ID: 923198323

View in Genome Browser
Species Human (GRCh38)
Location 1:231688940-231688962
Sequence TCTGAATTATTGAAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 327}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923198321_923198323 8 Left 923198321 1:231688909-231688931 CCTGAAGGCACTTCAGAAGACTT 0: 1
1: 0
2: 4
3: 29
4: 230
Right 923198323 1:231688940-231688962 TCTGAATTATTGAAGGAAGATGG 0: 1
1: 0
2: 2
3: 37
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923198323 Original CRISPR TCTGAATTATTGAAGGAAGA TGG Intronic
904907587 1:33909593-33909615 TTTGAATGATTGAATGATGATGG + Intronic
906449933 1:45936797-45936819 ACTGAATTATTCAGGAAAGAAGG + Intronic
907166373 1:52415179-52415201 TCTGAATTAGTGGAGGAAGAGGG - Intronic
908694984 1:66829642-66829664 TCTCAATAATTGAAAGAAGTAGG + Intronic
908756483 1:67473524-67473546 TCTGATTCTCTGAAGGAAGATGG + Intergenic
909553594 1:76928011-76928033 TGTGATTTATTGGAGGAAAATGG + Intronic
909756654 1:79234041-79234063 TCTAAAACATTGAAGGAGGAAGG + Intergenic
910012259 1:82479989-82480011 TCTGAATTATTTCAGGAAAAAGG - Intergenic
910504748 1:87937244-87937266 TTGGAATGAATGAAGGAAGATGG - Intergenic
911507611 1:98773021-98773043 TCTGAATTATTTCAGGAGCAAGG - Intergenic
911704556 1:100996361-100996383 TCTGATTTTTAAAAGGAAGAGGG + Intronic
912037750 1:105343010-105343032 TATGAATTATTGAATAATGAGGG + Intergenic
912203540 1:107484762-107484784 ACTGGATTATTGATGGTAGAGGG - Intergenic
913414610 1:118591009-118591031 AGGGAATTATTGAAGAAAGAAGG - Intergenic
914942477 1:152035369-152035391 TCTGCATTCTGGAAGGAAAAGGG - Intronic
915826612 1:159084856-159084878 TCTGAAGGACTGAAGGAACAAGG + Intronic
916972504 1:170039159-170039181 TGTGTATTATTGATGGAAAAAGG + Intronic
917158788 1:172033779-172033801 TCTAAATTATTGTGGGAAAAGGG - Intronic
917282693 1:173394016-173394038 TCTGCATTATTTCAGCAAGAAGG + Intergenic
918245633 1:182656978-182657000 TCTGAATAATGGAAGGGAGAAGG + Intronic
919557546 1:199077964-199077986 TCTGAATAATTGATATAAGATGG + Intergenic
919678930 1:200414504-200414526 TAACAATTATTGAGGGAAGAGGG - Intergenic
920351491 1:205340940-205340962 TCCCAATTTGTGAAGGAAGATGG - Intronic
921564305 1:216698122-216698144 TAGGAATTATTGAGGGAAAACGG + Intronic
923198323 1:231688940-231688962 TCTGAATTATTGAAGGAAGATGG + Intronic
924787506 1:247211731-247211753 TCTGATTTTTGGGAGGAAGATGG - Intergenic
1063271167 10:4511237-4511259 TCTGGATTATTGGAGAGAGAAGG - Intergenic
1064340487 10:14481086-14481108 TCTGAATTACTAATGGAAAAAGG + Intergenic
1064884021 10:20089623-20089645 TCTGTATCATGGAAGGTAGATGG + Intronic
1065287180 10:24197332-24197354 TCTGACTTATGGAAAAAAGATGG + Intronic
1066264070 10:33758245-33758267 TATGGATTATTGAGGGAAAAGGG + Intergenic
1066495385 10:35937400-35937422 TCTGAATTTTATAGGGAAGAAGG - Intergenic
1068796504 10:61087600-61087622 TCTCAATTATGAAAGGAAGAGGG - Intergenic
1068987587 10:63121481-63121503 TATGAATTAATCAGGGAAGAAGG - Intergenic
1071420330 10:85490234-85490256 TCAGGTTTATTGAGGGAAGATGG - Intergenic
1072425476 10:95326470-95326492 GTTGAATAAATGAAGGAAGAAGG + Intronic
1073366311 10:102945018-102945040 TGTTAATTATTAAGGGAAGAAGG - Intronic
1073399827 10:103248091-103248113 TCTTAATTATTGAATTAAGAGGG + Intergenic
1075989722 10:126825479-126825501 TATGAATTATGGAAGAAAGATGG + Intergenic
1076167941 10:128297392-128297414 TCTTCATTATGCAAGGAAGAGGG + Intergenic
1077031228 11:468867-468889 TCTGAATAATTGGAGAAGGAGGG + Intronic
1077200207 11:1302957-1302979 TTTGTATAATTAAAGGAAGAGGG - Intronic
1079870169 11:25787898-25787920 TTTAAAGTTTTGAAGGAAGAAGG - Intergenic
1082073136 11:47955742-47955764 TTTGAATTATACAAGAAAGATGG + Intergenic
1082213571 11:49537166-49537188 TCTAAATTACTGAGAGAAGATGG - Intergenic
1082772869 11:57222103-57222125 TGAGAATTATTGTAGGAAGAGGG - Intergenic
1084424120 11:69075223-69075245 TCAGCATTATTGAGGAAAGAAGG - Intronic
1085871490 11:80355674-80355696 TCTCATTTATTAAAAGAAGATGG - Intergenic
1085993352 11:81879004-81879026 TCTGAATTAGAGGAGAAAGATGG - Intergenic
1086165059 11:83768557-83768579 TCTGAGCAATTGAGGGAAGAGGG - Intronic
1087220092 11:95537459-95537481 CATGAAGTAGTGAAGGAAGACGG + Intergenic
1087229902 11:95648987-95649009 TCTGAATAATTGAAAGAAAATGG - Intergenic
1087757258 11:102067623-102067645 TCTCAATGATTTTAGGAAGAAGG - Intronic
1087941789 11:104106537-104106559 TCTGAATAATTGAATGAATGTGG - Intronic
1088986969 11:114917703-114917725 TTTGAAATAATGAAGGAAAAAGG + Intergenic
1089490948 11:118883727-118883749 TCTGTTTTTTTGAAGAAAGAGGG - Intergenic
1089889427 11:121865628-121865650 TCTGAATCCTTGAAGGAATGTGG - Intergenic
1090185060 11:124732880-124732902 TTTGAATAATTGAATGAATAAGG - Intergenic
1090432067 11:126654436-126654458 TCTGAAATGTTGAAGGTGGAGGG + Intronic
1090985140 11:131759986-131760008 TTTGAATTATTAAAGGAGGCTGG + Intronic
1091314536 11:134603838-134603860 ACTGAATTATTGAAAAAACAAGG - Intergenic
1091999697 12:5022022-5022044 GCGAAATGATTGAAGGAAGACGG + Intergenic
1092936663 12:13370213-13370235 TCTGAATTCTTTAATTAAGAAGG - Intergenic
1092943361 12:13430848-13430870 TCTAAATTATTTAATGAGGAAGG - Intergenic
1093118627 12:15241857-15241879 TCTGAATCTGTGAAGGAAGGTGG + Intronic
1093475147 12:19546785-19546807 TCTGAAAGCTTGAATGAAGAAGG + Intronic
1093932174 12:24965189-24965211 TCTAAATTATTCAAGAGAGAAGG - Intergenic
1094006222 12:25754810-25754832 TCTGTATTTTTGTAGGAACAAGG - Intergenic
1094799501 12:34016596-34016618 TTTGAATTACTGAAGGATGGAGG + Intergenic
1095112288 12:38310862-38310884 TTTGAATTACTGAAGGATGGAGG + Intergenic
1096046876 12:48570174-48570196 GGTGAATTATGGAAGGAAGCTGG - Intergenic
1096284251 12:50284343-50284365 GCTGGATATTTGAAGGAAGAAGG - Intergenic
1098297231 12:69016307-69016329 ACTGCATGATTGAAGAAAGAGGG + Intergenic
1098930712 12:76409061-76409083 TCTGTATTATTAAAGAAAGTAGG - Intronic
1099051680 12:77788679-77788701 TCTACATAATAGAAGGAAGAAGG - Intergenic
1099284586 12:80701941-80701963 TTTGATTTATTGAAGCAACAAGG + Intergenic
1099397072 12:82153816-82153838 TTCAAATTAGTGAAGGAAGATGG + Intergenic
1099727262 12:86447933-86447955 TCAGAATTGCTGAAGGAAAATGG - Intronic
1100011666 12:89961271-89961293 TCTTCCTTTTTGAAGGAAGAGGG + Intergenic
1101119634 12:101565499-101565521 TTTGAGTTATTGGAGGAAGTCGG - Intergenic
1102003807 12:109575771-109575793 TCTGAAATTTTGCAGGCAGAAGG + Intronic
1102981379 12:117244105-117244127 TCTTAAATATTAAAGGAAGATGG - Intronic
1103855139 12:123962925-123962947 TCGGAATTAATGAAAGAACACGG + Intronic
1105967493 13:25397918-25397940 CCTGAATTGTTGAAGGCAGCGGG + Intronic
1106171505 13:27292660-27292682 GCTGGATTTTTGAAGAAAGAGGG - Intergenic
1106175235 13:27324672-27324694 TAATAATTATTGAAGGAAGAGGG - Intergenic
1108289464 13:48944158-48944180 TTTAAAATATTGAATGAAGATGG + Intergenic
1108638448 13:52359492-52359514 TCTAAAATATTAAAGGAATAGGG - Intergenic
1109109876 13:58303368-58303390 TATGAATGAATGAATGAAGATGG + Intergenic
1109860130 13:68187546-68187568 TTTCATTTATTGAAGGAGGATGG - Intergenic
1110042657 13:70784336-70784358 TCTGAAGAATTGAAGAAACATGG - Intergenic
1111254997 13:85655496-85655518 TTAAAATTTTTGAAGGAAGATGG + Intergenic
1111435962 13:88208480-88208502 TCTGAATTCTGTAAGGAACAGGG + Intergenic
1111684918 13:91489945-91489967 TATGAATTATTAAAAGAAAAAGG + Intronic
1111937301 13:94570334-94570356 CCTGAATTATTGCAGTAAGCAGG - Intergenic
1113077754 13:106484720-106484742 TCTGAAATATTTAAGGGAGTTGG + Intergenic
1113828908 13:113278808-113278830 TCTCAGTTACTGAAAGAAGAGGG - Intergenic
1114631380 14:24161549-24161571 GCTGGATTGTTCAAGGAAGAAGG + Intronic
1118537368 14:66782879-66782901 TCTGAAAGATGGAAAGAAGAAGG + Intronic
1122559454 14:102601372-102601394 TGTGAATTAATGAAGAAAGAAGG - Intronic
1124114548 15:26829086-26829108 TCAGAATGCTTGAAGAAAGAAGG - Intronic
1125143474 15:36438303-36438325 TCAGAAATAATGAAGGGAGATGG - Intergenic
1125526125 15:40376079-40376101 TTTGAATTCTTAAATGAAGAAGG - Intergenic
1126960078 15:53982510-53982532 TCAGAATAACTGGAGGAAGAAGG + Intergenic
1127940415 15:63689699-63689721 TCTGTTTTATTGAAGAAAAAAGG + Exonic
1128448756 15:67788434-67788456 GCTTCATTATTGAAGGTAGATGG + Intronic
1128896505 15:71378511-71378533 TCTGAATTCCTCAAGGATGATGG - Intronic
1129087516 15:73111379-73111401 TATGAATTTATGAATGAAGATGG + Intronic
1130264115 15:82383701-82383723 TCTGATTTTTTTAAGGGAGAGGG - Intergenic
1130634007 15:85599080-85599102 TCAGCACTAATGAAGGAAGAGGG - Intronic
1131794551 15:96001901-96001923 TATGAATTTTGGAAGGATGATGG - Intergenic
1133706076 16:8355934-8355956 TCTGAAGGATTCAAGTAAGAGGG - Intergenic
1135729690 16:24883677-24883699 TCTAACCTAGTGAAGGAAGAGGG - Intronic
1135952835 16:26931249-26931271 TCTAAATTGTTAAAGGAAGAAGG - Intergenic
1137842701 16:51654492-51654514 TCTGAACCCTTGAAGGAAAATGG + Intergenic
1137917684 16:52450657-52450679 TCTGACCTATTGCAGGATGATGG + Intronic
1138437967 16:57016804-57016826 TCTGAATTGGAGGAGGAAGAGGG + Intronic
1138915361 16:61456704-61456726 TCTGAAATCTGGAAGGAAAATGG - Intergenic
1139870525 16:70104901-70104923 CCTAAATTATTGAAGGTAAAAGG + Intergenic
1140034230 16:71360359-71360381 TATGAATTACTGATGGAAGTGGG + Intronic
1142786872 17:2231364-2231386 CCTGAATTACAGAAGGTAGAGGG - Intronic
1143100992 17:4504652-4504674 CCTGAAATCTTGAAGGTAGAAGG + Intronic
1143393998 17:6577300-6577322 TCTGAATTAATGAAAGGTGAAGG - Intergenic
1143449837 17:7029486-7029508 GCAGAATTAAAGAAGGAAGAAGG + Exonic
1144288296 17:13800752-13800774 ATAGAATTATTGAAGGCAGAAGG - Intergenic
1144382391 17:14715036-14715058 TCTGAATTCTAGAAGGGAAAGGG - Intergenic
1145024161 17:19455213-19455235 GGTGAATGTTTGAAGGAAGAGGG - Intergenic
1146530456 17:33603809-33603831 TCAGCATTACTGAAGGCAGAAGG + Intronic
1148018379 17:44538421-44538443 TAGGATTTATGGAAGGAAGAGGG - Intergenic
1149162566 17:53711759-53711781 ACTAAATTATTAAATGAAGAAGG + Intergenic
1149205281 17:54237204-54237226 TCTTAAAAATTGAAGGAATAGGG + Intergenic
1150261277 17:63793722-63793744 TGTGAAAAATTGGAGGAAGATGG - Intronic
1153267083 18:3281953-3281975 TGTAAATTAATGAAGGAAGGAGG - Intergenic
1155366473 18:25054208-25054230 TCAGATTTTATGAAGGAAGAGGG + Intergenic
1155412101 18:25557744-25557766 TCTGAAATAGTGGAGGTAGAGGG + Intergenic
1156937823 18:42732492-42732514 CCAGTATTTTTGAAGGAAGACGG + Intergenic
1158762857 18:60411108-60411130 CCTGGAATATTGAAGGGAGAAGG + Intergenic
1161676869 19:5655901-5655923 GTTTAATTATTGAAGGAAAAAGG + Intronic
1163468621 19:17484136-17484158 CCTGAATGAATGAAGGAAGGAGG + Intronic
1164284176 19:23796825-23796847 GCTAGATTAATGAAGGAAGAAGG - Intronic
1166482410 19:43185359-43185381 TCAGAAGTGTTGAAGGAATAGGG - Intronic
1166534935 19:43567223-43567245 TCTGAATTAGAGAATGGAGATGG + Intronic
1168116747 19:54225399-54225421 TCAGAATGAAAGAAGGAAGAAGG + Intronic
925609583 2:5692268-5692290 TCCGAGTTAATAAAGGAAGATGG + Intergenic
926547990 2:14265911-14265933 ACTGAACTATTGAAGTAAAATGG + Intergenic
927104407 2:19811174-19811196 GCTTATTGATTGAAGGAAGATGG - Intergenic
927293620 2:21428274-21428296 TCTGAGTTGTTGATGGAAGAAGG - Intergenic
927615752 2:24593036-24593058 TTTGAATTAATGAGGGAAAAAGG + Intronic
928456373 2:31426425-31426447 CCTGAAACATGGAAGGAAGATGG + Intergenic
928702133 2:33909766-33909788 TCTGAAGAAATGAAGTAAGATGG + Intergenic
929765620 2:44841690-44841712 TTTGAATTAATGAAGGGAGCAGG + Intergenic
929835960 2:45399888-45399910 TGTGAATGTTTGAAAGAAGAGGG + Intronic
930202700 2:48560315-48560337 TCTGAATTCTCAAAGGAAGCTGG - Intronic
930602412 2:53457503-53457525 TTGGGATTTTTGAAGGAAGAAGG - Intergenic
932150236 2:69364252-69364274 ACTGAAATATTGAAGGCAAATGG + Intronic
932589076 2:73052689-73052711 TCTTAATTATGGACCGAAGATGG - Intronic
933507446 2:83196430-83196452 TTTGAATTATTGCAGAAAGAGGG - Intergenic
933798448 2:85940665-85940687 TCTGAATTATTGGCCGAGGATGG - Intergenic
933917424 2:87010007-87010029 TCAGAATTATTGAAGTAACATGG + Intronic
934005572 2:87759911-87759933 TCAGAATTATTGAAGTAACATGG - Intronic
935528783 2:104206456-104206478 TGTGAATTATTTAAAGAAGAGGG - Intergenic
935768529 2:106394004-106394026 TCAGAATTATTGAAGTAACATGG - Intronic
935911572 2:107901924-107901946 TCAGAATTATTGAAGTAACATGG + Intergenic
937372176 2:121306473-121306495 TCTGACTTATGGAAAGAAGCTGG - Intergenic
940104808 2:150086870-150086892 TATGAATTAATTAAGGGAGAAGG - Intergenic
940278595 2:151965929-151965951 TCAGAATCTTTGAAGGAAGCAGG - Intronic
940495073 2:154417210-154417232 ACTTAATTATTTAAGGAAGGTGG - Intronic
940620040 2:156100800-156100822 AATGAATTATCGAAGGGAGAAGG - Intergenic
941237250 2:162990023-162990045 TCTGAGTCATTGAAGAAAGGTGG + Intergenic
942785233 2:179693327-179693349 GCTGAATGACTGAAGGGAGAAGG + Intronic
943758182 2:191580100-191580122 TCTGTATTTTTAAAGGAATATGG + Intergenic
944716308 2:202378026-202378048 TCTGAATAATGAAAGGAACATGG - Intronic
945642960 2:212453354-212453376 TCTCCATTTTTGAAGGCAGAAGG - Intronic
946836151 2:223774543-223774565 TCTGGTTTTTTTAAGGAAGATGG + Intronic
946942752 2:224786771-224786793 TCTAACTTCTTGAAGAAAGAGGG - Intronic
947293446 2:228603470-228603492 TGTGAATTATTGTAGTAAGAGGG + Intergenic
947855345 2:233320238-233320260 TCTGGACGAATGAAGGAAGAAGG - Intronic
948648285 2:239422721-239422743 GCTGAATTTTTCAAGGAGGACGG + Intergenic
1169479388 20:5964346-5964368 TCTTAATTTTTCAGGGAAGAAGG - Intronic
1173057164 20:39625841-39625863 TATGAAAGATTGTAGGAAGAAGG - Intergenic
1173785292 20:45788766-45788788 ACTGAATAATTAAAGGAGGAGGG + Intronic
1175457331 20:59125308-59125330 TCTGAATTGTTGAAACAATAAGG - Intergenic
1176897768 21:14402902-14402924 CTTGAATTATTTAAGGAAAAGGG + Intergenic
1177601705 21:23323788-23323810 TTTGAATTAATGAAGAAAGATGG + Intergenic
1179077137 21:38133076-38133098 CCTCAATTATAGAAAGAAGAAGG + Intronic
1182217746 22:28733349-28733371 TCTGCATTTTTCTAGGAAGAGGG + Intronic
1184423676 22:44396441-44396463 CCTGAATTATAGAAGGATGCTGG - Intergenic
950328011 3:12131015-12131037 TCTGAATTATAGAAGGAGTAGGG + Intronic
950942686 3:16909790-16909812 TCTGAATTATTCAAAAAAGATGG - Intronic
951002555 3:17580760-17580782 TGTAAATGTTTGAAGGAAGAGGG - Intronic
951110859 3:18802152-18802174 TCTGATCTATGAAAGGAAGAAGG + Intergenic
951575453 3:24108710-24108732 TCTTGACTATTGAAGGGAGAAGG - Intergenic
952022782 3:29042537-29042559 TCTGAAAAATGGAAGGAAGAAGG - Intergenic
952082046 3:29771321-29771343 TTTGAATTGTTTAAGGAAGATGG - Intronic
953855378 3:46495740-46495762 TCTCAACTAGTGAGGGAAGAAGG - Intergenic
955605458 3:60697215-60697237 TATCAATTAATGAAGGAAAATGG + Intronic
955610886 3:60755880-60755902 TTTGAATCATTTAAGGAAAAAGG + Intronic
957264697 3:77948149-77948171 TCCTAAATATTGAAGCAAGAGGG - Intergenic
957327359 3:78713669-78713691 TCTGGATTATGGATGGAAAAGGG + Intronic
957481119 3:80795754-80795776 TCTGAATCCTTGAAGAAAGACGG - Intergenic
957632543 3:82736490-82736512 ACTGAATGATGGAAGAAAGAAGG + Intergenic
957913920 3:86661527-86661549 TGTGAATTTTTGAAGGCAAAGGG - Intergenic
958020282 3:87986220-87986242 TCTAAATTAATAAAGGTAGATGG + Intergenic
958500518 3:94901408-94901430 TCAGAATTATTTTATGAAGAGGG - Intergenic
960480918 3:118189168-118189190 TCTGAGTCAGTGAATGAAGAGGG + Intergenic
960882364 3:122357956-122357978 CCTCAACTAATGAAGGAAGATGG - Intergenic
962756678 3:138470140-138470162 TCTGAAGGTTTGATGGAAGAAGG + Exonic
962858557 3:139373740-139373762 ACTGAATTATGGAATGGAGAGGG - Exonic
962910711 3:139847078-139847100 TCTCAACTATTGAAAGAAGGTGG - Intergenic
964239311 3:154573513-154573535 TCTTAGTTAGTGGAGGAAGATGG + Intergenic
964252280 3:154732498-154732520 TCTGATGGATTTAAGGAAGATGG - Intergenic
965506027 3:169515988-169516010 CCTGAATTATTTTGGGAAGAAGG - Intronic
965701791 3:171465511-171465533 TCGGAAGAAATGAAGGAAGAAGG + Intergenic
966222933 3:177568486-177568508 TCTGAATTGTTCAAATAAGAGGG - Intergenic
966627511 3:182034262-182034284 ACTAAAGTATTGTAGGAAGAGGG - Intergenic
967074995 3:185993966-185993988 TTTGAATTTTTGAAAGCAGATGG + Intergenic
967443197 3:189533197-189533219 TCTGAGTGATTGAACAAAGAGGG + Intergenic
967646517 3:191930079-191930101 TCTGAATTACTGAAGGACCAAGG - Intergenic
969954887 4:10878883-10878905 GGAGAATTAATGAAGGAAGAAGG + Intergenic
970173574 4:13313551-13313573 TCTGAATTGTGGAGAGAAGAAGG + Intergenic
970775107 4:19664318-19664340 TCTGAAAAATAGAAGGTAGATGG + Intergenic
971376706 4:26061646-26061668 CATGAATTATTGGAGGAAGTTGG + Intergenic
971589026 4:28443238-28443260 AGTGAATTATTGAAGGAATGAGG + Intergenic
971700539 4:29968448-29968470 TCTAAGTTATTTAAGAAAGAAGG - Intergenic
972238967 4:37168074-37168096 TCTGAGTTCCTAAAGGAAGAGGG + Intergenic
972443612 4:39121096-39121118 ACTAAATTAATAAAGGAAGACGG - Exonic
972931810 4:44081053-44081075 TCTATATTATGGAAGGCAGAGGG - Intergenic
973715705 4:53673951-53673973 TAAGAATTATAGGAGGAAGAGGG - Intronic
974744964 4:66060568-66060590 TCTGAAATATTGCAGAAGGAAGG - Intergenic
974836579 4:67258493-67258515 TCTCAAATAATGAAGGATGATGG - Intergenic
975639488 4:76485083-76485105 TCTGAATTGTTGAAACAGGATGG - Intronic
976653661 4:87463755-87463777 TCTGAATCATTTATGAAAGATGG - Intergenic
977091026 4:92676019-92676041 TCCTAATTATTCATGGAAGAGGG + Intronic
977406346 4:96604122-96604144 TCAGAATTATTGAAGAATAAAGG - Intergenic
977773683 4:100891901-100891923 TCTGAATAATTCTATGAAGAAGG + Intergenic
978269149 4:106868036-106868058 TATGGATTATTGAAGAATGAAGG + Intergenic
979253328 4:118587734-118587756 TCTGAAGTAATCAAGGAAGTGGG - Intergenic
979708974 4:123755253-123755275 TCAGAATTTCTGAATGAAGATGG - Intergenic
979826173 4:125235247-125235269 GGTGAATCATTGAAAGAAGAGGG + Intergenic
980072252 4:128255848-128255870 TATGAAGTATTGAACTAAGAGGG + Intergenic
980461717 4:133124135-133124157 TCTGAATTAATGAAAGAATCAGG + Intergenic
980495234 4:133581033-133581055 TATGAATTACTGAGGGAAAAAGG + Intergenic
981244628 4:142520404-142520426 TATAAATTATTGAAGGAGTAGGG + Intronic
982271300 4:153592019-153592041 TGTGAATTATTTAAGAACGAGGG + Intronic
982567384 4:157002861-157002883 TCTGAATTAGTGAAGCAAAAAGG + Intergenic
982651502 4:158093260-158093282 TCTGAAAGATTGAAGGAGGTTGG - Intergenic
982667578 4:158284898-158284920 TATGAATTTGTGAAGGCAGATGG + Intergenic
982912996 4:161168751-161168773 TCTCCATTATTTAGGGAAGAGGG + Intergenic
982935113 4:161463815-161463837 TGTGAAGTATGGGAGGAAGACGG - Intronic
983409804 4:167381792-167381814 TCTGAAATATTGGAGGTACATGG + Intergenic
985928054 5:3033385-3033407 TGTGAATAATTGATGAAAGAGGG - Intergenic
986240536 5:5955721-5955743 CCTGGATGATTGAAGGAAGGAGG - Intergenic
986295046 5:6430946-6430968 TCTGTCTTATTGAAGGTGGAAGG - Intergenic
986422596 5:7599574-7599596 TCTGAATTATGGAAGGAAGGGGG + Intronic
987638356 5:20577275-20577297 TTTGAATTATTGACGAAAGCAGG - Intergenic
987995573 5:25273357-25273379 TCTGCATCAGTGTAGGAAGAGGG - Intergenic
989342585 5:40392793-40392815 TCTGGAATAGTGAAGGAATAGGG + Intergenic
989493966 5:42089838-42089860 TCTGATTCATTGAAGAAGGATGG - Intergenic
989637775 5:43555681-43555703 TTTGAATTATTGAACTCAGAAGG - Intronic
989740954 5:44771281-44771303 TCTAAAATACTGAGGGAAGAAGG + Intergenic
990199836 5:53359042-53359064 GCAGAATCATTGAAGGAACATGG + Intergenic
990284148 5:54283288-54283310 TCTGTATGATTGAAGGAATTTGG + Intronic
990579958 5:57158648-57158670 TGTTAATTATTGAAAGAAAAGGG + Intergenic
991180076 5:63740276-63740298 TCTGAGATATTAAAGAAAGAAGG + Intergenic
991618804 5:68523917-68523939 TCAGAATCATGGAAGGAAGCTGG + Intergenic
992161733 5:74011005-74011027 AATGAATAAATGAAGGAAGAAGG + Intergenic
992841273 5:80697562-80697584 TCAGTATTATTGAAGGTAAAGGG + Intronic
993918818 5:93774276-93774298 TCTGAATTCTTGAAGGCCGTTGG - Intronic
994044725 5:95295168-95295190 TCTGAATTACAAAGGGAAGAGGG - Intergenic
994412961 5:99432383-99432405 TCTGAACTCATGAAGGAAGAGGG + Intergenic
994480878 5:100333336-100333358 TCTGAACTCATGAAGGAAGAGGG - Intergenic
995020851 5:107365802-107365824 TCTGAATCATTGGAAGGAGAAGG + Intergenic
995111694 5:108436164-108436186 TCTTAATTATTGAAGGTACTTGG - Intergenic
995762265 5:115576040-115576062 TCTGCAAAATTGAAGGATGAGGG + Intergenic
996074620 5:119176433-119176455 AGTGAATTCTTGAAGGATGAGGG - Intronic
998292624 5:140929064-140929086 TCTGAGGTATGGAAGTAAGATGG + Exonic
998437163 5:142120859-142120881 TCTTTGTTCTTGAAGGAAGAGGG + Intronic
998564690 5:143206660-143206682 TCTGAAGTACTGCATGAAGAAGG - Intronic
999428095 5:151504774-151504796 TCTGAATTCTTTAACAAAGAAGG + Exonic
1000116245 5:158156281-158156303 TCCAAAGTATTGAAGGGAGAAGG - Intergenic
1000769007 5:165327799-165327821 TCTGCATTAGTGCAGGAAGTTGG - Intergenic
1002873980 6:1194373-1194395 TCTTATCTATTGATGGAAGATGG - Intergenic
1003975584 6:11340675-11340697 TCTGAATTATTCAAGGTCGATGG - Intronic
1004119160 6:12803221-12803243 TGTGAATTATTGAACGCAGCGGG - Intronic
1004654509 6:17645594-17645616 TCAGCATCATTGAAGGAAGGAGG - Intronic
1006393539 6:33772635-33772657 TCTGAGTCAGAGAAGGAAGAGGG + Exonic
1006720333 6:36145851-36145873 TGTGAGTTCTTTAAGGAAGATGG - Intergenic
1007105384 6:39280068-39280090 CCTGAATGAAGGAAGGAAGAAGG - Intergenic
1007568657 6:42873105-42873127 TCTGAATTATTTAGGGATAATGG - Intergenic
1007836138 6:44675172-44675194 TCTGAATGAATGAATGAACAGGG - Intergenic
1008162027 6:48089920-48089942 TCTGAATCAAAGAAGGCAGATGG - Intergenic
1008714410 6:54271581-54271603 TCTCAATTATTCAGGGAATAGGG - Intergenic
1008799376 6:55347396-55347418 TCTGAATTAAGGGTGGAAGATGG + Intronic
1009863817 6:69370573-69370595 TGTGAAATATGGAAGGAAAATGG - Intronic
1009900314 6:69801181-69801203 TCTGATCTCTGGAAGGAAGATGG + Intergenic
1010211268 6:73364178-73364200 TCTGTATTTTGGAAGGTAGAGGG + Intergenic
1011168424 6:84477529-84477551 TTTTAATTTTTGAAGGTAGAAGG - Intergenic
1011467659 6:87675119-87675141 TGTGAAATAGTGAAGGAGGAGGG - Exonic
1012378254 6:98588504-98588526 TCTGTATTCTTGAAGGAGGACGG + Intergenic
1015137673 6:129891822-129891844 GGTGTATTATTGAATGAAGAAGG + Intergenic
1015576340 6:134675636-134675658 TTTAAATTATTGAAAGAAGGAGG + Intergenic
1015911052 6:138168049-138168071 GCTGAATTAATGAAGTAAGAGGG - Intronic
1016045378 6:139475513-139475535 TGTCAGTTGTTGAAGGAAGAAGG - Intergenic
1016955454 6:149622383-149622405 TCTGAAATATTGAAGGTTAAAGG + Intronic
1016979084 6:149837780-149837802 TATGAATGAATGAATGAAGAGGG - Intronic
1018129369 6:160714162-160714184 TCAGAATTATTGAAGTAACATGG - Intronic
1018430044 6:163714795-163714817 ACAGAATTCATGAAGGAAGAGGG - Intergenic
1018664399 6:166121836-166121858 TCTGAGTGATGGATGGAAGATGG - Intergenic
1020570084 7:9849757-9849779 TCTAAATTATTGAAAACAGAAGG - Intergenic
1021346501 7:19535641-19535663 TCTGAATTATTGAGAAAAAATGG - Intergenic
1021741640 7:23692168-23692190 TCTAAACTATTAAAGGTAGATGG + Intronic
1022460248 7:30598298-30598320 TCTAGATTATTAAATGAAGAGGG + Intronic
1022578075 7:31517900-31517922 TCTGAGTTATGGGAGAAAGATGG + Intronic
1023445831 7:40230655-40230677 TTTGAATTAGTGAATGTAGAAGG + Intronic
1024193743 7:47038610-47038632 CCTGAATTATTAAAAGAAGCAGG - Intergenic
1026700387 7:72637138-72637160 TCTGAACTAATGAAGTGAGATGG + Intronic
1030285203 7:107819022-107819044 TGTGAAAGATAGAAGGAAGACGG + Intergenic
1030600822 7:111589717-111589739 TCTGCAATATTGAAGTAAGTAGG - Intergenic
1030800703 7:113847283-113847305 TATGAATTATTTAGGTAAGAGGG + Intergenic
1030885731 7:114934358-114934380 TCTAAATTCATGAAGGGAGAAGG - Intronic
1033002248 7:137519277-137519299 CCTGCATTATGGACGGAAGATGG + Intronic
1034747155 7:153532965-153532987 TCTGACTAAATGAATGAAGATGG + Intergenic
1035137876 7:156725027-156725049 TTTGAATAATTAAAGTAAGACGG - Intronic
1036921825 8:12863511-12863533 TGTGCATGATTGAAAGAAGAAGG + Intergenic
1041211558 8:55557051-55557073 TCTAATTTATTCTAGGAAGATGG + Intergenic
1041813838 8:61943877-61943899 TGTTACTTATTGGAGGAAGATGG + Intergenic
1042407331 8:68421250-68421272 TCTGAAATCTAGAAAGAAGAAGG + Intronic
1042907618 8:73788383-73788405 TCTGAATAATAAAAGGAAAATGG + Intronic
1044204429 8:89475913-89475935 TGTGAAAGCTTGAAGGAAGAGGG - Intergenic
1045623957 8:104019712-104019734 CCTAAATTATTGCAGGAAAATGG - Intronic
1045830637 8:106456266-106456288 TTTGAATTGTTGGAGGAAGCAGG - Intronic
1046454042 8:114436089-114436111 TCTGAAATATGGAAAGAAGAAGG + Intergenic
1047829998 8:128618712-128618734 GCTGATTTCATGAAGGAAGATGG + Intergenic
1050199030 9:3121717-3121739 TTTTAATTGTTGAAGGTAGAGGG - Intergenic
1050545631 9:6706485-6706507 TCTGAAGTATAGAACAAAGAAGG - Intergenic
1051360363 9:16276693-16276715 TCTAAATTATGGAATTAAGAGGG - Intergenic
1052550575 9:29942258-29942280 TCTTAATTTTTGAAGGCAGCAGG + Intergenic
1052985981 9:34488348-34488370 TCTGAGTTACTGAAAGAAGAAGG + Intronic
1053724487 9:40984971-40984993 ACTGAATTCTTGATGGAAGGTGG - Intergenic
1054341478 9:63867019-63867041 ACTGAATTCTTGATGGAAGGTGG + Intergenic
1055235803 9:74121617-74121639 ATTGAAATATTGAATGAAGAAGG - Intergenic
1056154970 9:83825057-83825079 TCTGAATTTGTGAATGAAGCTGG + Intronic
1056317627 9:85406507-85406529 TCTGAATCAATGCAGGAAGATGG - Intergenic
1056355784 9:85800043-85800065 TCTGAATTTGTGAATGAAGCTGG + Intergenic
1056597386 9:88018942-88018964 TCAAAATTATTGCAAGAAGAGGG - Intergenic
1056726473 9:89123476-89123498 TGAGACTTATTGGAGGAAGAGGG - Intronic
1057408431 9:94794680-94794702 TCTGTATTCTTGAGGGAAGAAGG + Intronic
1058002130 9:99876550-99876572 TATGAATTATTGCTGGAGGATGG + Intergenic
1058089441 9:100787893-100787915 TCTTAAATATTAAAGGAACATGG + Intergenic
1058094824 9:100847548-100847570 TTTGAATGATTGAAGATAGAGGG - Intergenic
1060407616 9:123380709-123380731 TTTGATTTATAGAAGGAAAATGG - Exonic
1060652567 9:125341566-125341588 TATTAATTATTGCAGGAAAATGG + Intronic
1185805956 X:3057424-3057446 TCAGAATTATGGGATGAAGAGGG - Intronic
1186094542 X:6085367-6085389 TCTGACTTACTGAAGGACAATGG - Intronic
1187053121 X:15713909-15713931 TCTGAAATATTCATGGAATAAGG + Intronic
1187671174 X:21667394-21667416 ACTGAACTATTAAAGGAAGCTGG - Intergenic
1188604719 X:32014293-32014315 TCTGTATTATTAAGGGAAAAAGG - Intronic
1189233537 X:39470635-39470657 TTTGGATTCATGAAGGAAGAGGG - Intergenic
1191910790 X:66147225-66147247 TCTGAAAGATAGAAAGAAGAAGG - Intergenic
1193150710 X:78121582-78121604 TCTTGTTTATTGAATGAAGAAGG + Intronic
1194106413 X:89773181-89773203 TCTCAATAGTTTAAGGAAGAAGG + Intergenic
1195169456 X:102251727-102251749 TCTTAAATATTGAGGGATGAAGG - Intergenic
1195189401 X:102435362-102435384 TCTTAAATATTGAGGGATGAAGG + Intronic
1195675593 X:107505034-107505056 GCTGAGTGATTCAAGGAAGATGG + Intergenic
1196323285 X:114369937-114369959 TCTGAAATATTTCATGAAGATGG - Intergenic
1200458374 Y:3421041-3421063 TCTCAATAGTTTAAGGAAGAAGG + Intergenic
1201273094 Y:12274554-12274576 TCAGAATTATGGGATGAAGAGGG + Intergenic