ID: 923192520

View in Genome Browser
Species Human (GRCh38)
Location 1:231633515-231633537
Sequence ATGTGGAAGCCCAATGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923192520_923192523 0 Left 923192520 1:231633515-231633537 CCCTGCTCATTGGGCTTCCACAT 0: 1
1: 0
2: 1
3: 12
4: 167
Right 923192523 1:231633538-231633560 TTTGCTTCCTTCCCTTGCCCAGG 0: 1
1: 0
2: 5
3: 40
4: 415
923192520_923192528 15 Left 923192520 1:231633515-231633537 CCCTGCTCATTGGGCTTCCACAT 0: 1
1: 0
2: 1
3: 12
4: 167
Right 923192528 1:231633553-231633575 TGCCCAGGTGGTTCCATTTCAGG 0: 1
1: 0
2: 10
3: 10
4: 157
923192520_923192524 3 Left 923192520 1:231633515-231633537 CCCTGCTCATTGGGCTTCCACAT 0: 1
1: 0
2: 1
3: 12
4: 167
Right 923192524 1:231633541-231633563 GCTTCCTTCCCTTGCCCAGGTGG 0: 1
1: 0
2: 1
3: 32
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923192520 Original CRISPR ATGTGGAAGCCCAATGAGCA GGG (reversed) Intronic
901159177 1:7162071-7162093 ATGTAGAAGGCCATTGGGCAGGG + Intronic
902392282 1:16113534-16113556 GTGTGGAGGCCCAGAGAGCAGGG - Intergenic
907518351 1:55007418-55007440 ATGTGGCAGACAAATGAGTATGG + Intronic
908011548 1:59783230-59783252 ATGGTGAACACCAATGAGCATGG + Intergenic
913452535 1:119001708-119001730 GTGTGGACGCCCCAGGAGCAGGG + Intergenic
913501806 1:119478612-119478634 TTGTGAGAGGCCAATGAGCAGGG + Intergenic
913963376 1:143355482-143355504 ATGTGGCAGCCCCTTGAGAAAGG - Intergenic
914057732 1:144181068-144181090 ATGTGGCAGCCCCTTGAGAAAGG - Intergenic
914121414 1:144785298-144785320 ATGTGGCAGCCCCTTGAGAAAGG + Intergenic
914384257 1:147152607-147152629 ATGTGGTAGCCTTAGGAGCAAGG - Intergenic
917454515 1:175174553-175174575 ATGTGGAAGAACACTGAGCAGGG + Intronic
920195603 1:204224282-204224304 AAGTGGAAGGACAATGAGAAGGG + Intronic
921419753 1:214932714-214932736 ATGTGAAAGCACATTGAGGAAGG + Intergenic
922001700 1:221485289-221485311 ATATGAAAGCCCAAAGAGTATGG + Intergenic
923078233 1:230629296-230629318 ATATGGGAGCCCAATAAGAAAGG - Intergenic
923192520 1:231633515-231633537 ATGTGGAAGCCCAATGAGCAGGG - Intronic
1064782555 10:18858391-18858413 TTGTGGAAGCCAAATTAGAATGG + Intergenic
1065316620 10:24470388-24470410 ATGAGGGTGTCCAATGAGCAGGG + Intronic
1066338381 10:34504075-34504097 ATGTGGAAGTGCAGTGAGCATGG - Intronic
1067685433 10:48463966-48463988 CTCTGGAAGCCCATGGAGCATGG + Intronic
1070432572 10:76355944-76355966 ATTTGGAAACCCAATTAGAAGGG + Intronic
1070740412 10:78899531-78899553 TTGTGGAAGCCAAAGGTGCAAGG - Intergenic
1070972455 10:80578805-80578827 ATGGTCAAGGCCAATGAGCAAGG + Intronic
1071737569 10:88318537-88318559 TTGTGCAAGCCCAAGCAGCATGG - Intronic
1071986722 10:91058989-91059011 ATGTGAGTGCCCAATGAACATGG - Intergenic
1073003541 10:100303587-100303609 ATCTGGAAGGCGAATGATCACGG + Intronic
1075334026 10:121596412-121596434 AGGTGGAAGCCCAAAGCGGAGGG - Intronic
1076605753 10:131689025-131689047 GTGTCAAAGCCCAATGTGCATGG - Intergenic
1080422661 11:32125585-32125607 ATGTTGAATCCCAATTACCAAGG + Intergenic
1082699245 11:56407714-56407736 ACGTGGAAGGCCAAAGAGAATGG + Intergenic
1084885470 11:72202970-72202992 ATGAGGTAGCCCATTGACCAAGG + Intergenic
1085483467 11:76841944-76841966 AGGTGGAAGCTCTTTGAGCAAGG + Intergenic
1085614867 11:77989644-77989666 ATTTGGAAGCCCAAGGAGGGTGG + Intronic
1087247841 11:95860653-95860675 ATGTAGAATCTCAATGTGCATGG + Intronic
1090496946 11:127222401-127222423 CTTTGGAAGCTCAATGAGCTCGG - Intergenic
1090620849 11:128559893-128559915 ATGAAGAGGCCCAATAAGCAGGG - Intronic
1092055045 12:5501808-5501830 ATGTGGAAGGCGAAAGAGGAAGG + Intronic
1092255177 12:6922990-6923012 GTGCGGAACCCCAATGAGTAGGG - Exonic
1096248243 12:50008888-50008910 ATGTTGAAGACCAATAATCATGG + Intronic
1097961284 12:65534120-65534142 AGGGGGAAACCCAATGAGCAAGG - Intergenic
1098168585 12:67722401-67722423 ATGTGGAAGTCCCAGGAGCCTGG + Intergenic
1098998390 12:77148120-77148142 AGGTTCAAGCCCAATGGGCAGGG + Intergenic
1100212365 12:92410709-92410731 ATGTTGAAGCCTAATCATCAAGG + Intergenic
1100874648 12:98949274-98949296 AGTTGGAAGCCCAAAGAGCTTGG + Intronic
1103130808 12:118466921-118466943 ATCTGTAAGCCCAAGGAGAAAGG - Intergenic
1105303986 13:19156627-19156649 ATGTGGAGGCCCAAAGGGCTGGG - Intergenic
1106794471 13:33190197-33190219 CTTTGGAAGGCCAATGAGGAAGG + Intronic
1112610216 13:100948100-100948122 CTGTGGAAGCCCCAGGAGCAAGG - Intergenic
1113232503 13:108229454-108229476 ATGTGGAATGCCAGTGGGCATGG - Exonic
1114065439 14:19055405-19055427 CTGTTGGAGCCCAAGGAGCAAGG + Intergenic
1114096824 14:19344597-19344619 CTGTTGGAGCCCAAGGAGCAAGG - Intergenic
1114870897 14:26657267-26657289 ATGTGGGAACCCAATCACCAAGG + Intergenic
1115281921 14:31673140-31673162 ATGTGGAATGCTAATTAGCATGG + Intronic
1117327165 14:54679960-54679982 ATTTGGAAGCCAAATGATCGTGG + Intronic
1117331189 14:54713424-54713446 ATGAGGAAGCCAGGTGAGCAGGG + Intronic
1117995445 14:61473554-61473576 ATTTGGAAGCCTAAAGAGAATGG + Intronic
1119303016 14:73585618-73585640 AGGTGGAGGTCCAATGAGCCGGG + Intergenic
1119531693 14:75366092-75366114 ATGAGGAAGCCCAAGGTGCTTGG - Intergenic
1120636876 14:86964156-86964178 CTGGGGAAGCCTCATGAGCATGG - Intergenic
1120766777 14:88334645-88334667 ATGTGGAGGGCCAAGGAACACGG - Intergenic
1130123739 15:81074607-81074629 ATGTGAAAGCAAAGTGAGCATGG + Intronic
1131525489 15:93149217-93149239 AGGTGGCAGCCCACTGGGCAGGG - Intergenic
1133729587 16:8568232-8568254 ATGTGGCACCCCAGAGAGCAAGG + Intergenic
1137279439 16:46963108-46963130 ATGCATAAGCCCAATGAACACGG - Intronic
1140503493 16:75454845-75454867 ATTTGGAAGTCAAATGTGCATGG + Intronic
1141778148 16:86138177-86138199 CAGTGGAAGCCCAAGGAGTAGGG + Intergenic
1142375457 16:89704678-89704700 AGGTGGTAACCCAATGACCAGGG - Intergenic
1142744199 17:1947650-1947672 ATGTGGCGGCCTAATTAGCACGG - Intronic
1144005511 17:11095845-11095867 ATATTGAAGCCAAATGGGCAGGG + Intergenic
1146517174 17:33498388-33498410 AGGTGGGAGACCAAAGAGCACGG + Intronic
1147627835 17:41911184-41911206 CTGAGGAAGCCCAATGAGGGAGG + Intronic
1151671559 17:75574111-75574133 ATGTGGAAGCCCAGGGCCCAGGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1156591649 18:38496466-38496488 ATGTGGAAGCCCACTGAGTTTGG - Intergenic
1158269583 18:55698098-55698120 CTGTGGATGCCCAGTGAGCTTGG + Intergenic
1159454267 18:68640955-68640977 ATTTGGAAACCCAATGACAATGG - Intergenic
1161721740 19:5906507-5906529 CTGTGGATACCCAATGGGCAAGG - Intronic
1161893447 19:7060129-7060151 ATGTGGAAACCAAAGAAGCAAGG - Intergenic
1163606532 19:18278901-18278923 AGTTGGAAGCCCAAAGCGCAGGG + Intergenic
1164859916 19:31554846-31554868 ATATGGAAGCCCAAGGAAGAAGG + Intergenic
1167818840 19:51907867-51907889 AAGAGGCAGCCCACTGAGCATGG + Intronic
1168102767 19:54149712-54149734 CTGTGGAGGCCCATTGAGCAGGG - Exonic
1202697215 1_KI270712v1_random:133741-133763 ATGTGGCAGCCCCTTGAGAAAGG - Intergenic
925297787 2:2789698-2789720 GTGTGGAAGAACCATGAGCATGG + Intergenic
925785671 2:7429840-7429862 GTGTGGATGCCCACTGAGCACGG + Intergenic
927016742 2:18971250-18971272 ACGTGGAAGCCCTATTATCATGG + Intergenic
928347092 2:30509907-30509929 ATGTGGAAGCCAAATGTGGCAGG + Intronic
930118833 2:47743169-47743191 ATGTGGCAGCACAGTGATCAAGG - Intronic
931733994 2:65177702-65177724 CTGTGGGCGCCTAATGAGCATGG - Intergenic
933556281 2:83835064-83835086 ATTTGGAAGCTCTGTGAGCAAGG - Intergenic
933849073 2:86350952-86350974 ATGAGGAAGCCCAAGGCACATGG + Intergenic
934278383 2:91590758-91590780 ATGTGGCAGCCCCTTGAGAAAGG - Intergenic
935720031 2:105971820-105971842 ATGCAGAAGCCCACTGAGCTGGG + Intergenic
937031196 2:118742243-118742265 ATGTGGAAACCAAACGAGCCAGG - Intergenic
937209699 2:120260416-120260438 TTGTGGCAGCCCAGTGGGCAGGG + Intronic
937335246 2:121058527-121058549 ATGTGGAGGGCAAATGGGCAAGG + Intergenic
937504310 2:122519496-122519518 ATTTGGAAGACAAAGGAGCAAGG + Intergenic
938219581 2:129553915-129553937 ATGTGGCAGCCCAGTGAGCAAGG - Intergenic
939433989 2:142149500-142149522 ATGTAGAAGACCAATTAGAAAGG - Intergenic
940364223 2:152828481-152828503 ATGTGGATGTACGATGAGCATGG + Intergenic
941733271 2:168944032-168944054 ATGTGTAAGCCCCTTGAACAAGG + Intronic
942729187 2:179044933-179044955 ATGTGGAAGAGCAATGAGCCAGG - Intronic
944689938 2:202149638-202149660 ATGGGGAACCCCAATTAGAAAGG + Intronic
948072394 2:235138416-235138438 ATGAGGAGGCCCCAGGAGCAGGG + Intergenic
948229978 2:236342423-236342445 ATGTGGACGTCCAATGCTCATGG + Intronic
1170806069 20:19633074-19633096 ATGTGGAAAGCCAAAGATCATGG - Intronic
1175160626 20:57005185-57005207 ATCTGGAAGCCCTTTGAGGATGG - Intergenic
1175276141 20:57772237-57772259 ATTTGGTAACCCTATGAGCAGGG + Intergenic
1179826636 21:43969570-43969592 ATGGGGATGCACACTGAGCAGGG - Intronic
1179875826 21:44266890-44266912 CTGTGGAAGCCCCAGGAGCCTGG + Intergenic
1180483929 22:15778025-15778047 CTGTTGGAGCCCAAGGAGCAAGG + Intergenic
1180713730 22:17857595-17857617 ATGTAGAAGCACAAAGAGCTGGG + Intronic
1180878097 22:19184661-19184683 ATGTGGAAGACAAGTCAGCAAGG - Intronic
1180944911 22:19687578-19687600 ATGTGGAGTCCCAGAGAGCAGGG - Intergenic
1182702573 22:32252492-32252514 ATATGGAAAACCAATGAGCACGG - Intronic
1183324413 22:37183681-37183703 AGGTGGAAGCCCAGAGAGCTGGG + Intronic
1183738252 22:39655715-39655737 AAGTGGGAGCCCAAGGAGGAGGG - Intronic
949234670 3:1793747-1793769 ATGTGGAAGCCCAATAAAGGAGG - Intergenic
950711163 3:14813817-14813839 ATGTAGAAGTTCAATTAGCAGGG - Intergenic
950947291 3:16962059-16962081 ATGGGGAAGCTCAGGGAGCATGG + Intronic
952393074 3:32897525-32897547 ATGTGAAAGCCAAAAGAGGAGGG - Exonic
953664402 3:44915705-44915727 AGTTTGAAGCCCAATGTGCAAGG + Intronic
954777928 3:53036609-53036631 ACTTGGAAGCCCAACGGGCAGGG + Intronic
955102805 3:55868556-55868578 ATGTGGAAGTCCACAGAACAGGG - Intronic
958929045 3:100189795-100189817 ATGGGGCAGCCCACTGTGCAGGG - Intronic
960552082 3:118987137-118987159 ATGTGGAAGCACCATTAGGAAGG - Intronic
963346832 3:144104895-144104917 ATCTGGGAGCCCAATTGGCAGGG + Intergenic
964312556 3:155410305-155410327 GTGTAGAAGGCCACTGAGCAGGG - Intronic
965670093 3:171138976-171138998 AAGTGGAAGCTGCATGAGCAAGG + Intronic
965787455 3:172351180-172351202 ATGTGGAAGACCACAGAGGAAGG + Intronic
965925207 3:173970506-173970528 ATGTGGAAGCCAGATGATGAAGG + Intronic
967633176 3:191770877-191770899 ATGTGGATGCCAAATAGGCAAGG - Intergenic
968265168 3:197357087-197357109 AGGGGGAAACCTAATGAGCAAGG + Intergenic
968974869 4:3816756-3816778 ATGTGGCACCACACTGAGCAGGG - Intergenic
969155817 4:5208927-5208949 CTGATGAAGCCCACTGAGCAGGG - Intronic
971545828 4:27884924-27884946 ATGAGGAAGAGCAATGAACAAGG - Intergenic
977359879 4:95988647-95988669 CTGTGGAAGCCCACTGAGCCTGG + Intergenic
978609556 4:110522422-110522444 GTTTGGAAGGCCAATGTGCATGG - Intronic
980706512 4:136503418-136503440 ATGTTGAAACCCAATCACCAAGG + Intergenic
980984746 4:139684546-139684568 ACGTGGAAGCTCCATGTGCATGG + Intronic
986597806 5:9441686-9441708 AGGTGGCAGGCCAAGGAGCAGGG + Intronic
986861275 5:11929072-11929094 ATGAGGAAGCCCAGTGCACATGG - Intergenic
987613140 5:20234774-20234796 ATTTGAAAGCCCAAAGAACAGGG + Intronic
988529680 5:32016723-32016745 AAGTGGAAGTCCAAAGAGAAGGG - Intronic
992018961 5:72603719-72603741 TTGAGGAATCCCAAAGAGCAGGG + Intergenic
992154412 5:73940704-73940726 ATGGCCAAGCCCAATGAGAAAGG - Intronic
993152320 5:84176395-84176417 ATCTGGGAGCCCACTGAGCCTGG - Intronic
998657076 5:144193323-144193345 AAGTTGGATCCCAATGAGCAAGG - Intronic
998707715 5:144782910-144782932 TTGTGGAAGCCAAATGATGAAGG + Intergenic
1001108619 5:168876665-168876687 ATGTGGAAGCCCAGGGAGACAGG - Intronic
1009413338 6:63391875-63391897 ACATGGAAGGACAATGAGCATGG + Intergenic
1011745502 6:90403925-90403947 GAGAGGAAGCCAAATGAGCATGG - Intergenic
1012026612 6:94001906-94001928 ATGTGGAAGCACACTAAACAAGG - Intergenic
1017334931 6:153245086-153245108 ATGTGAGATCCCAATGAGCTAGG + Intergenic
1023011267 7:35926556-35926578 TTGTGGGAGGCCAATGAGAAAGG - Intergenic
1023848404 7:44136854-44136876 ATGTGACAGCCCAAGGAGCTGGG + Intergenic
1029402254 7:100353526-100353548 ATGTGGAGGCCCAGGCAGCAGGG - Intronic
1031878501 7:127169097-127169119 ATGAGGAAGCTTAATGAGGAAGG + Intronic
1032606787 7:133364177-133364199 ATGTAGAGGCCCAATCATCATGG + Intronic
1034985880 7:155515250-155515272 GTGTGGAGGCCAGATGAGCAGGG - Intronic
1035273676 7:157734706-157734728 ATTTCGAAGCCAAATGAGAATGG - Intronic
1036117466 8:5973407-5973429 ATGTGGAAGGGAAATGAGCATGG - Intergenic
1036659729 8:10700203-10700225 AAGGGGAAGGCCGATGAGCAGGG - Intronic
1041154280 8:54968668-54968690 ATTTGGAAGGCCAATGAGGGTGG + Intergenic
1045341061 8:101254923-101254945 ATGTTGAAGCCTAATCACCAAGG + Intergenic
1046885866 8:119366365-119366387 ATGTGGATGCACAGTGGGCAGGG - Intergenic
1047598975 8:126407543-126407565 ATGTGGAAATCCCATGAGCAAGG + Intergenic
1052681625 9:31700507-31700529 CTGAGGAAGCACAATGATCAAGG + Intergenic
1053479486 9:38405371-38405393 ACGTGGAAGCCCAGTGCCCAGGG - Intergenic
1054852917 9:69867067-69867089 ATGTTGAAGCCAAATGACCGAGG + Intronic
1057865525 9:98677346-98677368 ATGTGAAAAGCCAATGACCAGGG - Intronic
1058399219 9:104594370-104594392 ATGTGGAAAACCAATGACAACGG + Intergenic
1186522876 X:10221345-10221367 AGGTGGAAGCCTAATAAGAATGG + Intronic
1187268965 X:17762514-17762536 AGGTGGCAGCCCCATGAGAATGG - Intergenic
1187320561 X:18234142-18234164 AGGTGGCAGCCCCATGAGAATGG + Intergenic
1188503748 X:30858619-30858641 GTGAGGAAGACCAGTGAGCATGG + Intronic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1191239554 X:58173094-58173116 ATTTTGAAGCCCAATGAGTTAGG + Intergenic
1191977881 X:66893869-66893891 AGGTGGAAGCCCAGTCAACAAGG + Intergenic
1202069336 Y:20974378-20974400 ATGTGGGGGCCCAATCAGAATGG + Intergenic
1202095135 Y:21241938-21241960 ATGTAGAAGACCAATGGCCATGG - Intergenic