ID: 923187574

View in Genome Browser
Species Human (GRCh38)
Location 1:231588877-231588899
Sequence CAGATGTTGTAGGGGACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 243}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923187574_923187580 9 Left 923187574 1:231588877-231588899 CCCTGTGTCCCCTACAACATCTG 0: 1
1: 0
2: 0
3: 6
4: 243
Right 923187580 1:231588909-231588931 CCTGCCTTTGTGTTAAAACGAGG 0: 1
1: 0
2: 0
3: 5
4: 76
923187574_923187584 19 Left 923187574 1:231588877-231588899 CCCTGTGTCCCCTACAACATCTG 0: 1
1: 0
2: 0
3: 6
4: 243
Right 923187584 1:231588919-231588941 TGTTAAAACGAGGCCGGAATGGG 0: 1
1: 0
2: 0
3: 2
4: 49
923187574_923187585 20 Left 923187574 1:231588877-231588899 CCCTGTGTCCCCTACAACATCTG 0: 1
1: 0
2: 0
3: 6
4: 243
Right 923187585 1:231588920-231588942 GTTAAAACGAGGCCGGAATGGGG 0: 1
1: 0
2: 0
3: 1
4: 57
923187574_923187583 18 Left 923187574 1:231588877-231588899 CCCTGTGTCCCCTACAACATCTG 0: 1
1: 0
2: 0
3: 6
4: 243
Right 923187583 1:231588918-231588940 GTGTTAAAACGAGGCCGGAATGG No data
923187574_923187582 13 Left 923187574 1:231588877-231588899 CCCTGTGTCCCCTACAACATCTG 0: 1
1: 0
2: 0
3: 6
4: 243
Right 923187582 1:231588913-231588935 CCTTTGTGTTAAAACGAGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923187574 Original CRISPR CAGATGTTGTAGGGGACACA GGG (reversed) Intronic
900940725 1:5796934-5796956 CAGGTTTTCTAGGAGACACAAGG + Intergenic
902225967 1:14996663-14996685 TAGAGAATGTAGGGGACACAGGG - Intronic
903049875 1:20592755-20592777 GAGATATTGTGTGGGACACATGG + Intronic
903853137 1:26320324-26320346 CAGCTGTTTCAGGGGGCACAGGG - Exonic
904407869 1:30305256-30305278 CAGATGATGCAGGGCACGCAAGG - Intergenic
904698386 1:32343522-32343544 AAGATGATGAAGGGGCCACAGGG - Intergenic
906240225 1:44238266-44238288 AGGATGTTGTGGGGGAGACAGGG + Intronic
907432611 1:54422267-54422289 CAGATGTTGCAGTGGATACTGGG + Intergenic
907574284 1:55512069-55512091 CAGATGCTTTAGGTCACACATGG - Intergenic
909371049 1:74884077-74884099 CACATGTTGTGGGAGACACCTGG + Intergenic
909637329 1:77831157-77831179 CAGATCTTGTTTGGGACATATGG + Intronic
909900132 1:81123878-81123900 CAGAAGATGAAGGGGAAACAAGG - Intergenic
909996162 1:82282210-82282232 CACATGTTGTATAGGACATAGGG + Intergenic
913608843 1:120491495-120491517 CAGATCTTGTAGGTGACTCTTGG - Intergenic
914370585 1:147021272-147021294 CAGATCTTGTAGGTGACGCTTGG - Intergenic
914444088 1:147734649-147734671 CACATGTTTCAGGGAACACAGGG + Intergenic
914484105 1:148092138-148092160 CAGATCTTGTAGGTGACGCTTGG + Intergenic
914582350 1:149030343-149030365 CAGATCTTGTAGGTGACCCTTGG + Intronic
915709398 1:157880384-157880406 CAGATTGTGTTGGAGACACATGG - Intronic
915800780 1:158790800-158790822 GAGATTTTGGTGGGGACACAGGG - Intergenic
917479223 1:175396603-175396625 CTGATGTTGTAGGTGAGACCTGG + Exonic
918100174 1:181365977-181365999 GAGATGTTGCAGGGGACCAAAGG + Intergenic
918453912 1:184687646-184687668 CAGTGGTTGTAGTGGACAAATGG - Intergenic
918480424 1:184971979-184972001 CAGATGTTTTGAGGCACACAAGG + Intronic
919560576 1:199113821-199113843 CATATGTTGTGAGGCACACATGG + Intergenic
922850740 1:228731724-228731746 GACATGTTGTTGGGGACCCAGGG + Intergenic
923187574 1:231588877-231588899 CAGATGTTGTAGGGGACACAGGG - Intronic
923345367 1:233046497-233046519 CAGTTGTAGTTGGGGACACAGGG - Intronic
924056654 1:240130899-240130921 CAGGTGTTGTAAGGGAAAGAGGG - Intronic
1063061556 10:2560554-2560576 AAGATGTTGTGGTGGACCCAAGG + Intergenic
1066347307 10:34600503-34600525 CAGATATTCTGGTGGACACATGG - Intronic
1069952689 10:72030645-72030667 CATATTTTGTAGGGGAAACTGGG - Intergenic
1070171634 10:73937512-73937534 CAGATGTGGTTGGGGAGTCATGG + Intergenic
1071025817 10:81111772-81111794 CACATGTTGTAGGAGAGACCCGG - Intergenic
1071967775 10:90870067-90870089 CTGATGTTGTATTGCACACAAGG + Intergenic
1072105874 10:92273338-92273360 CAGATATTGTAGGAGATACTGGG - Intronic
1073989438 10:109245724-109245746 CAGCTGGTGCCGGGGACACAAGG + Intergenic
1074373277 10:112917840-112917862 CAGATGTTGCAAAGGAGACAGGG + Intergenic
1075576947 10:123584499-123584521 CAGATTCTGTATGGGACCCAGGG - Intergenic
1077596725 11:3538342-3538364 CAGAGGTTGGAGGGGTCAGAAGG - Intergenic
1080605437 11:33861333-33861355 GAGAGGTTGTAGGGGACCTAAGG + Intronic
1083681985 11:64355488-64355510 CAGAGCTTGCAGGAGACACAGGG - Intronic
1084238434 11:67803217-67803239 CAGATGTTGCAGGGTGCACCTGG + Intergenic
1084644311 11:70445791-70445813 CAGAGGCTGTGGCGGACACAGGG + Intergenic
1085948925 11:81305943-81305965 CAGAAGGTGAAGGGGAAACAAGG - Intergenic
1086665307 11:89473267-89473289 CCCATGATGTAGGAGACACAAGG - Intronic
1089825329 11:121270427-121270449 GAGATGTTGTGTGGGACTCAGGG - Intergenic
1093874166 12:24329476-24329498 CAGATGTTGAAGGAGAGACCTGG - Intergenic
1094235326 12:28158494-28158516 GAGATGTTGTAGTGAACACCTGG - Intronic
1095252845 12:39998880-39998902 CACATGTTGTAGGAGAGACCTGG + Intronic
1098022558 12:66170810-66170832 CAGCTGGTGTAGGGGACAGGTGG + Intergenic
1099379830 12:81940013-81940035 CATATGTTGTAGGAGAGACCTGG - Intergenic
1099568256 12:84279824-84279846 CAGAAGGTGAAGGGGAAACAAGG + Intergenic
1100124557 12:91407870-91407892 CAAGTGTAGTAGGTGACACAGGG - Intergenic
1102248018 12:111367469-111367491 CAGATGTGGAAATGGACACAGGG + Intronic
1104782928 12:131433121-131433143 CAGAGGATGCGGGGGACACAGGG - Intergenic
1104783339 12:131434287-131434309 GAGAGGATGCAGGGGACACAGGG - Intergenic
1106123631 13:26882396-26882418 CTGATGCTGTAGGTGACATAAGG + Intergenic
1106923910 13:34592823-34592845 CAGAGGTTGGAGGAGAGACAGGG - Intergenic
1108640900 13:52381412-52381434 CAGGTGTTTTAGGGGACCCATGG - Intronic
1111218350 13:85173810-85173832 CAGAGGTTGTAGCTGAGACAGGG - Intergenic
1111290679 13:86166155-86166177 CAGATGGTGAAGGGGAGCCAGGG + Intergenic
1113754009 13:112796476-112796498 CAGAGGTTGAAGGGGACCAAAGG + Intronic
1114328322 14:21611996-21612018 CAAATGATGTAGTGGAGACATGG - Intergenic
1115511103 14:34138739-34138761 AAGATGTTCTAATGGACACAAGG - Intronic
1116079561 14:40155547-40155569 CACATGTTGTGGGAGACACCTGG - Intergenic
1116986100 14:51222121-51222143 CACATGTTGTAGGAGATACCTGG - Intergenic
1121166648 14:91807891-91807913 CACATGTTGTGGGAGACACCTGG + Intronic
1121931870 14:97979552-97979574 CAGAGCTTGTAGTGGACACTTGG + Intergenic
1122349693 14:101081404-101081426 CAGATGTTGGCGAGGATACAGGG + Intergenic
1123456760 15:20433378-20433400 AAGCTGTGGTAGGGGCCACATGG - Intergenic
1123661302 15:22566978-22567000 AAGCTGTGGTAGGGGCCACATGG + Intergenic
1123773583 15:23554746-23554768 CACATGTTGTAGCAGACACCTGG - Intergenic
1124035854 15:26053076-26053098 AAGATGTTGCAAGGGACAGAAGG - Intergenic
1124262908 15:28208532-28208554 AAGCTGTGGTAGGGGCCACATGG - Intronic
1124315102 15:28661214-28661236 AAGCTGTGGTAGGGGCCACATGG + Intergenic
1124418775 15:29498162-29498184 CAGAAGGTGAAGGGGAAACAAGG - Intronic
1124658120 15:31524865-31524887 CAGATGCTAATGGGGACACAGGG - Intronic
1125383434 15:39112075-39112097 CAGAAGTTGTAGGGAAAGCAAGG + Intergenic
1125847790 15:42874210-42874232 CAAATGCTATGGGGGACACAAGG - Intronic
1127917439 15:63466792-63466814 CAGATCTTCATGGGGACACAAGG + Intergenic
1130448897 15:84030968-84030990 CAGAAGGTGAAGGGGAAACAAGG - Intronic
1130484974 15:84393860-84393882 CAAATGTTGCAGGAGACCCAGGG + Intergenic
1131448489 15:92519221-92519243 TAGATGCTGTAGGGGACAGGAGG + Intergenic
1132147274 15:99436398-99436420 GAGATGGTGTAGGGGTCCCAGGG - Intergenic
1132495491 16:261330-261352 CTGCTGTTGAAGGGGACTCAGGG + Intronic
1132884008 16:2174503-2174525 GAGATGGTGTAGGCCACACAAGG - Intronic
1132989608 16:2786016-2786038 CAGGTGTTGGTGGGGAGACACGG + Intronic
1134847615 16:17453689-17453711 GAGATCTTATTGGGGACACAGGG + Intronic
1136925137 16:34364863-34364885 AAATTGTTGTAAGGGACACATGG - Intergenic
1136979436 16:35046943-35046965 AAATTGTTGTAAGGGACACATGG + Intergenic
1137498996 16:48996159-48996181 CAGATGGGGCAGGGGACAGATGG + Intergenic
1139266355 16:65642879-65642901 CAGATGGTTTAGGGGGCAGATGG - Intergenic
1144817052 17:18041709-18041731 CTGATGTAGTAGGGGACAATTGG + Intronic
1144951489 17:18996797-18996819 CAGAGGTTGGAATGGACACAGGG - Intronic
1147529687 17:41263773-41263795 AAGATGATGTAAGAGACACATGG + Intergenic
1148105980 17:45119106-45119128 CAGATGTGGTAGATGACAGATGG - Intronic
1148993333 17:51685410-51685432 CAGAGGTAGGAGGAGACACAAGG - Intronic
1150138792 17:62711644-62711666 TGGATGTTGTGGGGAACACAGGG + Intronic
1152467196 17:80473088-80473110 CAGATGTTGATGGGGCCCCAAGG - Intronic
1153097180 18:1420158-1420180 CAGATTTTGAAGAGGCCACATGG - Intergenic
1155174474 18:23290391-23290413 GATATGCTTTAGGGGACACACGG - Intronic
1155369154 18:25079663-25079685 CAGATGGTGGGGGGGACGCAGGG + Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1158149178 18:54347903-54347925 CAGGTGTTGTAGGAGAGACCTGG + Intronic
1161516441 19:4699313-4699335 CAGATGATGATGGGGACACCAGG - Intronic
1161895372 19:7075594-7075616 CAGATGTGTGAGTGGACACAGGG + Intronic
1162147394 19:8621148-8621170 CAGAGGTTTCAGGGGACACTTGG + Intergenic
1162890320 19:13728109-13728131 CATATCTTTGAGGGGACACAAGG + Intergenic
1163018172 19:14469542-14469564 CAGATGCTGTAGGGGAGGCAGGG - Intronic
1163491700 19:17620614-17620636 CAGAGGTGGAAGGGGGCACAGGG + Intronic
1163539812 19:17901284-17901306 GAGATTTGGGAGGGGACACAGGG - Intergenic
1164906768 19:31974252-31974274 CATATGTTGGTGGGGACAGAGGG + Intergenic
1167208474 19:48118232-48118254 AAGATGTGGGTGGGGACACACGG - Intronic
925221303 2:2143640-2143662 CAGGTGTTAGAGGGGACAGAAGG + Intronic
927577446 2:24211114-24211136 CACAAGTTCTTGGGGACACAGGG + Intronic
929017460 2:37513117-37513139 ATGATGTTGAAGGGGACAGATGG + Intergenic
930235786 2:48887807-48887829 CAGCTGTTGTAGGGGGGAAAAGG + Intergenic
930865782 2:56120785-56120807 CAGATGTTCTGGGGGAGAAAGGG + Intergenic
931162127 2:59703862-59703884 GAGATTTTGGTGGGGACACAAGG + Intergenic
931402952 2:61948833-61948855 GAGATCTTGAAGGGGACTCAGGG - Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932112297 2:69012678-69012700 CAGATGAAGTAGGGGAAAAACGG - Intergenic
932137554 2:69244163-69244185 CAGATACTATAGGGGAGACAGGG + Intronic
936586598 2:113763715-113763737 CACATGTTGTGGGGGGCACCTGG - Intergenic
937141789 2:119608377-119608399 GAGATGCTGGAGGAGACACATGG - Intronic
938982553 2:136540315-136540337 CAGATGGTGAAGGGGAAGCAAGG - Intergenic
939642973 2:144663171-144663193 AAGGTGTTGTGGGGGAGACAAGG + Intergenic
939757428 2:146131145-146131167 CAGAGGCGTTAGGGGACACATGG - Intergenic
940466225 2:154030791-154030813 CAGAAGGTGAAGGGGAAACAAGG - Intronic
941649989 2:168082196-168082218 CAGATGATGTAGAGGAGGCAGGG - Intronic
942790072 2:179751173-179751195 CAGAATCTGTAGGGGAGACATGG - Intronic
943107206 2:183560436-183560458 CAGAAGGTGAAAGGGACACAAGG + Intergenic
944471325 2:200056066-200056088 CAGAGGATGTGGGGGACTCATGG - Intergenic
1168927227 20:1592049-1592071 CAGAAGGTGAAGGGGAAACAAGG - Intronic
1170560900 20:17557463-17557485 AATACGTTGTAGGGGACATAGGG - Intronic
1171053863 20:21886934-21886956 AAAATGTTGTAGGGGAAATAAGG + Intergenic
1171514985 20:25723014-25723036 ATGATGTTGTTGGGTACACATGG + Intergenic
1173638753 20:44584227-44584249 CAGATGGTCTAGTGGAGACATGG - Intronic
1174183562 20:48689988-48690010 CAGGTGTTGCAGGGGAGACCAGG + Intronic
1174431728 20:50475036-50475058 CAGATTATGTAGGGGCCACAAGG + Intergenic
1174642093 20:52053554-52053576 CAGGTGTTGCTGGGGACACTTGG + Intronic
1175764574 20:61583422-61583444 CAGATGTTTGAGGGGAGACGGGG + Intronic
1176020157 20:62958653-62958675 CAGAGGTTCTAGGGGAGCCATGG - Intronic
1177161450 21:17552728-17552750 CTCATGTTTTAGGGGACACTTGG + Intronic
1177783940 21:25649506-25649528 CACATGTTGTGGGAGAGACACGG - Intronic
1183200162 22:36380373-36380395 CAGATGTCTTAGGGGAAACTGGG + Intronic
1183263395 22:36810845-36810867 CACAGGCTGTAGGGGACAGAGGG - Intronic
1184172098 22:42765796-42765818 CTGGCCTTGTAGGGGACACAGGG - Intergenic
1185032448 22:48451538-48451560 CAGATGTGGGAGGGGAGAGAGGG + Intergenic
1185117436 22:48945721-48945743 CAGATGTTGTGAGGATCACAGGG - Intergenic
949503105 3:4700985-4701007 CACATGTTGTGGGAGACACCTGG - Intronic
949796764 3:7860010-7860032 CACATGTTGTTGGGGGCACCTGG - Intergenic
951180805 3:19655954-19655976 CAGAAGATGAAGGGGAAACAAGG + Intergenic
951242668 3:20305247-20305269 CAGCTGTTGTAGGAGAGACCTGG - Intergenic
951655390 3:25001834-25001856 TAGATGATGTATGGAACACATGG - Intergenic
951900802 3:27655869-27655891 CAGATGTTACAGTGGAAACAAGG + Intergenic
951969915 3:28432081-28432103 CACATGTTGTAGGAGGGACATGG - Intronic
953360654 3:42293313-42293335 CATATGTTGTAGGAGAGACCTGG + Intergenic
954925515 3:54230974-54230996 TAGATGATGATGGGGACACATGG + Intronic
956247793 3:67203635-67203657 CAGAAGTTGAAGGGGAAGCAAGG - Intergenic
956500118 3:69873610-69873632 AACATGTTGGATGGGACACAAGG - Intronic
957444142 3:80292875-80292897 CAGAAGTTGAAGGGGAAGCAAGG + Intergenic
957773902 3:84730422-84730444 AAGATATTGTAGTGGCCACAAGG + Intergenic
960623017 3:119654415-119654437 CAGATGTAAGAGGGGAAACATGG + Intronic
960651047 3:119950584-119950606 AAGTGGGTGTAGGGGACACAGGG + Intronic
960736279 3:120784621-120784643 CAGGTGGTGTAGAGGACAGATGG - Intergenic
961158248 3:124699570-124699592 CAGAATTTACAGGGGACACATGG - Intronic
961565295 3:127759384-127759406 CAGGTGTGGTAGGGGACCAAGGG - Intronic
963357184 3:144223697-144223719 CACATGTTGTAGGAGAGACCTGG + Intergenic
965814470 3:172622370-172622392 CAGAAGGTGAAGGGGAAACAAGG - Intergenic
967919211 3:194602092-194602114 CAGAATTTGTAGGGTACCCAAGG - Intronic
971852998 4:32008267-32008289 CAGAAGGTGAAGGGGACAAAAGG - Intergenic
971945775 4:33274738-33274760 GAGATTTTGGTGGGGACACAAGG + Intergenic
972090995 4:35283442-35283464 CAGAAGGTGTAGGGGAAGCACGG - Intergenic
973042829 4:45494406-45494428 CAGAAGATGAAGGGGAAACAAGG + Intergenic
974171478 4:58271540-58271562 CAGGTGTTGTAGGAGAGACCTGG + Intergenic
975611225 4:76205662-76205684 CAGATGCTGAAGGGGCCAGATGG + Intronic
976545921 4:86335733-86335755 CAGAAGGTGAAGGGGAAACAAGG + Intronic
976853359 4:89575134-89575156 CAGAAGGTGAAGGGGAAACAAGG - Intergenic
977521889 4:98094733-98094755 CAGTGGTGGTAGTGGACACAGGG + Intronic
977551493 4:98448271-98448293 CACATGTTGTTTGGGCCACATGG + Intergenic
979948973 4:126867763-126867785 CACATGTTGTAGGAGGCACTTGG + Intergenic
985869483 5:2542790-2542812 AAGATGCTGCAGGGGACACAGGG + Intergenic
987944614 5:24588320-24588342 TAGATGGGGTAGGGGATACAGGG - Intronic
989266861 5:39485005-39485027 TAGATGTTATTGGGGGCACAGGG + Intergenic
989296815 5:39838381-39838403 GAGATTTTGGTGGGGACACAGGG - Intergenic
990162447 5:52957203-52957225 GAGATGCTGTAGGGGACAACAGG - Exonic
990246758 5:53870854-53870876 AAGATGTTCCAGTGGACACAAGG - Intergenic
990667167 5:58086142-58086164 CAGATGTTGGAGTGAATACATGG - Intergenic
990804385 5:59642443-59642465 CATGTGTTGTGGGGGACACCCGG + Intronic
991498863 5:67255888-67255910 CAGATGAGGTAGGAGACTCAGGG - Intergenic
993563901 5:89448223-89448245 CAAATGTTGTGGGGGAAAGAAGG + Intergenic
994285038 5:97954836-97954858 CAGAAGTTGAAGGGGAAACAAGG - Intergenic
994446498 5:99880322-99880344 CAGATGGTTTAGGGCTCACAGGG - Intergenic
994734256 5:103533089-103533111 CAGATGTTGAAGGAGAGACCTGG + Intergenic
995285382 5:110383050-110383072 CAGATGTTGGTGGGGAGACCTGG + Intronic
996332243 5:122342725-122342747 TAGCTGGTGCAGGGGACACAGGG - Intronic
996622229 5:125520872-125520894 CACATGTTGTAGGAGAGACCTGG - Intergenic
996768196 5:127056599-127056621 CACATGTTGTGGGAGACACCTGG - Intronic
1004404865 6:15323575-15323597 AAGACTTTTTAGGGGACACAAGG + Intronic
1006303021 6:33204107-33204129 CAGGTGGGGTAGGGGACACCAGG - Exonic
1007046883 6:38784553-38784575 TGGAAGGTGTAGGGGACACAAGG - Intronic
1008204269 6:48634220-48634242 CAGAAGTTGGAGTGGACACCTGG - Intergenic
1008707493 6:54181126-54181148 CAAATGTTGTCTGGGAGACAGGG + Intronic
1009517740 6:64641358-64641380 CACATGTTGTAGGAGGCACCTGG - Intronic
1010645706 6:78386059-78386081 CATGTGTTGTGGGGGACACCTGG - Intergenic
1011693447 6:89890956-89890978 CACATGTTTTAGGGAGCACAGGG - Intergenic
1012485758 6:99721415-99721437 GAGATGTGGGTGGGGACACAGGG - Intergenic
1012636326 6:101547197-101547219 CACATGTTGTAGGAGAAAGAGGG - Intronic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1015822516 6:137279626-137279648 GAGATTTTGGTGGGGACACAAGG + Intergenic
1015842525 6:137489720-137489742 AAGAAGTTCGAGGGGACACAAGG + Intergenic
1015969449 6:138729775-138729797 CAGATATTGAAGAAGACACATGG - Intergenic
1015989940 6:138929273-138929295 CAGGTGTTTTAGGGGAGGCAGGG + Intronic
1017623008 6:156318064-156318086 CAGAAGGTGAAGGGGAAACAAGG + Intergenic
1017644032 6:156522548-156522570 CAGATGGTGAAGGGGAAGCAAGG - Intergenic
1018202758 6:161410650-161410672 CAGATGGAGTTGGGGAAACATGG + Intronic
1019814649 7:3190639-3190661 CAGAGGCTGCAGGTGACACACGG + Intergenic
1021446675 7:20741478-20741500 CATAGGTTGTAGGGGGCAAATGG + Intronic
1021747589 7:23758020-23758042 CACATGTCGTAGGGAGCACAGGG + Intronic
1022857958 7:34334548-34334570 GAGATGATGTAGGGCAGACAGGG - Intergenic
1029517383 7:101034122-101034144 CAGAAGTTGTAGGAGACGAACGG - Exonic
1030059354 7:105610668-105610690 CACATGTTCTAGGGGAAAGAAGG + Intronic
1030257505 7:107527653-107527675 CAAATGTCCTAGGGAACACACGG + Intronic
1033649850 7:143332506-143332528 CAGCTGTTGGTGGGGCCACATGG + Intronic
1037058631 8:14478518-14478540 CAGGTGTTATGGGGGACAGAGGG + Intronic
1042086055 8:65110136-65110158 TAGAAGGTGAAGGGGACACAAGG - Intergenic
1043364242 8:79513251-79513273 CACATGTTGTGGGAGACACCTGG + Intergenic
1044370940 8:91409942-91409964 CAGTTATTTAAGGGGACACAGGG + Intergenic
1046069112 8:109229124-109229146 CACATTTGGTAGGGGACAGATGG + Intergenic
1046532214 8:115461515-115461537 TAGTTGTTGCTGGGGACACATGG - Intronic
1048462136 8:134629688-134629710 CAGAAGTTGAAGGGGAAGCAAGG - Intronic
1052273897 9:26656736-26656758 CAGCTGGTGGAGGGGACAAAAGG - Intergenic
1052673018 9:31582311-31582333 GAGAAGTTGTTGGGAACACATGG + Intergenic
1055420677 9:76137960-76137982 CATATGCTTTAGGGAACACAAGG - Intronic
1057252338 9:93514110-93514132 CAGAAGTTGAAGGGGAAGCAAGG + Intronic
1058027199 9:100154812-100154834 GAGATAATGTAGAGGACACAGGG + Intronic
1058395514 9:104549097-104549119 CAGAAGGTGAAGGGGAAACAAGG - Intergenic
1061000108 9:127898068-127898090 CAGATGTGGCAAGGGACACGCGG + Intronic
1061807691 9:133145563-133145585 CAGATGTGTGAGGGGAGACAAGG + Intronic
1185692257 X:2165237-2165259 CAGATGTTGGTGTGGATACAGGG + Intergenic
1186442020 X:9594710-9594732 CAGATATTTTAGGGAAGACAGGG + Intronic
1186667203 X:11729367-11729389 CTGACCTTGGAGGGGACACAAGG - Intergenic
1191904011 X:66068369-66068391 GAGATTTTGTAAGGGATACAAGG - Intergenic
1192266111 X:69538973-69538995 CAGATGTAATCTGGGACACATGG - Intergenic
1192863156 X:75100544-75100566 AAGAGGTTGAAGGGGCCACAGGG - Intronic
1195214361 X:102683764-102683786 CAGATGGTGAAGGGGAGTCAGGG + Intergenic
1195380299 X:104264311-104264333 GAGATGAGCTAGGGGACACACGG + Intergenic
1195472198 X:105243336-105243358 CAGAAGATGAAGGGGAAACAAGG - Intronic