ID: 923191122

View in Genome Browser
Species Human (GRCh38)
Location 1:231621827-231621849
Sequence AGCTATGTATGTACAGCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923191114_923191122 23 Left 923191114 1:231621781-231621803 CCAGCCCTGTGTGGGTGAATGAG 0: 1
1: 0
2: 1
3: 25
4: 215
Right 923191122 1:231621827-231621849 AGCTATGTATGTACAGCTGTTGG 0: 1
1: 0
2: 1
3: 9
4: 122
923191117_923191122 18 Left 923191117 1:231621786-231621808 CCTGTGTGGGTGAATGAGTTGGG 0: 1
1: 0
2: 0
3: 20
4: 276
Right 923191122 1:231621827-231621849 AGCTATGTATGTACAGCTGTTGG 0: 1
1: 0
2: 1
3: 9
4: 122
923191115_923191122 19 Left 923191115 1:231621785-231621807 CCCTGTGTGGGTGAATGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 157
Right 923191122 1:231621827-231621849 AGCTATGTATGTACAGCTGTTGG 0: 1
1: 0
2: 1
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923191122 Original CRISPR AGCTATGTATGTACAGCTGT TGG Intronic
901575990 1:10201299-10201321 TGCTGTGTATTTTCAGCTGTGGG + Intergenic
901723815 1:11223448-11223470 AGAAATGTATGTACATGTGTCGG + Intronic
909505790 1:76388234-76388256 AGCTATCCATGTACAGTAGTTGG + Intronic
911552841 1:99305595-99305617 ACCTATGTATGTACTTCAGTGGG + Intronic
912090931 1:106075310-106075332 AGCTATGCAAGTACCTCTGTAGG - Intergenic
916413885 1:164575090-164575112 TGCTATGTATTTGCAGCTATTGG + Intronic
919212390 1:194504443-194504465 AGCTATGTTTTTACAGCTTTGGG + Intergenic
920811252 1:209287950-209287972 ATCTATGTATGTAAACCTTTGGG + Intergenic
921597211 1:217067398-217067420 AGCTATCTATGTTCAGTTGAAGG - Intronic
923191122 1:231621827-231621849 AGCTATGTATGTACAGCTGTTGG + Intronic
1064020657 10:11805926-11805948 ATCTATGTATGTACGCATGTAGG - Intergenic
1069527823 10:69188923-69188945 AGTTATGTGTTTAGAGCTGTGGG + Intronic
1070490750 10:76974139-76974161 TGCTAAGTGTGTACAGATGTGGG - Intronic
1074396640 10:113103548-113103570 AGCTTTGGATGTACAGATGCTGG + Intronic
1075669002 10:124250356-124250378 TGGCATGTATGTGCAGCTGTGGG - Intergenic
1076386845 10:130063145-130063167 AGCTTCGTATGAACAGCTGGAGG + Intergenic
1077677556 11:4209742-4209764 AATAATGTATGTACAGCTGATGG - Intergenic
1078383471 11:10865630-10865652 ATCTATGTGTGTACTTCTGTAGG + Intergenic
1080809991 11:35694104-35694126 ATCTGTGTATGTGCAGCTGTTGG - Intronic
1081333075 11:41828005-41828027 AGTTTTGTAAGTACAGTTGTTGG + Intergenic
1081384937 11:42460510-42460532 AGCTCTGGATGAAAAGCTGTTGG - Intergenic
1081818492 11:45967607-45967629 AGCTATCCTTGGACAGCTGTAGG + Intronic
1083970559 11:66071176-66071198 ATCCATGTATGTACAGCTCCCGG - Intronic
1084215010 11:67642379-67642401 AGGCATGGATGGACAGCTGTGGG + Intergenic
1086920801 11:92584219-92584241 AGCTATGTACGAACAGCTGATGG - Intronic
1091251792 11:134150350-134150372 ATCTGTGTATGTACATCTGAGGG - Exonic
1096519885 12:52179019-52179041 AGTTATGTCTCTACAGCTGCAGG + Intronic
1098913976 12:76238600-76238622 TGCTATGTATGTACCACAGTTGG + Intergenic
1100637883 12:96453168-96453190 AGCAATGTGGATACAGCTGTAGG + Intergenic
1101287144 12:103326516-103326538 AGGTATGTAAGTAGAGCGGTAGG - Intronic
1101966597 12:109286525-109286547 AGTTATGTCTGTACATCTGGTGG - Intronic
1105774581 13:23645792-23645814 AGTTGTGTATGTCCAGCTGCTGG + Intronic
1109843514 13:67952096-67952118 AGCTATGTGTCTACAGGTGATGG - Intergenic
1110806006 13:79755222-79755244 AGCCATTTATGTTCAGTTGTTGG - Intergenic
1113396800 13:109955503-109955525 ACCTATGTATCTAAAGCTGGTGG - Intergenic
1113969360 13:114176896-114176918 AGCTGTGGGTGGACAGCTGTGGG + Intergenic
1113969371 13:114176949-114176971 AGCTGTGGGTGGACAGCTGTGGG + Intergenic
1113969466 13:114177375-114177397 AGCTGTGGGTGGACAGCTGTGGG + Intergenic
1115458808 14:33635875-33635897 AGGGATGTATGTACAGGTGCTGG - Intronic
1120899606 14:89564545-89564567 AGCTCTGAATGTACAGTTGAAGG + Intronic
1124137886 15:27050852-27050874 AGCAAAATATGTACAGCTATTGG - Intronic
1124244087 15:28055594-28055616 AGCTATGTGTGGAATGCTGTGGG + Intronic
1127041725 15:54984543-54984565 AGCCCTGTATGTAGATCTGTTGG - Intergenic
1127682377 15:61310292-61310314 AGCAATGTATATGCAGCTGGAGG - Intergenic
1130684918 15:86028654-86028676 ACCTATGTGTGTAAAGCAGTAGG + Intergenic
1130942169 15:88520026-88520048 AGTTATATATGTACAAATGTTGG - Intronic
1131716962 15:95121945-95121967 AGCTATGTTAGTCCAGCTTTTGG + Intergenic
1137902722 16:52286703-52286725 AGCAATGTAGATACAGCTGGAGG + Intergenic
1138093948 16:54197469-54197491 AGCTGTGTATGTGCAGGTGTGGG + Intergenic
1143868661 17:9942358-9942380 AGGTGGGTATGTGCAGCTGTGGG + Intronic
1144069361 17:11653930-11653952 AGCTATGGAAATACAGCTGATGG - Intronic
1148910422 17:50939632-50939654 GGCAATGGATGTACACCTGTGGG + Intergenic
1150471031 17:65437818-65437840 AGCTAGTTGTGTACAGATGTTGG + Intergenic
1156105226 18:33651342-33651364 AAGTATATTTGTACAGCTGTAGG - Intronic
1158596273 18:58818684-58818706 ACATATGTATATACAGCTGTTGG + Intergenic
1168616576 19:57842269-57842291 AACAATGAATGCACAGCTGTGGG - Intronic
925005804 2:442270-442292 ACCTGTGTGTGCACAGCTGTGGG - Intergenic
925005885 2:442830-442852 ACCTGTGTGTGCACAGCTGTGGG - Intergenic
927854246 2:26517954-26517976 AGCTATGTATGGACACCCATGGG - Intronic
930833632 2:55772287-55772309 AGCTTTTTATGTACCTCTGTAGG + Intergenic
931577999 2:63740228-63740250 ATATATGTATATTCAGCTGTAGG + Intronic
932682915 2:73841926-73841948 AGCTATTCATGTACAGGTCTGGG + Intronic
935153762 2:100463867-100463889 AGTTATGTATGTACAGATGTAGG - Intergenic
935306011 2:101737178-101737200 AGGTGTGTATGTACTTCTGTTGG + Intronic
937993783 2:127678695-127678717 AGGTGTGAATGTACAGCCGTGGG + Intronic
941624166 2:167811970-167811992 TGCTATATGTGTACAGATGTTGG + Intergenic
942133009 2:172899005-172899027 AGCTATGTATATATTGATGTGGG + Intronic
944907195 2:204274202-204274224 AGCTATTTTTTTTCAGCTGTGGG - Intergenic
1169656576 20:7930738-7930760 AGCTAATGATGTACAGCAGTAGG - Intronic
1173127885 20:40356976-40356998 AGCAATGTATGTAAAGCATTTGG + Intergenic
1174552592 20:51372702-51372724 CCCTAAGTAGGTACAGCTGTCGG - Intergenic
1177017170 21:15806520-15806542 AGCCATGTATGTACATAGGTGGG + Intronic
1177273800 21:18880520-18880542 AGCTGTTTATGTACAACTGTGGG + Intergenic
1177284808 21:19036123-19036145 AGTTATGTAAGGACAACTGTGGG - Intergenic
1179122719 21:38563379-38563401 AGCTATGTATGTATAGGGGCAGG + Intronic
1179592873 21:42422140-42422162 TGTCATGTATGCACAGCTGTGGG - Intronic
957023036 3:75145411-75145433 ATGTATGTATGTGCAGCTTTGGG - Intergenic
958080439 3:88739781-88739803 AGCTGTGTATGTACAGCAACAGG + Intergenic
958898327 3:99855441-99855463 AGCTGAGTCTGTACATCTGTCGG + Intronic
958967014 3:100570409-100570431 AGCTATCTCTGTTCAGCTGCAGG + Intronic
960427992 3:117532459-117532481 AGTCATGTCTTTACAGCTGTGGG - Intergenic
961156813 3:124686599-124686621 AGTTATGTAGGAAGAGCTGTAGG + Intronic
964513208 3:157476455-157476477 AGCAAAGGATGTACAGCAGTAGG + Intronic
965704848 3:171495960-171495982 ATCTATGTATTTGCAGATGTTGG - Intergenic
969777626 4:9369622-9369644 AGTTATGTCTTTACACCTGTAGG + Intergenic
974826579 4:67138976-67138998 AGATATATATGTACATCTATCGG - Intergenic
974860553 4:67515532-67515554 TGCTATGTATGAAGAACTGTGGG - Intronic
977183151 4:93902771-93902793 AGATATTTATTTACAGCAGTGGG + Intergenic
977462809 4:97346406-97346428 AGGTGTGTATCTATAGCTGTTGG - Intronic
977526247 4:98149485-98149507 AGATATGTATATATAGTTGTTGG + Intergenic
984228505 4:177065059-177065081 AGCTCAGTGTGAACAGCTGTTGG - Intergenic
984404580 4:179311497-179311519 AGCTATGTATGTGTAGGGGTAGG - Intergenic
984524169 4:180836986-180837008 ATCTCTGTATCTACAGCTCTTGG - Intergenic
991071225 5:62483173-62483195 AGCTATGTTTTTACAGAAGTTGG + Exonic
991725440 5:69531236-69531258 AGGTTTGTATGCACAGGTGTAGG + Intronic
993922396 5:93822648-93822670 AGCTATATATTTATATCTGTAGG + Intronic
994075230 5:95642937-95642959 AGCTTTGTATGTGTAGGTGTAGG + Intergenic
995923124 5:117337767-117337789 AATTATGTATGTAAAGCTCTAGG + Intergenic
997598744 5:135125190-135125212 GACTATGTATGTAAAGCTCTTGG + Intronic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
999519150 5:152332541-152332563 AGCTATGAACAGACAGCTGTGGG + Intergenic
1000398622 5:160802047-160802069 AGCTGTGTCTGTAGAGGTGTTGG + Intronic
1000640234 5:163693519-163693541 AGCTATTTATTTAGTGCTGTGGG - Intergenic
1004117467 6:12784181-12784203 AGATATATATGTATATCTGTGGG - Intronic
1005308012 6:24532379-24532401 AGCTCTCTAATTACAGCTGTGGG + Intronic
1006428012 6:33978218-33978240 GGCAATGTATGTACAGCACTCGG - Intergenic
1007815510 6:44522405-44522427 AGCTGGGTATCTTCAGCTGTGGG - Intergenic
1008330988 6:50244214-50244236 AGGTGTGTATATACAGGTGTGGG + Intergenic
1010101637 6:72116294-72116316 AGATGTGTAAGTACAGATGTTGG + Intronic
1011051083 6:83150291-83150313 GGGAATGTATGTACAGGTGTTGG + Intronic
1011077837 6:83456695-83456717 AGCTGTGGGTATACAGCTGTGGG - Intergenic
1019851432 7:3562042-3562064 AACTATGTACACACAGCTGTGGG - Intronic
1020911747 7:14139997-14140019 AGATATTTAAGTAAAGCTGTAGG + Intergenic
1027862862 7:83607162-83607184 AGTTATGTAAGTACAGCTTTAGG - Intronic
1028607614 7:92672122-92672144 ATATATATATGTACAGCTTTTGG - Intronic
1030317295 7:108128675-108128697 TGCGCTGTATGTGCAGCTGTGGG - Intronic
1039735435 8:40326995-40327017 AGCTATGTATGTGGATATGTGGG + Intergenic
1042132208 8:65598549-65598571 TGCTATATAAGTATAGCTGTAGG - Intergenic
1047111730 8:121797093-121797115 GGGTGTTTATGTACAGCTGTGGG + Intergenic
1047465955 8:125114524-125114546 ACATATGTATATACAGCAGTGGG + Intronic
1048505578 8:135018034-135018056 AGATATGTATGTAAAGCCCTGGG + Intergenic
1049340171 8:142108047-142108069 AGGCATGTATGTGAAGCTGTGGG - Intergenic
1056958838 9:91104126-91104148 AACTATGTAAGTAGATCTGTTGG + Intergenic
1059208886 9:112492548-112492570 AGGTATGTATGTACATATGTAGG - Intronic
1059905152 9:118975323-118975345 AGCTATGTATGTAAAATTATTGG + Intergenic
1186153692 X:6703801-6703823 AGCAATGTATGCTCAGCTATTGG + Intergenic
1187265102 X:17725263-17725285 AGCTATGTCTGTAGATCTGTGGG - Intronic
1188219015 X:27517157-27517179 AATAATGTATGTACAGCTGGTGG - Intergenic
1189273083 X:39765446-39765468 AGCTATGGATGGACAGATTTGGG + Intergenic
1189758040 X:44292230-44292252 ACATATGTATGTACATATGTAGG + Intronic
1190287984 X:48973117-48973139 AGCTATGTATGGACAGAGATGGG - Intergenic
1194527636 X:94997501-94997523 AGCTATGTATGAATTTCTGTTGG + Intergenic
1197672755 X:129296659-129296681 ATTTATGTATGTAGAGATGTTGG - Intergenic