ID: 923187769

View in Genome Browser
Species Human (GRCh38)
Location 1:231590577-231590599
Sequence CATAACACGGAGTAGTAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923187769 Original CRISPR CATAACACGGAGTAGTAGTA TGG (reversed) Intronic
903479118 1:23640104-23640126 CATCACTGGGACTAGTAGTAAGG + Intronic
908443267 1:64176930-64176952 CATCACACAGAGAAGTAGCAAGG + Intronic
909186575 1:72493982-72494004 CGTAAGATGGAGGAGTAGTAAGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
918978629 1:191525509-191525531 CAGAACACGGAGGACTGGTAAGG + Intergenic
923187769 1:231590577-231590599 CATAACACGGAGTAGTAGTATGG - Intronic
1063777875 10:9284534-9284556 CATAACACAGAGTAGAAGAAAGG + Intergenic
1064205416 10:13319886-13319908 CATAACACTGTGTAGGGGTAAGG + Intronic
1080286712 11:30623310-30623332 CATAAAAGGGAGTAAAAGTATGG - Intergenic
1081019928 11:37932801-37932823 CATAACATGGAGTAAGACTAGGG + Intergenic
1100447649 12:94676093-94676115 GATAACACAGAGGAGTAGAAGGG + Intergenic
1109673354 13:65638866-65638888 CATAACACAGTTTAGTATTAAGG - Intergenic
1114702147 14:24689908-24689930 ACTAACAGGTAGTAGTAGTATGG - Intergenic
1124547104 15:30640039-30640061 GATAACCCAGAGTAGTAGTTTGG + Intronic
1124780703 15:32630001-32630023 GATAACCCAGAGTAGTAGTTTGG + Intronic
1140935756 16:79668164-79668186 CATAAGAAGGAGTTGTAGAATGG + Intergenic
942261278 2:174166803-174166825 CATAAGGTGGAGTAGTAGTTGGG - Intronic
1173439878 20:43066685-43066707 CATAGCACGGAGTGGTGGAAGGG + Intronic
1184207251 22:43013250-43013272 CATAACACAGAGAAGTAGATGGG - Intronic
950426786 3:12928604-12928626 CATTACACGGGCTAGGAGTAGGG - Intronic
952476483 3:33716328-33716350 CACAGCACCGAGTAGAAGTAGGG + Intronic
954377380 3:50202257-50202279 CACAACACAGTGTAGAAGTATGG - Intergenic
956913027 3:73840768-73840790 GATAACACGAAGTATTGGTAAGG + Intergenic
962153988 3:132924619-132924641 CTTAACACTGAGTAGTAGGATGG - Intergenic
962443222 3:135442379-135442401 CATGATATGGAGTAGTGGTAAGG + Intergenic
973017983 4:45165544-45165566 CATCACTCTGAGTTGTAGTAAGG + Intergenic
976921120 4:90444231-90444253 CATAACACGATATAGTACTATGG + Intronic
982680650 4:158424917-158424939 AATAACAAGGACAAGTAGTATGG + Intronic
993712082 5:91235210-91235232 CTTAGCGTGGAGTAGTAGTAGGG + Intergenic
1005184659 6:23151682-23151704 CATAACTCTGAGTGGTATTAAGG + Intergenic
1006979463 6:38135378-38135400 CAAAACACGGAGATGTAGAAAGG - Intronic
1007990495 6:46250434-46250456 CATAACAGTGAGTACAAGTAAGG + Intronic
1009828751 6:68901796-68901818 CATAACAATGAATACTAGTAGGG + Intronic
1022068944 7:26891252-26891274 CATAAGAGGTAGTAGTAGCAGGG - Intronic
1022977164 7:35569409-35569431 CATAAAACTGAGTAGAAGCAGGG - Intergenic
1039069791 8:33639517-33639539 CAAAACAAGGTGTAGTAGAAAGG - Intergenic
1042357907 8:67849549-67849571 CATTACATGGTGTATTAGTAAGG + Intergenic
1046634285 8:116655707-116655729 TATAACATGGAGTAATAGTCTGG - Intronic
1057082439 9:92183003-92183025 CATAACAACGTGTAATAGTATGG + Intergenic
1059048486 9:110896539-110896561 CATACCATGGAGTAGTACAATGG - Intronic
1059063527 9:111058601-111058623 CATCACACAAAGTAGTAGAAAGG - Intergenic
1191840368 X:65509461-65509483 CAGAACAAGGAGTAGAAGGAAGG - Intergenic
1199026141 X:142940963-142940985 CATAACACAGGGTAATAGAAGGG + Intergenic