ID: 923183630

View in Genome Browser
Species Human (GRCh38)
Location 1:231548534-231548556
Sequence CAGTGGGAATAGAGAGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 1, 1: 2, 2: 5, 3: 46, 4: 559}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923183621_923183630 20 Left 923183621 1:231548491-231548513 CCTTCTTGGAGTGAAATGAATAG 0: 1
1: 0
2: 0
3: 16
4: 170
Right 923183630 1:231548534-231548556 CAGTGGGAATAGAGAGGAATGGG 0: 1
1: 2
2: 5
3: 46
4: 559
923183625_923183630 -5 Left 923183625 1:231548516-231548538 CCTCAAGTTTGGTGTTAGCAGTG 0: 1
1: 0
2: 0
3: 16
4: 192
Right 923183630 1:231548534-231548556 CAGTGGGAATAGAGAGGAATGGG 0: 1
1: 2
2: 5
3: 46
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923183630 Original CRISPR CAGTGGGAATAGAGAGGAAT GGG Intronic
900906782 1:5564844-5564866 CTGTAGGAAAAGAGAGAAATTGG - Intergenic
901157715 1:7151593-7151615 CCTTGGGCATAGCGAGGAATTGG - Intronic
902688225 1:18092846-18092868 CAGTGGGGACAGAGGAGAATGGG - Intergenic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903920518 1:26796837-26796859 CGGTGGTGATAGAGAGGGATGGG + Intronic
904706567 1:32395203-32395225 CAGAGGGAAAAGAGATGAAGGGG - Intergenic
905544358 1:38785994-38786016 CAATGGGAATGGAGAGGAAAGGG + Intergenic
905634132 1:39537993-39538015 CTCTGGGAATCGAGTGGAATGGG - Intergenic
905945789 1:41900625-41900647 GAGAGGGAATAGAGAGGCAGTGG + Intronic
906191773 1:43903573-43903595 CAGGGGGAAGAGAGAGGACAGGG + Intronic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
906662071 1:47590149-47590171 CAGAGAGAGTAAAGAGGAATGGG + Intergenic
906713222 1:47948184-47948206 CAGTGGGGATAGAGAGACTTGGG + Intronic
907259681 1:53208230-53208252 CAGGGGATTTAGAGAGGAATAGG - Intronic
907571139 1:55485100-55485122 CAGTGGGAATCGGGAGGTCTGGG + Intergenic
907633928 1:56113880-56113902 CAGTGGGGATAGAGCTGAACAGG + Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907861413 1:58357243-58357265 CAGTGAGAACAGAGGGAAATGGG + Intronic
908140159 1:61176009-61176031 GAGTGGGAATTGAGAGGCAAAGG + Intronic
908418010 1:63932291-63932313 GAGTGGGAATGGAGAGGAAGTGG + Intronic
908992222 1:70105433-70105455 CAGTGGTAATACACAGTAATGGG - Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909688463 1:78377608-78377630 CAATGGGAATAAAGAGGAAAGGG - Intronic
910197145 1:84653455-84653477 CAGTGGGCATAGTGAGGGATGGG - Intronic
910520083 1:88110891-88110913 CAGTGGAAATGGACAGGAAGTGG - Intergenic
911294212 1:96094124-96094146 CAGTGGAAAGGGAGAGGTATTGG + Intergenic
911630424 1:100177263-100177285 GACTGGTGATAGAGAGGAATCGG + Intronic
912073957 1:105849319-105849341 CAGTAGGAAGAGAGGGGGATGGG - Intergenic
912185243 1:107267563-107267585 CAGTGGAATTTGAGAGGATTAGG - Intronic
912463770 1:109855216-109855238 CAGTGGGTATAGAGAGACAACGG + Intergenic
912468545 1:109890830-109890852 CAGTGGGAATAAATAGAAAGAGG - Intergenic
912588046 1:110784705-110784727 TAGTGGGAATTGAGAGAAACAGG - Intergenic
913182649 1:116337007-116337029 GAGAGGGAAAAGAAAGGAATGGG - Intergenic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
915989968 1:160504110-160504132 GAGAGGGAACAGAGAGGAAATGG + Intronic
916946028 1:169728280-169728302 CAGTGGAACTAGAGAGTACTTGG + Intronic
917332615 1:173897741-173897763 AAGTGAGTATAGAGAAGAATGGG - Exonic
917746301 1:178011247-178011269 CAGTGGGAAATGAGGGGAAAGGG + Intergenic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
919334841 1:196219263-196219285 CAGGAGGAATAGGGAGAAATGGG + Intergenic
919523797 1:198622106-198622128 GAGGGAGAATAGAGATGAATTGG + Intergenic
920047704 1:203144301-203144323 CTGTGGATATAGAGATGAATAGG - Intronic
920742540 1:208595297-208595319 CAGTGGTAATAGGGAGGAGGAGG + Intergenic
921050160 1:211505489-211505511 TAATGGGAAGAGAGAGGAAAGGG + Intergenic
921154517 1:212428655-212428677 CACAGGCAATAGAGACGAATAGG - Intergenic
923183630 1:231548534-231548556 CAGTGGGAATAGAGAGGAATGGG + Intronic
923489219 1:234468576-234468598 AAGTGGGATAAGAGAAGAATTGG - Intronic
924284694 1:242474458-242474480 CAGTGGGAATTGAGAAGAAAGGG - Intronic
1063348652 10:5335185-5335207 CAGTGGGTAAAGGGAGGATTAGG + Intergenic
1063742271 10:8837072-8837094 CAAAGGCAATAGAGAGTAATGGG - Intergenic
1065185630 10:23168433-23168455 CAGTGGGAAGATAGATGAAGGGG - Intergenic
1066937319 10:41855535-41855557 CAAATGGAATAGAGTGGAATCGG - Intergenic
1068712245 10:60147699-60147721 CAGGAGGAAGAGAGAGGAAGGGG - Intronic
1068774197 10:60853566-60853588 CAGTGGGAAGAGAGAGGGAGGGG + Intergenic
1071918045 10:90318281-90318303 TATAGGGAACAGAGAGGAATTGG + Intergenic
1072576271 10:96703342-96703364 CAATGGGAATGGAGAGGGAGGGG + Intronic
1073950071 10:108797321-108797343 CAGAAGGAAGAGAGAGGAAAAGG + Intergenic
1074179925 10:111050919-111050941 CTGTGGGAATGGACAGGCATTGG + Intergenic
1074332411 10:112528783-112528805 CAGAGGAAATAGAAAGGAAGGGG + Intronic
1074604689 10:114949741-114949763 CAGAGGGAATGGAAAGGAAGGGG + Intronic
1074667165 10:115741320-115741342 CAGTAGGCAGAGATAGGAATAGG + Intronic
1075352082 10:121733191-121733213 CAGGTGGAAGTGAGAGGAATAGG - Intergenic
1075628606 10:123985152-123985174 CAGTAGCAAGAGAGAGGAAGGGG + Intergenic
1076429772 10:130393623-130393645 CCATGGGAGTGGAGAGGAATGGG - Intergenic
1076462903 10:130658556-130658578 CAGTGTGAGGAGAGAGGAAGAGG + Intergenic
1077497340 11:2892576-2892598 CAGGGGGAGCAGAGAGGAAATGG - Intronic
1077800585 11:5532052-5532074 AAGTGGGAATAAACAGGAATAGG - Intronic
1077826536 11:5815584-5815606 CAGTGAGAATGTAGAGAAATTGG + Intronic
1078126974 11:8575588-8575610 CTGGGGGAAGAGAGAAGAATGGG + Intronic
1078474159 11:11616681-11616703 CAGTGGTACTAGAGACAAATAGG - Intronic
1078603201 11:12751437-12751459 CTGTGGGAACACAGAGGAGTGGG + Intronic
1080193402 11:29578794-29578816 CAGTGGAATGAGAGAGGAAGTGG - Intergenic
1081216533 11:40405771-40405793 CTGTGGGAAAAGTGAGGAAGTGG - Intronic
1081833076 11:46130886-46130908 CAGTGGGAATGGAGAAGCAGAGG + Intergenic
1082568339 11:54708114-54708136 CAATGGAGAAAGAGAGGAATAGG + Intergenic
1082624636 11:55467999-55468021 GAATGGGAAAAGGGAGGAATAGG + Intergenic
1083341094 11:61958929-61958951 CAGGGGGAATTTAGAGGAATAGG - Intronic
1084521409 11:69665280-69665302 CAGTGGGCATAGAGATGTCTCGG + Intronic
1084982720 11:72840017-72840039 GAGTGGGAAGAGAGAGCAGTGGG - Intronic
1085534025 11:77207467-77207489 CAGACGGAAGAGAGAGGAACTGG + Intronic
1085873335 11:80376533-80376555 CAGAGGGAATTCAGAGGACTAGG + Intergenic
1086312644 11:85551941-85551963 CAGTGGGAAAAGAGAGTATCAGG + Intronic
1086496411 11:87409005-87409027 GAGTGGCAGGAGAGAGGAATAGG - Intergenic
1086602840 11:88656268-88656290 CAGTGAGAAGAGGGAGAAATTGG - Intronic
1087402844 11:97689453-97689475 CATTGGGATTAGGGAGGAAGGGG - Intergenic
1087645154 11:100800331-100800353 CACTGGGAACAGAGGGGAGTTGG + Intronic
1088475590 11:110235423-110235445 AAATGAGAATAAAGAGGAATGGG - Intronic
1088977751 11:114830817-114830839 TAGTAGAAATAGAGAGGAAATGG + Intergenic
1089093227 11:115896351-115896373 CATTGGGAAGAGAGAGGAGAGGG - Intergenic
1089682802 11:120128850-120128872 CAATGGGAAGAGAAAGGAAGGGG + Intronic
1089844394 11:121447074-121447096 CCCTGGGAATATAGAGGAGTAGG - Intergenic
1090414478 11:126531197-126531219 CAGTGGGAATAGAGAGGAAAGGG - Intronic
1092025521 12:5236514-5236536 CAGAGGGTATAGAGAGGAACAGG + Intergenic
1092136052 12:6148008-6148030 CAGTGGGAGCAGAGAGCACTGGG - Intergenic
1092269287 12:7009976-7009998 CTGTGGGAATATAAAGAAATGGG + Intronic
1092950071 12:13494083-13494105 CAGTGAGAATATAGAGAAAAGGG - Intergenic
1094313646 12:29114132-29114154 TAGTGGGAATAGAAAGAAAAGGG + Intergenic
1094445975 12:30530883-30530905 CAGTGAGAGTAGATAGGAATTGG - Intergenic
1094530179 12:31267032-31267054 CAATGGGGGTAGGGAGGAATTGG - Intergenic
1096753802 12:53781997-53782019 CACTGTGAAAAGAGAGGAAGAGG - Intergenic
1096766667 12:53896610-53896632 AAGTGGGAATGGCAAGGAATGGG - Intergenic
1097171921 12:57119996-57120018 TAGTGGGAATACAGAGCAACTGG - Intronic
1097181680 12:57175315-57175337 CAGCAGGAATGGAGACGAATGGG + Intronic
1097926951 12:65139324-65139346 CAGTGTGGCTAGAGAGAAATGGG - Intergenic
1098300742 12:69051876-69051898 CAGTGGGAAAAGGGTGGAAAAGG + Intergenic
1098377957 12:69837462-69837484 CCGGGGGAGTGGAGAGGAATTGG + Intronic
1098990538 12:77060660-77060682 CAGTGGCATTAAAGAGGAAGTGG - Intronic
1099648295 12:85389636-85389658 CAGTAAGAATAGAAAGGAAGAGG - Intergenic
1099717827 12:86319119-86319141 CAGTAGGAGTAGAAAGGAGTAGG - Intronic
1100046658 12:90390200-90390222 CAGGGGCGATAGAGAGGTATTGG + Intergenic
1100419564 12:94418416-94418438 CAGCAGAAATAGAGAGGAAGAGG + Intronic
1101568029 12:105928027-105928049 CAGTGGGAAGAGAGTGGAAGAGG + Intergenic
1101896243 12:108759127-108759149 CTATGGGAATAGCGAGGAAAGGG + Intergenic
1102645879 12:114403592-114403614 GAGTGGGAATAAAAAGGAAAAGG + Intronic
1102732780 12:115127751-115127773 GAGTGTTATTAGAGAGGAATAGG - Intergenic
1102736430 12:115164921-115164943 TAGTGGGAAGAGAGAAGGATGGG - Intergenic
1102807034 12:115791291-115791313 CAGAGGAATTTGAGAGGAATGGG + Intergenic
1103175556 12:118860337-118860359 CAGAGGCAATAGACAGGCATGGG + Intergenic
1103551867 12:121743835-121743857 CAGTGGAAAAAGACAGGACTGGG + Intronic
1103781579 12:123402313-123402335 CAGTGGGAATGGAGATGGAGAGG + Intronic
1103852328 12:123941230-123941252 CTGTGGGAATGCAGAGGAACAGG - Intronic
1104751531 12:131243085-131243107 CAATGGGATGAGAGAGGAAATGG - Intergenic
1106071649 13:26417692-26417714 CAGGGAGAATAGAGAGGATAGGG - Intergenic
1106569941 13:30917703-30917725 CAGGGGGAAGAGAGCGGAAGCGG + Intronic
1110601001 13:77373531-77373553 CATTGGGAGGAGACAGGAATTGG + Intergenic
1112177737 13:97044216-97044238 AACTGGGAATAGAGAGCAAAAGG - Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1113250705 13:108449451-108449473 CAGTTGGAATAGAGAGTCATGGG + Intergenic
1114149841 14:20025874-20025896 AAGAGAGAATAAAGAGGAATTGG - Intergenic
1114163486 14:20195077-20195099 TGGTGGGAATAGGGTGGAATAGG - Intergenic
1114337250 14:21703278-21703300 CAATGAGAATGGAGAGGAAAGGG + Intergenic
1116193600 14:41691761-41691783 CTCTGGGAATAGTAAGGAATGGG - Intronic
1117428196 14:55623031-55623053 AAGTGGGCATAGAAAGAAATTGG - Intronic
1117841242 14:59862647-59862669 CAGTGGGAACAGATGGGAAATGG - Intronic
1118204857 14:63713389-63713411 CAATGGCAGTAGAGAGAAATGGG - Intronic
1119657311 14:76426220-76426242 ATGGGGGAAGAGAGAGGAATAGG + Intronic
1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG + Intronic
1120394866 14:83956170-83956192 CAGTGGGACTAGAAATGTATGGG - Intergenic
1120715862 14:87840139-87840161 CACTGGGAAGACAGAGGAAGTGG - Intronic
1120930120 14:89839787-89839809 CAGGGGGAAGAGAGAGGAAGGGG + Intronic
1121501429 14:94441525-94441547 CAATGGGTAAAGAGAGGAAAAGG - Intergenic
1121689468 14:95865871-95865893 CACTGGGGAGAGAGAGGAAAAGG + Intergenic
1124037091 15:26063997-26064019 CAGTGAGAATAAAGAGGCAGAGG - Intergenic
1125189036 15:36967953-36967975 CAGCGGCAATAGAGAGGGCTAGG - Intronic
1125394360 15:39230898-39230920 CAGAGGGAAAAGACAGGAATAGG + Intergenic
1125840437 15:42796047-42796069 CAGTGAGTTTAGGGAGGAATAGG + Intronic
1125890681 15:43264142-43264164 TAGTGGGAATGCAGAGAAATTGG + Intronic
1126069119 15:44850258-44850280 CAGTTGGAAAAGAGAGGTAAGGG + Intergenic
1126089692 15:45040515-45040537 CAGTTGGAAAAGAGAGGTAAGGG - Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1127473353 15:59309980-59310002 CTGTGAGAACAGAGAGGAAAGGG - Intronic
1127697994 15:61470581-61470603 CAGTGGAAATGGAGTGGAATTGG - Intergenic
1128115349 15:65101883-65101905 CAGTGGGAAACGCGGGGAATGGG + Intronic
1128194859 15:65743503-65743525 GATTGGGAGTAGAGGGGAATGGG - Intronic
1128976393 15:72156746-72156768 CCCTGGGAATAGTGAGGAGTGGG + Intergenic
1129083140 15:73059527-73059549 CTGTGGAAATAAAGATGAATTGG + Intronic
1129178257 15:73855449-73855471 CAGGGGGAAGAGAGAGAAAGAGG + Intergenic
1129322524 15:74782812-74782834 AAGTGGGAGAAGAGGGGAATGGG - Intronic
1129922559 15:79332432-79332454 AAGTGGGAGTAGAGGGCAATTGG + Intronic
1130333760 15:82941575-82941597 CAGTGGGCTTGGAGAGGAAGAGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131346793 15:91656797-91656819 CAGTGGGAATAGAAAAGGAAAGG + Intergenic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133516167 16:6511259-6511281 CACAGGAAATAGGGAGGAATAGG + Intronic
1135117349 16:19735011-19735033 AAATGGGAGCAGAGAGGAATTGG - Intronic
1135722906 16:24832354-24832376 CAGTGGAGAAAGAGAGGGATGGG + Intergenic
1136542844 16:30937917-30937939 CAGTGGGCAGAGAGAGGTTTTGG + Intronic
1137420191 16:48326812-48326834 CTGTGGGAAGAGGGAGGAAAGGG - Intronic
1137510939 16:49100217-49100239 TGGTGGTAATAGAGAAGAATTGG - Intergenic
1138769257 16:59643598-59643620 CAGAGGAAAAAGAGAGGAAAGGG - Intergenic
1138924239 16:61571252-61571274 CAGTGGGGAGAGGGAGGAAATGG - Intergenic
1139254555 16:65528626-65528648 CAGTGGGAACAGGAAGCAATAGG + Intergenic
1139615063 16:68084054-68084076 CAGTGGGAAGAGAGGGTAAAGGG - Intergenic
1139632106 16:68237083-68237105 CACTGGGCAAAGGGAGGAATGGG - Intronic
1141471539 16:84241890-84241912 CAGAGAGAACTGAGAGGAATGGG - Intergenic
1141798457 16:86290799-86290821 CATTGGGAATAGAGGGGGAAAGG + Intergenic
1143351889 17:6294916-6294938 CAGTGGGAATCGAGAGTTATGGG + Intergenic
1146266268 17:31454959-31454981 CAGTGGGAACAGGCAGGAAGAGG + Intronic
1146549363 17:33766842-33766864 CAATGGTAGTTGAGAGGAATGGG - Intronic
1147131247 17:38410629-38410651 AAGTGGGGAGAGAGATGAATAGG - Intergenic
1147620178 17:41861259-41861281 CTGTGGTTATAGAAAGGAATAGG - Intronic
1148581408 17:48746695-48746717 CAGGGGAAAGAGAGTGGAATGGG + Intergenic
1149775654 17:59354892-59354914 CAGTGAGAGAAGAGAGGAGTTGG + Intronic
1150162135 17:62907496-62907518 TAGTGGGAAACTAGAGGAATGGG + Intergenic
1150228266 17:63535426-63535448 CAGTGGGAGAACAGAGGAAGGGG - Intronic
1150937858 17:69657006-69657028 TATTAGGAATAGAGAGAAATAGG - Intergenic
1151107897 17:71639334-71639356 CAGTGGGAAGAGCAAGGAAAAGG + Intergenic
1151247683 17:72807666-72807688 CAGTGGGCCTGGAGAGGAAATGG + Intronic
1151803384 17:76390839-76390861 CAGTGGGGACAGAGGGGCATGGG + Exonic
1152768408 17:82153126-82153148 CTGGGAGAATAGACAGGAATGGG + Intronic
1153864397 18:9250397-9250419 TAGTGGGAATAGAGAGAAAACGG + Intronic
1154127465 18:11704443-11704465 AAGTGGGAATAGTGAGGAATGGG + Intronic
1155014627 18:21821087-21821109 CAGTGGGAACAGAATGGAATGGG - Intronic
1155366001 18:25049530-25049552 CAGTGGGAGTATAGAGGTAATGG - Intergenic
1155776625 18:29771184-29771206 CAATGGGAATAGAAGGGGATAGG + Intergenic
1155935632 18:31750221-31750243 TAGAGGGAAATGAGAGGAATAGG - Intergenic
1156093467 18:33499889-33499911 CAATGGGAATATGGAGGATTTGG - Intergenic
1156228116 18:35129033-35129055 GAGTGAGAAGAGAGAGGAATAGG + Intronic
1156623542 18:38881724-38881746 GAGAGGGAATAGGGAGCAATGGG + Intergenic
1157551090 18:48582328-48582350 CCGTGGGAACAGAGAAGAAGGGG + Intronic
1158038266 18:53061306-53061328 GAGTAGGAATAGAAAGGATTAGG - Intronic
1158320630 18:56258183-56258205 TATTGGGAATAGAGAGGGAAAGG - Intergenic
1159310876 18:66707346-66707368 CAGTGGGAGCAGAGAGGCAGTGG + Intergenic
1159485726 18:69054897-69054919 TAGTGGGAATAGAGAAAATTAGG + Exonic
1161800343 19:6414126-6414148 GAGAGGGAAGAGATAGGAATTGG + Intronic
1162403012 19:10457470-10457492 CACTGGGAAGAGAGAGGGAAGGG - Intronic
1162851003 19:13431042-13431064 GAGTGGGAATAGAGGGGGATGGG + Intronic
1163897876 19:20075495-20075517 AATTGGGAATAAAGAGGTATGGG - Intergenic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1165447210 19:35862843-35862865 AAGCGGGAAGAGAGAGGACTGGG - Intronic
1166583178 19:43920985-43921007 CAGTGGTCATAGAGAAGAAGAGG + Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1168546192 19:57252300-57252322 CAGTTGGAATTAAGAGGATTTGG - Intronic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
926486015 2:13459465-13459487 CAGTGAGAAGAGAGAGGTTTGGG + Intergenic
926591962 2:14749891-14749913 TAGGGGGAATGGTGAGGAATGGG + Intergenic
927919044 2:26957496-26957518 GAGAGGGAATATAGAGAAATAGG - Intergenic
928036077 2:27824731-27824753 AAATGGGAATGGAGAGGGATTGG - Intronic
928077476 2:28278358-28278380 CAGTGGGAATAGGGAGGAAGAGG + Intronic
929241665 2:39659779-39659801 CAGTGGAAACAGAGAGAAATGGG - Intergenic
929464655 2:42133731-42133753 CAGTGGTAATCGAGGGGATTTGG - Intergenic
930370430 2:50494461-50494483 CAGAGGGAATAAAGAGAAAGAGG + Intronic
930446449 2:51479614-51479636 CTGGGGGAATAGAGAGGATTGGG + Intergenic
930629114 2:53733139-53733161 TAGTGGGAATACAGATGAAATGG + Intronic
931342634 2:61416692-61416714 AAATGGGAAGAGAAAGGAATAGG - Intronic
931669813 2:64636879-64636901 CAGAGGGGAGAGAGAGGAAATGG + Intronic
932039459 2:68283813-68283835 CATAGGGAAGAGAGAGGCATGGG - Intergenic
932107335 2:68956786-68956808 GAGAGGGAAAAGAGAGGAAAAGG - Intergenic
932418349 2:71586935-71586957 CAGTGGGAGTAGGGAGGATAGGG - Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
934521579 2:95023376-95023398 CATTGGTAAGAGAGAGGCATTGG - Intergenic
934521596 2:95023547-95023569 CACTGGTAATAGAGAGACATTGG - Intergenic
935641467 2:105294561-105294583 CAGTGGGAACTGAGAATAATGGG + Intronic
936980466 2:118260310-118260332 CAGGGGGAACAAACAGGAATAGG + Intergenic
937134534 2:119541562-119541584 CAGTGGGAAGAAAGAGAAAATGG + Intergenic
938558795 2:132451264-132451286 GAGTGGAAATAGAGAGTAATGGG - Intronic
939831053 2:147071091-147071113 CAAGGGGAAAAGAAAGGAATGGG + Intergenic
940086132 2:149861198-149861220 CAGGAGGAATAGAGAGAAAAGGG + Intergenic
940392966 2:153154042-153154064 CAGAGGGAACAGAGACAAATGGG - Intergenic
940922304 2:159322407-159322429 TACTGGGAAGAGGGAGGAATGGG - Intronic
941099983 2:161284801-161284823 CAGTGGGAGTGGAAAGGATTAGG - Intergenic
941498906 2:166243850-166243872 AAGGGTGAATAGAGAGGAGTAGG + Intronic
941723684 2:168838664-168838686 CATGGGGAATAGATAGGAACAGG - Intronic
942976141 2:182020664-182020686 CAGTGGGGAAAGAGAGGATCAGG - Intronic
943055494 2:182972909-182972931 AAGTGGGAATAAAGAAGGATTGG + Intronic
943212338 2:184983809-184983831 CTGTGTGAATAAAGATGAATGGG - Intergenic
943960112 2:194253852-194253874 CAGTGGTAATAGAGAGCAAGGGG + Intergenic
943993305 2:194726204-194726226 CAGCTTGAATAGAGAAGAATGGG - Intergenic
944282177 2:197910615-197910637 CTGTGAGAACAGAGATGAATAGG - Intronic
944506185 2:200414080-200414102 AAGTGGGGGTAGGGAGGAATGGG - Intronic
946204555 2:218094191-218094213 CAAGGGGAATAGAGGAGAATGGG + Intergenic
946684763 2:222256468-222256490 CAGTGGGAGTGGAGAGGGAGAGG - Intronic
946920315 2:224573942-224573964 TAGTGGAAATGGAAAGGAATTGG + Intronic
948010048 2:234645445-234645467 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010061 2:234645495-234645517 CAGTGGGAGTAGGGAGGTAGTGG - Intergenic
948010066 2:234645512-234645534 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010071 2:234645529-234645551 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010083 2:234645579-234645601 CAGTGGGAGTAGGGAGGTAGTGG - Intergenic
948010088 2:234645596-234645618 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010096 2:234645629-234645651 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010104 2:234645662-234645684 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010108 2:234645678-234645700 CAGTGGGAGTAGACAGCAGTGGG - Intergenic
948010111 2:234645695-234645717 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010119 2:234645728-234645750 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010128 2:234645761-234645783 CAGTGGGAGTAGGCAGCAATGGG - Intergenic
948010132 2:234645778-234645800 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010145 2:234645828-234645850 CAGTGGGAGTAGGGAGGTAGTGG - Intergenic
948010150 2:234645845-234645867 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010158 2:234645879-234645901 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010163 2:234645896-234645918 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010177 2:234645949-234645971 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010202 2:234646065-234646087 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010210 2:234646098-234646120 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010215 2:234646115-234646137 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010223 2:234646148-234646170 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010228 2:234646165-234646187 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010236 2:234646198-234646220 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010241 2:234646215-234646237 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010249 2:234646248-234646270 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010261 2:234646299-234646321 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010269 2:234646333-234646355 CAGTGGGAGTAGGGAGGCACGGG - Intergenic
948010275 2:234646350-234646372 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010292 2:234646431-234646453 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010300 2:234646464-234646486 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010305 2:234646481-234646503 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010313 2:234646514-234646536 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010318 2:234646531-234646553 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010326 2:234646564-234646586 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010331 2:234646581-234646603 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010351 2:234646664-234646686 CAGTGGGAGTAGGGAGGTAGTGG - Intergenic
948010362 2:234646714-234646736 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010372 2:234646748-234646770 CAGTGGGAGTAGGGAGGTAGTGG - Intergenic
948010377 2:234646765-234646787 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010382 2:234646782-234646804 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010387 2:234646799-234646821 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010392 2:234646816-234646838 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010397 2:234646833-234646855 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010402 2:234646850-234646872 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010412 2:234646884-234646906 CAGTGGGAGTAGGGAGGTAGTGG - Intergenic
948010417 2:234646901-234646923 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010429 2:234646952-234646974 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010434 2:234646969-234646991 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010442 2:234647002-234647024 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010447 2:234647019-234647041 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010455 2:234647052-234647074 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010460 2:234647069-234647091 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010468 2:234647102-234647124 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010473 2:234647119-234647141 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010481 2:234647152-234647174 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010493 2:234647203-234647225 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010501 2:234647237-234647259 CAGTGGGAGTAGGGAGGCACGGG - Intergenic
948010507 2:234647254-234647276 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010524 2:234647335-234647357 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010532 2:234647368-234647390 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010537 2:234647385-234647407 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010545 2:234647418-234647440 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010550 2:234647435-234647457 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010558 2:234647468-234647490 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010563 2:234647485-234647507 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010571 2:234647518-234647540 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010583 2:234647569-234647591 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010591 2:234647603-234647625 CAGTGGGAGTAGGGAGGCACGGG - Intergenic
948010597 2:234647620-234647642 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010614 2:234647701-234647723 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010622 2:234647734-234647756 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010627 2:234647751-234647773 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010635 2:234647784-234647806 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010640 2:234647801-234647823 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010648 2:234647834-234647856 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010653 2:234647851-234647873 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010661 2:234647884-234647906 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010670 2:234647917-234647939 CAGTGGGAGTAGGCAGCAATGGG - Intergenic
948010674 2:234647934-234647956 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010679 2:234647951-234647973 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010684 2:234647968-234647990 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010692 2:234648001-234648023 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010708 2:234648082-234648104 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010713 2:234648099-234648121 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010721 2:234648132-234648154 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010726 2:234648149-234648171 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010746 2:234648232-234648254 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010751 2:234648249-234648271 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010756 2:234648266-234648288 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010764 2:234648299-234648321 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010769 2:234648316-234648338 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010777 2:234648349-234648371 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010789 2:234648400-234648422 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010797 2:234648434-234648456 CAGTGGGAGTAGGGAGGCACGGG - Intergenic
948010803 2:234648451-234648473 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010811 2:234648485-234648507 CAGTGGGAGTAGGGAGGCACGGG - Intergenic
948010829 2:234648566-234648588 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010837 2:234648599-234648621 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010842 2:234648616-234648638 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010850 2:234648649-234648671 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010855 2:234648666-234648688 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010863 2:234648699-234648721 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010868 2:234648716-234648738 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010888 2:234648799-234648821 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010899 2:234648849-234648871 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010909 2:234648883-234648905 CAGTGGGAGTAGGGAGGTAGTGG - Intergenic
948010914 2:234648900-234648922 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010919 2:234648917-234648939 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010924 2:234648934-234648956 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010934 2:234648968-234648990 CAGTGGGAGTAGGGAGGTAGTGG - Intergenic
948010939 2:234648985-234649007 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010951 2:234649036-234649058 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010956 2:234649053-234649075 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010964 2:234649086-234649108 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010969 2:234649103-234649125 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010977 2:234649136-234649158 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010982 2:234649153-234649175 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010990 2:234649186-234649208 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948010995 2:234649203-234649225 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948011000 2:234649220-234649242 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948011005 2:234649237-234649259 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948011010 2:234649254-234649276 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948011018 2:234649287-234649309 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948011034 2:234649368-234649390 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948011039 2:234649385-234649407 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948011047 2:234649418-234649440 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948011052 2:234649435-234649457 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948011072 2:234649518-234649540 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948011077 2:234649535-234649557 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948011082 2:234649552-234649574 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948011090 2:234649585-234649607 CAGTGGGAGTAGGGAGGCAGTGG - Intergenic
948920994 2:241065869-241065891 AAGTGGGACTGGGGAGGAATGGG + Intronic
1169764726 20:9136605-9136627 CAGTGGGAATGTGGAGGGATTGG + Intronic
1171091183 20:22287094-22287116 TAGTGGGAAGAGGGAGGAACAGG + Intergenic
1171327869 20:24311553-24311575 CAGTGAGATTAGAGAGGAGGTGG + Intergenic
1172693050 20:36803651-36803673 CAGTGGGAAGAAGGTGGAATTGG + Intronic
1173448870 20:43144425-43144447 CAGTGGGGATAGAAGGGATTAGG - Intronic
1173461622 20:43247686-43247708 GATTGGGAAGAGAGAGGAGTTGG + Intergenic
1174898733 20:54476352-54476374 GAGTGGGAAAAGAGGGGAACCGG - Intronic
1177864905 21:26500698-26500720 GAGTGGGAAGACAGAGCAATTGG + Intronic
1178940627 21:36902225-36902247 CAGTGGCTAGAGGGAGGAATGGG + Intronic
1180645948 22:17339183-17339205 CAGTGGGAAGTCAGAGCAATGGG - Intergenic
1184464947 22:44663478-44663500 CAATGGGAACAGAGAGAGATTGG - Intergenic
1184876318 22:47278034-47278056 AAGTGGGAACTGAGAGAAATGGG + Intergenic
1184898427 22:47426140-47426162 AAGTGGGAATAGAGAATAAAGGG + Intergenic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950928846 3:16769434-16769456 CAGTGGTATTAGAGAGGGAAAGG + Intergenic
953138850 3:40208877-40208899 GGGTGGGAATGGAGAGGAAGAGG - Intronic
953720198 3:45348322-45348344 GGGTGGGTATACAGAGGAATTGG + Intergenic
954225046 3:49175894-49175916 CTGTGGGATGAGAGAGGCATGGG + Exonic
954225112 3:49176236-49176258 CAGAGAGAATAGAGAGGATGTGG + Exonic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
955141855 3:56277582-56277604 CAGTGGGAATAGACAGGGAAAGG - Intronic
956082880 3:65578475-65578497 AAGTGGGAACAAAGAAGAATAGG - Intronic
956245946 3:67183292-67183314 CAGTGGGATTGGAGCTGAATGGG + Intergenic
956694481 3:71906905-71906927 GAGAGGGAACAGAGAGGAGTAGG + Intergenic
956890468 3:73608123-73608145 CAGTGGGAAGAGAAAGCAAAGGG + Intronic
957166911 3:76686190-76686212 CAGTCGGTGTAGAGAGGAAAAGG + Intronic
957566997 3:81896730-81896752 CACTGGGGATACAGAGGACTCGG + Intergenic
958121073 3:89289282-89289304 CAGTGGGAATAAAGAGTAAAAGG - Intronic
959388903 3:105748502-105748524 CAGTGGGGATATAGAGGAAAAGG + Intronic
959897785 3:111624658-111624680 CAGTGGGAATCGAGAGTGAAGGG + Intronic
960423869 3:117482358-117482380 CTGTGGGACTTGAGAGGAAGAGG + Intergenic
962311144 3:134327619-134327641 CAGTGGGAAGGAAGAGGAAGAGG + Intergenic
962453636 3:135544652-135544674 CATTCTTAATAGAGAGGAATTGG - Intergenic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963097322 3:141557748-141557770 CTATGGAAATAGAGAGGAAGAGG + Intronic
963275322 3:143324281-143324303 CTGTGGGAATGGAGAGGGAGAGG - Intronic
963289449 3:143473130-143473152 CAGTGGGAAATGAGAGGAGCTGG - Intronic
963483088 3:145902368-145902390 CAGTGGCTGTAGATAGGAATGGG - Intergenic
964094904 3:152919957-152919979 TGGTGGGAATAAAGAGGAAAGGG + Intergenic
964407450 3:156364172-156364194 CAGTCTGAATCCAGAGGAATGGG - Intronic
964642106 3:158919470-158919492 CAGTTGGAAGAGTGAGGAATTGG + Intergenic
964764765 3:160169318-160169340 GTGTGGGAATGGGGAGGAATAGG - Intergenic
965338507 3:167457475-167457497 CACTGGGAATAGTAAGGAACTGG - Intronic
965747435 3:171939961-171939983 AAGTGGGAATAAGGAGGCATGGG + Intergenic
965911424 3:173782128-173782150 TATTGGGGATAGGGAGGAATAGG + Intronic
966076249 3:175938687-175938709 CAGTAGGAAGAGAGAGAAAGAGG - Intergenic
966215577 3:177498863-177498885 CAGTGGTAATAGAGAGGCCTTGG - Intergenic
966319593 3:178686425-178686447 CACAGGGCACAGAGAGGAATTGG - Intronic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966813649 3:183870731-183870753 AAGTGGCAAGAGAGAGGAAGGGG - Intronic
967755138 3:193160270-193160292 AAATGGGTATTGAGAGGAATTGG - Intergenic
967943905 3:194787141-194787163 CTGTGGGAATGGAGAGGGAGGGG + Intergenic
969841877 4:9888783-9888805 CAGAGGGCAGACAGAGGAATGGG + Intronic
970173159 4:13309053-13309075 CAAAGGGAACAGAGAGGACTGGG - Intergenic
970186987 4:13466552-13466574 CAGTGAGAATATAGAGAAAAGGG + Intronic
970569119 4:17362383-17362405 GAGTGGGAAAAGAGAGGGAGTGG - Intergenic
970865869 4:20758048-20758070 TAGGGGGAATTAAGAGGAATAGG - Intronic
971253142 4:24989877-24989899 CAGTGGGGATAGGGTGGGATGGG - Intergenic
971344156 4:25797024-25797046 CAGGGGGAATAGACAGGTAGTGG + Intronic
971361826 4:25945253-25945275 CACAGGGAATATGGAGGAATGGG + Intergenic
971464746 4:26944906-26944928 TTGTGGGAATAGAGAGTATTTGG + Intronic
972704772 4:41531542-41531564 CACTGGGCATAGAGAGGTTTGGG - Intronic
972707572 4:41560255-41560277 CAGGAGGAATAGAAAGGAAAAGG - Intronic
973336167 4:48958912-48958934 CAGTGGAAATGGAGAAGAAGAGG + Intergenic
973639457 4:52888300-52888322 CAGAGAGAAGAGAGAGGACTGGG + Intronic
975340129 4:73230601-73230623 TAGTTGGATTAGAGAAGAATGGG - Intronic
975996629 4:80322682-80322704 CAGTAGGAAAAGGTAGGAATAGG + Intronic
976386233 4:84461901-84461923 CAGTGAAGTTAGAGAGGAATTGG - Intergenic
977460721 4:97321516-97321538 CACTGGAAACAGAGAGGAGTGGG - Intronic
977506989 4:97915244-97915266 CACTGGGAAAAGAGAAGAAAAGG + Intronic
978490186 4:109303338-109303360 CAGTGGGAAGAGAAGGGAAGTGG - Intergenic
979451084 4:120871789-120871811 TGGTGAGAATATAGAGGAATTGG + Intronic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
981027182 4:140088461-140088483 CAGTGGGAATGGAAAGGAAGAGG - Intronic
981651946 4:147070185-147070207 CAGTAGAAATAGAGAGGAAAAGG + Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
983095105 4:163552262-163552284 AAGTGGAAACAGTGAGGAATGGG + Intronic
983835742 4:172381422-172381444 AACTGGGAGTAGGGAGGAATGGG - Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984627190 4:182020408-182020430 AAGGGGGAATAGAGAGAGATTGG + Intergenic
986104322 5:4645307-4645329 CAGTGGGATTAGAACAGAATTGG - Intergenic
986420523 5:7576386-7576408 CAGATGCAACAGAGAGGAATGGG - Intronic
986549888 5:8940810-8940832 CAGAGGGAAGAGAGAGAAATGGG + Intergenic
986973772 5:13371021-13371043 CGGAGGGAGTAGAGAGGCATAGG + Intergenic
987173699 5:15285318-15285340 CAATGGGGAGAGAAAGGAATGGG + Intergenic
988196565 5:28012806-28012828 CAGTGCAAAAAGAGGGGAATTGG - Intergenic
988399742 5:30747516-30747538 CTGTGGCAATAGAGGGAAATAGG - Intergenic
988918713 5:35921248-35921270 CAGTTGGCATAGAGAAAAATTGG - Intronic
990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG + Intergenic
990966009 5:61448875-61448897 CAGTAGGAATAGAGAGTAATAGG + Intronic
992005442 5:72472926-72472948 CTGTGGGAGTTGAGAGGAAGGGG - Intronic
992134864 5:73734221-73734243 CAGAGAGAAAAGAGAAGAATAGG + Intronic
994448543 5:99909719-99909741 CAGAGGGTGAAGAGAGGAATGGG + Intergenic
994474619 5:100250822-100250844 CAGGAGGAAGAGAGAGGAGTGGG - Intergenic
994680995 5:102887721-102887743 CAGCTGGAACAGAGAGGAAAAGG - Intronic
996009110 5:118461139-118461161 TAGTGGGAATATAAAGGAGTTGG - Intergenic
996022025 5:118601890-118601912 CAAGGGGAATTGAGAGGAAATGG - Intergenic
996814364 5:127558592-127558614 AGGAGGGAATAGAGAGCAATGGG - Intergenic
997613223 5:135229562-135229584 CAGGCGGAAGAGAGAGGAAAGGG + Intronic
997774973 5:136595548-136595570 CTGTGGCCATAGAGATGAATGGG + Intergenic
998925359 5:147117848-147117870 CAGTGAGAATGCAGAGAAATGGG - Intergenic
999596771 5:153214143-153214165 AAGTGTGAATAGAGAGGAAAAGG + Intergenic
999597569 5:153222155-153222177 GAGTGTGAATAGAGAGGCAAAGG + Intergenic
999833439 5:155342470-155342492 CAGTGGGAAGAGAATGCAATTGG - Intergenic
1000189084 5:158891201-158891223 CAGTGGCAAGAGAGAGACATAGG - Intronic
1000532651 5:162443354-162443376 CAGTGAGAATAGATAGGAATAGG - Intergenic
1001245105 5:170100355-170100377 CAGTGGGAATAGTGAGAGCTGGG - Intergenic
1001693913 5:173655313-173655335 GAGTGGGAATAAAGAGGGAAAGG - Intergenic
1004113685 6:12746837-12746859 GAATGAGAATAGAAAGGAATGGG + Intronic
1006609570 6:35286098-35286120 GAGTGGAAATAGAGAGAAATGGG - Intronic
1006840635 6:37026068-37026090 CTGTGGGCAGAGAGAGGAAGAGG - Intronic
1007242959 6:40440255-40440277 CATTGCGAACAGAGAGGAAGTGG - Intronic
1008595729 6:53039876-53039898 CAGTGGGAATATACAGAAGTAGG + Intronic
1008664007 6:53697894-53697916 CAGTGAGGATGGAGAGGAAGAGG + Intergenic
1008839475 6:55883448-55883470 CAGTAGCAATAGAGAAAAATAGG + Intergenic
1009292307 6:61897609-61897631 CATTTGGAATAGACAGGGATAGG - Intronic
1009625677 6:66136992-66137014 CACTGGGGAGAGAGAGGCATGGG + Intergenic
1010144785 6:72655496-72655518 AAGTGGAATTAGAGAGGAACGGG + Intronic
1010625374 6:78131761-78131783 CCTTGGGAAAAGAGAGGAGTGGG + Intergenic
1010678225 6:78768720-78768742 CAGGAGGAAGAGAGAGGAGTGGG - Intergenic
1011292885 6:85794760-85794782 CAGAGGCCATAGAGAGGATTTGG - Intergenic
1011346447 6:86374413-86374435 CAGTGGGGATCGAGATGTATAGG - Intergenic
1011399833 6:86948550-86948572 CAGTGGGAGGTGAGAGGAAGTGG - Intronic
1013251841 6:108342171-108342193 CAGAGGGCATAGAAAGGGATGGG - Intronic
1014052198 6:116967781-116967803 CAGTGGGAAGAGCAAGCAATGGG + Intergenic
1014140242 6:117933666-117933688 CAGTGGGAAGAGAGAGAGCTGGG - Intronic
1014184496 6:118419800-118419822 AATTGGAAATAGAGAGGAAGGGG - Intergenic
1015886447 6:137923201-137923223 CAATGGGAACAGAGAGGAAAAGG - Intergenic
1016170918 6:141015551-141015573 CCTTGGGCATGGAGAGGAATAGG + Intergenic
1016488155 6:144566251-144566273 AAGTTGGAAGAGAGAGGATTGGG + Intronic
1016499110 6:144698947-144698969 CAGTGTGAATAGAGAACAGTTGG - Intronic
1017702429 6:157088315-157088337 CTGTGGGAACAAAGAGAAATGGG - Intronic
1019051807 6:169189324-169189346 CACTGGGAATAGACATCAATGGG + Intergenic
1020158963 7:5753301-5753323 CAGGAGGAATAGAGATGGATTGG - Intronic
1020409597 7:7876280-7876302 CAGTGGGATTGAAGAGGAATAGG + Intronic
1022051201 7:26675043-26675065 CAGTGAGAATAAAGTGGAATGGG - Intronic
1022276132 7:28856639-28856661 GAGGGAGAATAGATAGGAATAGG - Intergenic
1022548261 7:31209442-31209464 CAGTGGGAATGGAGAGGCTGCGG + Intergenic
1022977919 7:35575554-35575576 CAGTGGAAATTGTGAGGATTTGG + Intergenic
1023889117 7:44380260-44380282 CAGAGGGTCTAGAGAGGAAGGGG - Exonic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1026552242 7:71378604-71378626 CAGAGGGAATAAATAGGAAAGGG + Intronic
1027195347 7:76026257-76026279 CAGCGGGAATGGGGAGGAAAGGG + Intronic
1027535467 7:79394401-79394423 CAATGGGAGTAAACAGGAATCGG - Intronic
1027968914 7:85051466-85051488 CAGAGGCAATTGAGAGGAAATGG - Intronic
1028657023 7:93220250-93220272 CTGTGAGAATACACAGGAATAGG + Intronic
1028800236 7:94955472-94955494 CAGTGGGAATAAAAAGAAATAGG - Intronic
1028976800 7:96923757-96923779 AAATGAGAATAGAGAGGAAGGGG - Intergenic
1029026585 7:97423276-97423298 GAATGGGAAGAGAGAGGAGTAGG - Intergenic
1030327057 7:108230806-108230828 CAGTGGGAGGAGATAGGAGTGGG - Intronic
1030972820 7:116081477-116081499 CAGTGGTCATAGAGAAGAGTAGG - Intronic
1031003433 7:116444611-116444633 TAGTGGGAATTGAGAGGAAAAGG - Intronic
1032188061 7:129744689-129744711 AAGTGGAAATAGACAGTAATGGG - Intronic
1032544607 7:132731254-132731276 TAGTGGGAAGAGGGTGGAATAGG - Intergenic
1033636016 7:143211899-143211921 GAGAGGGAATAGAGAGAAAGTGG - Intergenic
1033731712 7:144187196-144187218 CAGTGGGAAGAGCGAGGAGCAGG - Exonic
1033742562 7:144285779-144285801 CAGTGGGAAGAGCGAGGAGCAGG - Intergenic
1033751341 7:144363835-144363857 CAGTGGGAAGAGCGAGGAGCAGG + Exonic
1034078324 7:148253634-148253656 CTGTGGGAAGAGAGAGGCCTCGG - Intronic
1035023207 7:155810600-155810622 CTGTCGGAAGGGAGAGGAATGGG - Intronic
1035605820 8:929222-929244 GAGTGGGAATGGCGGGGAATCGG - Intergenic
1035605871 8:929384-929406 GAGTGGGAATGGCGGGGAATCGG - Intergenic
1035632441 8:1118527-1118549 CTGTGCGAATAGAAATGAATGGG + Intergenic
1036644470 8:10603047-10603069 GAGTTTGAATGGAGAGGAATGGG + Intergenic
1037381778 8:18292832-18292854 CCTTGGGAATACAGAGAAATTGG + Intergenic
1037520302 8:19674536-19674558 CAGTGGGAAAAGGCAGGAATGGG + Intronic
1037569918 8:20149407-20149429 AAGTGGGAAAGGAGAGGAAGAGG - Intronic
1037604880 8:20429707-20429729 TGGAGGGAATAGAGACGAATAGG - Intergenic
1037689926 8:21172959-21172981 AAATGGGAACAGAGAGGAGTGGG + Intergenic
1038777293 8:30542595-30542617 CAGTGGGAACAGACAAGCATGGG + Intronic
1038848398 8:31251221-31251243 TAGTGGCAAAAGAGAGGTATGGG + Intergenic
1038991026 8:32868536-32868558 CAGTGGAAATCCAGAGGAAGGGG + Intergenic
1043720731 8:83544914-83544936 CAGTGGGAACAGAGACTAGTGGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044935565 8:97290444-97290466 CAGTGGGGAAAGACAGGGATGGG + Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1046907596 8:119590451-119590473 GAGTGGTAATACAAAGGAATAGG - Intronic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047540313 8:125758897-125758919 CACTGGGATCAGAGTGGAATAGG - Intergenic
1047557815 8:125951533-125951555 CCGTGGGAAAAGACAAGAATTGG + Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1049022432 8:139966632-139966654 CAGTGGGATTAGAAAGGAGCTGG - Intronic
1049465758 8:142750618-142750640 CGGTGGGAGGAGAGAGGAAGAGG - Intronic
1050258485 9:3816893-3816915 CAGGGGGAAGAGAGATGATTTGG + Intergenic
1050634944 9:7602435-7602457 GAGTGGAACTAGAGATGAATTGG + Intergenic
1052112253 9:24600944-24600966 GGGTGGGAGTTGAGAGGAATTGG + Intergenic
1052916204 9:33925950-33925972 CTGTGGGGACAGAGGGGAATAGG - Intronic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1058471585 9:105284931-105284953 AAGTGGGAGTTGAGAGGAAATGG - Intronic
1058880827 9:109284832-109284854 CAGTGGCAATGGATAGTAATAGG - Intronic
1059358195 9:113717810-113717832 CAGTGGGGAGAGAGTGGAAGGGG + Intergenic
1059764651 9:117372233-117372255 CATTGGAAAGAGAGAGGAAGAGG - Intronic
1060051997 9:120384307-120384329 CAATGGGAAAAGAGGGGACTTGG + Intergenic
1060467019 9:123915754-123915776 GAGTGGGACTAGGGAAGAATAGG + Intronic
1061208899 9:129179395-129179417 CAGTGGGAGAAGAGAGGGACAGG + Intergenic
1061888273 9:133604140-133604162 CAGTGTGAATAGAAATAAATAGG - Intergenic
1186307385 X:8277049-8277071 CACTGGGAAGAGAGAGAAGTGGG + Intergenic
1186445810 X:9627663-9627685 CAATGAGAATAAACAGGAATTGG - Intronic
1186573640 X:10742302-10742324 AAGTGGGAATATGGAGGAAAGGG + Intronic
1186897452 X:14018217-14018239 CAATGGCAAGAGGGAGGAATAGG + Intronic
1187421106 X:19134496-19134518 CAGGGGGAAGGGAGAGGAAGAGG - Intergenic
1187674717 X:21704201-21704223 GAGGGGGAACAGAGAGGTATGGG + Intergenic
1188893780 X:35642367-35642389 CAGTGGGAAGAAAGAGAAAATGG + Intergenic
1189555626 X:42142324-42142346 CAGGAAGAATAGAGAGGGATTGG - Intergenic
1189568937 X:42274476-42274498 GAGTGGGCAGAGAGAGGAGTGGG - Intergenic
1190257884 X:48777475-48777497 CAGTGGAAAAAAAGAGGAAAGGG + Intergenic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192217169 X:69168638-69168660 CAGTAGGAAAAGAGATAAATTGG - Intergenic
1193222321 X:78940814-78940836 CATTGGGAAAACAGTGGAATAGG - Intergenic
1193373379 X:80727243-80727265 AAGAGGGAATAGATTGGAATGGG - Intronic
1195128674 X:101833547-101833569 CAGTGAGAATACAAAGAAATTGG - Intronic
1195522308 X:105845395-105845417 AAGTGGGGAAAGAGAGAAATAGG + Intronic
1195790107 X:108575223-108575245 CAGAGGGAAATGAGAGGAACTGG - Intronic
1196206146 X:112942242-112942264 CACTGAGAATACAGAGGTATTGG + Intergenic
1196265745 X:113644144-113644166 CAGTGGGAATAGAGAGGTATAGG - Intergenic
1196745283 X:119066213-119066235 CATTTGGAATATAGAGGAAGGGG + Intergenic
1196871317 X:120116003-120116025 GAGAGGGAATGGAGAGGAGTGGG + Intergenic
1196997914 X:121404264-121404286 CAGTGGGGATAGAGGGGATGGGG - Intergenic
1197350725 X:125379683-125379705 AAGTGGGAATACCGAGGAGTCGG - Intergenic
1197627305 X:128816530-128816552 CAGTGGGAATAAAAAGGACAAGG + Intergenic
1198024789 X:132694461-132694483 CAGTGTGATTAGAGAAAAATGGG + Intronic
1199230478 X:145431770-145431792 CAGTGGCCATAGAAAGGCATAGG - Intergenic
1199243820 X:145579247-145579269 GTGTGGGTATAGAGATGAATGGG - Intergenic
1199480758 X:148296420-148296442 TAATGGGAATAGAAAGGAGTTGG - Intergenic
1199653572 X:149972326-149972348 CAGTGAGGACAGAGAGGAAGAGG + Intergenic
1202087015 Y:21148954-21148976 CAGAGGAAATAGAAAGGGATGGG + Intergenic