGAGGTCTGGTGGGGAGAGGG - Intergenic
934476492 2:94597027-94597049 CAGGAGGACTTGTGTGAAGAAGG + Intronic
934480523 2:94637176-94637198 CAGAAATAATGGTGGCCAGAAGG + Intergenic
934997205 2:98975179-98975201 CAGAAGTAATGGAGGCCAGAAGG + Intergenic
935473892 2:103494310-103494332 CAGAACTACTGGTGGGAGCTGGG + Intergenic
935568511 2:104634905-104634927 CAGGAGTCCTGGTGGCAACAGGG + Intergenic
936956903 2:118031361-118031383 GAGAAGTCCTGGGGGTAAGACGG + Intergenic
937352179 2:121173111-121173133 CAGAAGTACGGGAAGTAAGAGGG + Intergenic
937934586 2:127232568-127232590 CAGGAGTCCTGGTGGGAGGTGGG + Intergenic
939018998 2:136936665-136936687 CAGGAGAAAGGGTGGGAAGAGGG + Intronic
939602250 2:144207439-144207461 TAGAGGTACTGGAGGCAAGATGG + Intronic
941845021 2:170123739-170123761 AAGAAATCCTGGTGGAAAGATGG + Intergenic
942672271 2:178388731-178388753 CAGAAGTATGGGAGGGTAGATGG - Intronic
944945031 2:204674098-204674120 CAGAAGTAGTGCTGGGGATATGG + Intronic
945965774 2:216184992-216185014 GAGAGATACTGGTGGGAAGTAGG + Intronic
946026187 2:216673255-216673277 CAGAGGTGGTGGTGGGGAGATGG + Exonic
946310889 2:218882043-218882065 CAGAAGCAGAGGTTGGAAGAGGG + Intronic
947853402 2:233306712-233306734 CAGAAATAATAGTGGGAAGGAGG + Intergenic
947870994 2:233437917-233437939 GACAAGTACTGGTGGAAAGGGGG + Intronic
948176419 2:235946939-235946961 CAGAAGTAAGGTGGGGAAGAAGG - Intronic
1170330725 20:15207740-15207762 CAGAAGTAATGGGGGCCAGAGGG - Intronic
1170872607 20:20220479-20220501 CAGAAGTACAGGTGGCAACATGG + Intronic
1171432346 20:25091025-25091047 CTGAAGTCCTGGGGGGCAGAGGG + Intergenic
1172230747 20:33334037-33334059 CTGAAGATCTGATGGGAAGATGG - Intergenic
1172362666 20:34325022-34325044 CAGAAGTTTTGATGTGAAGAGGG - Intergenic
1173042370 20:39476452-39476474 AAGAAGTACAGGTGGGAGGTAGG - Intergenic
1173149969 20:40558646-40558668 AAGAAATAATGGAGGGAAGAAGG + Intergenic
1173800490 20:45891701-45891723 CCGGAGTACTGGCGGAAAGACGG - Exonic
1176129749 20:63491715-63491737 CAGAAGGATGGGTGGGGAGATGG + Intronic
1178609221 21:34066448-34066470 ACCAAGTGCTGGTGGGAAGATGG - Intergenic
1179434951 21:41355170-41355192 AAGAAGTGCTGGTGAGAATATGG + Intronic
1181086569 22:20442251-20442273 GAGAAGGACTGCTGGGAGGAAGG - Exonic
1181803890 22:25363753-25363775 CAGAGATACTGGTGGGATGATGG - Intronic
1182213042 22:28692589-28692611 CAGAAGTACGGGTCGGAGGCTGG + Intronic
1183043750 22:35203295-35203317 CAGAAGGACTGCTGGGCAGTTGG - Intergenic
1183616325 22:38948034-38948056 CAGAAGTAGGGGTGAGAAGTGGG + Intergenic
1184704220 22:46199226-46199248 TAGAGGTACTGTTGGTAAGAGGG + Intronic
951909620 3:27736397-27736419 CAGAAGCTAAGGTGGGAAGATGG - Intergenic
952830285 3:37558969-37558991 CACAAATACAGGTGGAAAGAAGG - Intronic
953384691 3:42499880-42499902 CTGAAGCACTGGGGGGAAGGGGG - Intronic
953551543 3:43907274-43907296 CAAAAGCCTTGGTGGGAAGATGG - Intergenic
953595729 3:44311043-44311065 CAGGAGTTTAGGTGGGAAGATGG + Intronic
953611308 3:44449695-44449717 CTGAAGTCCTGGTGGGAAGGTGG + Intronic
954039113 3:47870887-47870909 CAGAAGTATTGGTGGCCAGGCGG + Exonic
954361825 3:50126237-50126259 CAGAAGGGATGGTGGGAAGAGGG + Intergenic
954524679 3:51259560-51259582 CAGATGTCTTGGTGGGAAGAGGG + Intronic
955086967 3:55712246-55712268 CATAAGTGAAGGTGGGAAGAGGG + Intronic
955293676 3:57715783-57715805 CAAAAGTACAGGTGGCAAGCTGG + Intergenic
955689217 3:61574446-61574468 GAAAACAACTGGTGGGAAGAGGG - Intronic
957383593 3:79467287-79467309 CAGAAATACTGATTAGAAGAGGG + Intronic
957866721 3:86034901-86034923 CAGAAGTAGGGGTGGAGAGAAGG - Intronic
959090374 3:101896148-101896170 CAGAAGTAAGAGTGGGAAGGGGG - Intergenic
960036050 3:113104335-113104357 CACAAGTGCTGCTGGGGAGAAGG + Intergenic
960091023 3:113638027-113638049 CAGAATTCCTGGTGAGCAGAGGG - Intergenic
960257149 3:115522753-115522775 CCAAAGTACTTGTGTGAAGAGGG + Intergenic
960428966 3:117545490-117545512 CAGAAGTCCTGGAGAGAGGAAGG + Intergenic
961026519 3:123563144-123563166 CAGTGGTACTGGTGGGGACATGG + Intronic
961328432 3:126125209-126125231 CAGAAGTCCTGGAGAGAAGCAGG - Intronic
961929018 3:130514273-130514295 CACAAGTAGTGGTGGGAGTATGG + Intergenic
964121653 3:153190613-153190635 CAAAAGTACTTGTGGGTATATGG - Intergenic
964362483 3:155913111-155913133 CAGAGGAAGTGGTAGGAAGAGGG - Intronic
965824256 3:172714642-172714664 CAGAAGTACTGTGGGAAAGGTGG + Intergenic
965825899 3:172729505-172729527 CGGAAGCATTGGAGGGAAGAAGG + Intergenic
965951130 3:174309424-174309446 CAGATGCACTGGTGGGATAAGGG - Intergenic
967128502 3:186448252-186448274 CAGTAGTACTGATGGGAAGTGGG + Intergenic
968391737 4:198417-198439 CACAAGTTCAGGTGGCAAGAGGG + Intergenic
968435120 4:581106-581128 CAGAAGCTCTGGTGGGAGGGAGG - Intergenic
969564539 4:7970328-7970350 CAAAGGTGCTGGTGGGCAGAGGG + Intronic
970335523 4:15036694-15036716 CAGAAGTATTGGTGGCCAGGAGG + Intronic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971141323 4:23928239-23928261 CACAATTTCTGGTGGGAAAATGG + Intergenic
971311074 4:25526135-25526157 AATAAGCACTGGTGGGAAAAGGG + Intergenic
972841509 4:42935404-42935426 CAGAAGTATAGGAAGGAAGAGGG + Intronic
977297231 4:95224422-95224444 CAGGAATTCTGGTGGGAAGCAGG - Intronic
977665367 4:99640902-99640924 CACAAGTACAGGGGGGAAGGAGG + Exonic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
982093006 4:151896691-151896713 CAGAAGTACAAGAGGGAATAGGG + Intergenic
982670417 4:158313945-158313967 CAGAAGGGCTGGTGGGCAGGTGG + Intergenic
983676765 4:170303589-170303611 CAGAAGTACTGATGGGAGGAAGG + Intergenic
983711109 4:170716607-170716629 CAGAGGAACTGGTGAGAAAAGGG + Intergenic
984373757 4:178900212-178900234 CAGAAATACTGGGTTGAAGAGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985427369 4:189843902-189843924 CAGATGCAGTGGAGGGAAGAAGG - Intergenic
986179316 5:5378598-5378620 CACAAGCACAGGAGGGAAGAAGG + Intergenic
987317044 5:16733559-16733581 AGGAAGGCCTGGTGGGAAGAGGG + Intronic
988897433 5:35692964-35692986 CAGACAAACTGGTGGGAAGCAGG - Intronic
989118142 5:37976847-37976869 CAGAATTACTGGTGGGGATTAGG + Intergenic
989774091 5:45181989-45182011 CCGAAGTCCTGGTGGGAAGGTGG - Intergenic
991290699 5:65031327-65031349 CTGAAGCACTGTGGGGAAGATGG + Intergenic
992226144 5:74621129-74621151 CAGAAATACTGGGTAGAAGAGGG - Intergenic
993804141 5:92383643-92383665 GAGAATTACTGGTGAGGAGAAGG - Intergenic
994750136 5:103727091-103727113 CAGAAGGTCTGGGGTGAAGATGG + Intergenic
994947889 5:106419811-106419833 CAGAAGTAATGGGGGAAAAAAGG - Intergenic
995018840 5:107344517-107344539 CAGAAATAATGGAGGTAAGAAGG - Intergenic
996950608 5:129120824-129120846 CACATGTAGTGGTGGGAAGAAGG - Intergenic
998280888 5:140806625-140806647 CAGAAATACTAGGGTGAAGAGGG + Intronic
999682953 5:154076776-154076798 CAAGAGTACTGGGGAGAAGATGG - Intronic
999702297 5:154239266-154239288 CAGAAGGACAGGTAGGCAGAAGG - Intronic
999724328 5:154422590-154422612 CAGAAGTATGGGTGGGATTAAGG + Intergenic
999892382 5:155993151-155993173 CAGAAGGACTGAAGGGAAAATGG - Intronic
1000339957 5:160269354-160269376 CAGAAGCACTTGTGGGATGCAGG - Intronic
1000697820 5:164410624-164410646 CAGAAATCCTGTTGAGAAGATGG + Intergenic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001581728 5:172803135-172803157 CTGGAGCACTGTTGGGAAGAGGG + Intergenic
1002307798 5:178293979-178294001 CAGAAGTACTGTGGGAGAGAGGG + Intronic
1002517117 5:179766823-179766845 CCGAGGTAGTTGTGGGAAGAGGG + Intronic
1003528673 6:6919870-6919892 CAGAAGCACTGGGTGGAAGTAGG - Intergenic
1004495819 6:16161454-16161476 GAAAATTGCTGGTGGGAAGATGG + Intergenic
1004735901 6:18406235-18406257 CAGGAGTGCTGTGGGGAAGAGGG + Intronic
1004740664 6:18457259-18457281 CAGAATTTCAGGTGGCAAGAAGG - Exonic
1005105847 6:22223465-22223487 CAGGAGGAGAGGTGGGAAGAAGG - Intergenic
1006170977 6:32092422-32092444 GAGAAGTGCTTCTGGGAAGAGGG + Intronic
1011474862 6:87741490-87741512 CAGAACTCCTGGGGGGGAGATGG + Intergenic
1011525957 6:88265238-88265260 CAGCATGACTGGTGGGATGAAGG + Intergenic
1014813088 6:125906971-125906993 CGGAAGGATTGCTGGGAAGAGGG + Intronic
1015495984 6:133883872-133883894 CAGAGGAAATGGTGAGAAGAGGG + Intergenic
1015698929 6:136013291-136013313 CAAAAGAACTGGTGAAAAGAAGG - Intronic
1016286698 6:142481531-142481553 CAGAAGTACAGGTGGAAACCCGG + Intergenic
1016292401 6:142539434-142539456 TAGAAGTACTGGAGGGGACAGGG - Intergenic
1018151077 6:160940217-160940239 CAGAAGTGCTGATGGGTATAGGG + Intergenic
1019620214 7:1988133-1988155 CGGAAGCACGGGTGGGAAGGTGG + Intronic
1019935038 7:4249308-4249330 GAGCAGGACTGGTGGGAAGGTGG - Intronic
1020141160 7:5612699-5612721 CAGCAGAACTGGTGGGTTGAGGG + Intergenic
1021656902 7:22881706-22881728 AAGAAAGACTGGAGGGAAGAGGG - Intergenic
1022526597 7:31041940-31041962 CAGCCATACTGGCGGGAAGAAGG + Intergenic
1024675969 7:51638225-51638247 CAGTAGCACTGGTGGGATTAAGG - Intergenic
1025872668 7:65449359-65449381 CAGAAGAAAGGGAGGGAAGAAGG - Intergenic
1027870208 7:83696907-83696929 CTGAAATATTGGTGGGTAGATGG + Intergenic
1027888255 7:83937479-83937501 CAGAAATACTGGGTAGAAGAGGG + Intergenic
1029834992 7:103299871-103299893 CAGAAGTAAATGTGGGAGGATGG - Intronic
1031885677 7:127243505-127243527 CAGAATTATTCCTGGGAAGAGGG + Exonic
1033374179 7:140741518-140741540 CACAGCTAGTGGTGGGAAGAAGG - Intronic
1033552408 7:142459497-142459519 TAGAAGTAGTGTTGGGATGAGGG + Intergenic
1033727513 7:144134647-144134669 CAGAAGTCCTGGTGGTCAGCTGG - Intergenic
1034956745 7:155339681-155339703 CAGCAGTTCCCGTGGGAAGAAGG - Intergenic
1034984096 7:155496833-155496855 CAGAGGTCCTCGTGGGGAGAGGG - Intronic
1036293347 8:7515174-7515196 AAGAAGTCCTGATGAGAAGATGG - Intergenic
1036329211 8:7805823-7805845 AAGAAGTCCTGATGAGAAGATGG + Intergenic
1037018073 8:13933194-13933216 CAGAAGATGTGGTGGGAGGAAGG - Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037435756 8:18861462-18861484 GTGAAGTGCTGGTGGGAATATGG - Intronic
1037974069 8:23197085-23197107 CAGCAGAAATGGTGGGAATAGGG - Intronic
1039428781 8:37509320-37509342 CAGAAGGTCTGTTGGGATGATGG - Intergenic
1042401906 8:68359508-68359530 CAGAAGTGCTGGTGATAAGAGGG + Intronic
1042701402 8:71618815-71618837 CAGAATTCCAGGTGGGAAGCAGG + Intergenic
1043350991 8:79360572-79360594 GGGAAGTACTGGGTGGAAGAGGG - Intergenic
1044280477 8:90349656-90349678 CAGTTTGACTGGTGGGAAGAGGG + Intergenic
1045741438 8:105365074-105365096 CATAAGTGCTGGTGTAAAGAGGG + Intronic
1046549746 8:115700082-115700104 AAGAAATACTGGTGGGAGGAGGG - Intronic
1046955820 8:120062000-120062022 ATGAAGTACTGATGAGAAGATGG - Intronic
1047347242 8:124040156-124040178 CAGAAGGACTGGTGTGGGGAAGG + Intronic
1047895559 8:129362613-129362635 TAGCAGTAAAGGTGGGAAGAAGG + Intergenic
1048735982 8:137502400-137502422 CAGAATTGCTGGTGGGAACCTGG + Intergenic
1051327099 9:15983949-15983971 CAATGGTTCTGGTGGGAAGATGG - Intronic
1052684453 9:31737159-31737181 CAGAAGTAGTGGTAGGGGGATGG - Intergenic
1052848032 9:33354591-33354613 CTGAAGGACAGGTGGGATGATGG - Intronic
1053034845 9:34816157-34816179 CAGAAGTTCCAGTGGGAAGATGG - Intergenic
1053681568 9:40489051-40489073 CAGGAGGACTTGTGTGAAGAAGG - Intergenic
1053931562 9:43117381-43117403 CAGGAGGACTTGTGTGAAGAAGG - Intergenic
1054282145 9:63135883-63135905 CAGGAGGACTTGTGTGAAGAAGG + Intergenic
1054294659 9:63324568-63324590 CAGGAGGACTTGTGTGAAGAAGG - Intergenic
1054392679 9:64629055-64629077 CAGGAGGACTTGTGTGAAGAAGG - Intergenic
1054427329 9:65134264-65134286 CAGGAGGACTTGTGTGAAGAAGG - Intergenic
1054503047 9:65887276-65887298 CAGGAGGACTTGTGTGAAGAAGG + Intronic
1055499408 9:76888233-76888255 CACAAGGACTTCTGGGAAGATGG + Intronic
1055524740 9:77120367-77120389 CAGAAGTATCTGGGGGAAGACGG - Intergenic
1056086519 9:83155007-83155029 CACAAGAGGTGGTGGGAAGAAGG - Intergenic
1057541029 9:95970284-95970306 TAAAAGTACTAGTGGGAAGAGGG - Intronic
1059210191 9:112507083-112507105 TAGAAGTATTTGTGGGTAGAGGG + Intronic
1059764579 9:117371551-117371573 CACAACTATTGGGGGGAAGATGG - Intronic
1060697085 9:125718565-125718587 CAGAGGTATTGGTGGGGAGAGGG + Intergenic
1061579781 9:131529941-131529963 CCCAAGGACTTGTGGGAAGAAGG - Intronic
1186684119 X:11906548-11906570 CAGAAGTAATGGAGGCTAGATGG - Intergenic
1189541249 X:41992562-41992584 CACAAGTAGTGCTGGGCAGAAGG - Intergenic
1189918273 X:45878230-45878252 AAAAAGTACTTGTGGGAAGCCGG - Intergenic
1190284723 X:48954564-48954586 CAGAATTAATGATGGGAGGAAGG + Intronic
1190396685 X:49992273-49992295 AAGCAGTAATGGTGGGAAAATGG - Intronic
1190639969 X:52474902-52474924 CAGAAGGACATGGGGGAAGAAGG + Intergenic
1190647703 X:52537963-52537985 CAGAAGGACATGGGGGAAGAAGG - Intergenic
1190787828 X:53669798-53669820 CTGAAGTAATGGTGTGAAGTAGG - Intronic
1192330737 X:70173286-70173308 CAGGAGTGGTGGTGGGACGAGGG - Intergenic
1192678506 X:73226091-73226113 CAGAATGGCAGGTGGGAAGATGG - Intergenic
1192725099 X:73741673-73741695 CTGAAGTCATAGTGGGAAGAAGG - Intergenic
1192935115 X:75850816-75850838 CACACGTGCTGGTGGGAAAAGGG + Intergenic
1194472888 X:94319478-94319500 AAGAAGTGCAGGTGGGAAAATGG - Intergenic
1194869822 X:99115627-99115649 CAGAAGTACTACTGGTAATAAGG - Intergenic
1196820841 X:119699098-119699120 CAGAGGGAGTGGTAGGAAGAGGG + Intergenic
1198131490 X:133700181-133700203 AAGAACCACTGGTGGAAAGAAGG + Intronic
1198327521 X:135588263-135588285 TAGAAGTACTAGTCAGAAGAAGG + Intergenic
1200184303 X:154171879-154171901 CTGCATTGCTGGTGGGAAGATGG + Intergenic
1200189955 X:154209012-154209034 CTGCATTGCTGGTGGGAAGATGG + Intergenic
1200195708 X:154246821-154246843 CTGCATTGCTGGTGGGAAGATGG + Intergenic
1200201362 X:154283937-154283959 CTGCATTGCTGGTGGGAAGATGG + Intronic
1200843275 Y:7805451-7805473 CAGTATTACTTGTGGGCAGAGGG + Intergenic
1201340183 Y:12925250-12925272 CAGAAATAATGTTGGGAAGAGGG + Intergenic