ID: 923199260

View in Genome Browser
Species Human (GRCh38)
Location 1:231695453-231695475
Sequence AGGTGGGTATAGCCGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923199258_923199260 -10 Left 923199258 1:231695440-231695462 CCAGTTATCTGAGAGGTGGGTAT 0: 1
1: 0
2: 1
3: 2
4: 94
Right 923199260 1:231695453-231695475 AGGTGGGTATAGCCGGAAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 89
923199253_923199260 11 Left 923199253 1:231695419-231695441 CCTTATGATGATGCTGTCCATCC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 923199260 1:231695453-231695475 AGGTGGGTATAGCCGGAAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 89
923199251_923199260 16 Left 923199251 1:231695414-231695436 CCCAGCCTTATGATGATGCTGTC No data
Right 923199260 1:231695453-231695475 AGGTGGGTATAGCCGGAAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 89
923199252_923199260 15 Left 923199252 1:231695415-231695437 CCAGCCTTATGATGATGCTGTCC 0: 1
1: 0
2: 0
3: 2
4: 116
Right 923199260 1:231695453-231695475 AGGTGGGTATAGCCGGAAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 89
923199255_923199260 -6 Left 923199255 1:231695436-231695458 CCATCCAGTTATCTGAGAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 131
Right 923199260 1:231695453-231695475 AGGTGGGTATAGCCGGAAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923199260 Original CRISPR AGGTGGGTATAGCCGGAAGT AGG Intronic
902609179 1:17587367-17587389 AGGTGGGCATGGCTGGAACTGGG - Intronic
906491130 1:46269653-46269675 TGGTGGGTATGGCAGGCAGTAGG - Intronic
912037592 1:105339778-105339800 AGGTGGGGATTGCCAGAGGTTGG + Intergenic
921167236 1:212515779-212515801 AGGAGTGTTTAGCCGGAAGGAGG + Intergenic
923199260 1:231695453-231695475 AGGTGGGTATAGCCGGAAGTAGG + Intronic
923207407 1:231772380-231772402 ACGTGGGTAGAGCCGGGAGTGGG + Intronic
923396124 1:233566496-233566518 AGGTGGGGATAGGAAGAAGTTGG + Intergenic
1063981019 10:11451886-11451908 AGGTGGGAACAGACGGGAGTGGG - Intergenic
1070161201 10:73867671-73867693 AGGTGGGTACAGACGGGAATGGG + Intronic
1070657482 10:78281339-78281361 AGGTGGGCATGGCCTGGAGTGGG + Intergenic
1071810643 10:89177268-89177290 AGGTGGGTAGAGGTGGTAGTGGG - Intergenic
1073441588 10:103555595-103555617 AGCTGGGTAGAGCAGGAAGAGGG + Intronic
1079056761 11:17212885-17212907 AGGTGTGAATAGCAGGAGGTGGG + Intronic
1084640106 11:70420724-70420746 AGCTGGGTTTACCTGGAAGTGGG + Intronic
1088550371 11:111006529-111006551 AGATGGGTAGAGGCGGAAGTGGG - Intergenic
1096354070 12:50925286-50925308 AGGTGGGTAGAACTTGAAGTTGG - Exonic
1097250362 12:57629067-57629089 AGGTGGGTACAGCCGAGGGTTGG + Exonic
1103160518 12:118725284-118725306 AGCTGGGTATGGCTGGAATTGGG + Intergenic
1105290982 13:19053244-19053266 AGGTGGGTGAAGCTGGACGTTGG - Intergenic
1106499607 13:30315348-30315370 AGGTGGGTATAGGCAGAAGGAGG - Intergenic
1106501739 13:30335602-30335624 AGGGGGTTCTAGCTGGAAGTTGG + Intergenic
1107738987 13:43428813-43428835 AGGTGGGTAAAGCCACAAGCTGG + Intronic
1113403386 13:110016402-110016424 AGGAGGGTGTGGCAGGAAGTGGG + Intergenic
1125594984 15:40879108-40879130 ATGTGTGTCTAGCTGGAAGTTGG - Intergenic
1129032533 15:72629323-72629345 AGGTGGGTGGGGCCGGAAGGAGG + Intergenic
1129217359 15:74107920-74107942 AGGTGGGTGGGGCCGGAAGGAGG - Intronic
1129407303 15:75328071-75328093 AGGTGGGTGGGGCCGGAAGGAGG + Intergenic
1131998022 15:98151281-98151303 AGGTGGGTGTGGCTGGATGTGGG + Intergenic
1133290928 16:4720541-4720563 AGGTGGGTTCAGTCGGTAGTGGG - Intronic
1138543325 16:57701600-57701622 AGGTGGGTATCGAAGGAAGGGGG + Intronic
1139292151 16:65868770-65868792 AGGTGGGTACAGCCCCAAGGAGG - Intergenic
1144350278 17:14388595-14388617 AGGTGGGGATAGAAGGAAGAGGG + Intergenic
1148205812 17:45779125-45779147 AGCTGGGTATTGAAGGAAGTGGG - Intergenic
1148677975 17:49455960-49455982 AGAGGGGTAGAGGCGGAAGTGGG - Intronic
1150126781 17:62641227-62641249 AGGTGGGTGGATCCGGAAGGTGG + Intronic
1157950134 18:52027404-52027426 AGTTGGGTAGAGCAGGTAGTAGG - Intergenic
1160554645 18:79717458-79717480 TGGTGGGTGCAGCCGGATGTGGG + Intronic
1161019344 19:2000651-2000673 AGGGGGGAACAGCCGGGAGTGGG - Intronic
1161660973 19:5546049-5546071 AGGTGGGGGTGGCAGGAAGTGGG - Intergenic
926488287 2:13491068-13491090 GGGTAGGTGTAGCCAGAAGTTGG + Intergenic
931713314 2:65008278-65008300 CGGTGGGTATAGCTGAAAGCTGG - Intronic
932220550 2:69995734-69995756 AGGTGGGAAGAGCAGGAAGAAGG + Intergenic
933009977 2:77048898-77048920 AGATGGGGATAGCCAGAGGTTGG - Intronic
939654141 2:144801841-144801863 GGGTGGGTATATAAGGAAGTAGG + Intergenic
942750072 2:179277130-179277152 AGGTGGGTAGAGCACCAAGTGGG + Intergenic
943559542 2:189444027-189444049 AGGTGGATATAGCTAGTAGTAGG + Intronic
943947601 2:194088024-194088046 AGGTAGGTGTAGCTGGAAGGTGG - Intergenic
949079934 2:242088681-242088703 AGGCGATTATTGCCGGAAGTGGG - Intergenic
1173626421 20:44476115-44476137 AGGGGGTGACAGCCGGAAGTGGG + Intronic
1175826818 20:61941036-61941058 AGGTGGGAAGAGACGGAGGTGGG - Intergenic
1181102412 22:20550251-20550273 TGATGGGGATAGCCGGAAGCTGG + Intronic
1182844072 22:33416374-33416396 AAGTGGGTAGAACTGGAAGTGGG - Intronic
1184941547 22:47769793-47769815 AGGAGGGCATGGCAGGAAGTGGG - Intergenic
1185153696 22:49180585-49180607 AGGTGGGTTGAGACGGAAGTGGG - Intergenic
949823104 3:8136989-8137011 TGGTGGGTATAGCTGGAGGGTGG - Intergenic
957158829 3:76581951-76581973 AGATGAGTATGGCCTGAAGTAGG + Intronic
958765316 3:98360661-98360683 AGGTGGGTAAAGCATGAAGTGGG - Intergenic
975709923 4:77150854-77150876 AGGTCCTTATAGCTGGAAGTGGG + Intergenic
976016431 4:80560483-80560505 AGGTGGGTAGAGCACTAAGTGGG + Intronic
977867058 4:102041588-102041610 AGGTGGGTAAAGCAGGTAGAGGG + Intronic
978176374 4:105736724-105736746 AAGGGTGTATAGCCAGAAGTTGG - Intronic
981993236 4:150949429-150949451 AAGTGGGTATAGCTGTAAGAGGG + Intronic
983330347 4:166319362-166319384 AGGCTGGTATGGCTGGAAGTGGG - Intergenic
984435554 4:179705969-179705991 AGGTTGCTGTAGCCGGATGTTGG - Intergenic
987547514 5:19331965-19331987 AGGTGTGAATATCAGGAAGTTGG + Intergenic
990980024 5:61593910-61593932 AGGTGGGTATAGAAGGATGGTGG - Intergenic
994616169 5:102107268-102107290 AGGTGGGTAGAGCACTAAGTGGG - Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
999481367 5:151951035-151951057 AGGTGGGTATTGCAGAGAGTTGG + Intergenic
1003264006 6:4550333-4550355 AGGTGGGTGGAGCCCCAAGTGGG - Intergenic
1012030085 6:94048783-94048805 AGGTGAGTCAAGCTGGAAGTGGG - Intergenic
1013936235 6:115598369-115598391 AGGAGAGTATAGCAGGGAGTAGG - Intergenic
1015591517 6:134827256-134827278 AGGTGGGAATGACCTGAAGTTGG + Intergenic
1015594321 6:134851699-134851721 AGGAGGTTATAGCCAGAAGTAGG + Intergenic
1016627803 6:146192867-146192889 AGGTGGGCACAGCTGGAAGAAGG + Intronic
1017281601 6:152631730-152631752 AGGTGGGTATAGGTAGAAGGAGG + Intronic
1022112268 7:27239134-27239156 CGGTGGGGACAGCCGGAGGTGGG - Intergenic
1033833612 7:145282764-145282786 AGGTGGGTAGAGCATCAAGTGGG - Intergenic
1035537972 8:406946-406968 AGGCGGTTATTGCCGGAAGTGGG - Exonic
1038282318 8:26177135-26177157 AGGTGGGTAGATCACGAAGTAGG + Intergenic
1039132455 8:34281922-34281944 AGGTGGGTATTGCCGAAAATTGG - Intergenic
1040531095 8:48266961-48266983 AGGAGGGTAGAGCAGGAAGCCGG - Intergenic
1044206529 8:89497373-89497395 AGGTTGGTAAAGCCTGAAGGAGG - Intergenic
1046211337 8:111080858-111080880 AGGTGGGTAGAGCACCAAGTGGG - Intergenic
1046568873 8:115936950-115936972 AGGAGGGGATACCAGGAAGTTGG - Intergenic
1047275074 8:123399624-123399646 AGGTGGGTATCACCTGAGGTCGG + Intronic
1047380655 8:124359262-124359284 AGGTAGGCATAGCCGGAAGGTGG - Intronic
1048709441 8:137192128-137192150 AGGTGGGTAAAGCCATAAGCAGG - Intergenic
1049009415 8:139877396-139877418 AGGTGGGAAGAGCAGGAGGTAGG - Intronic
1049042063 8:140119911-140119933 AGATGTGTATAGAAGGAAGTAGG - Intronic
1049343849 8:142128129-142128151 AGGAGGACATGGCCGGAAGTGGG + Intergenic
1049405146 8:142449069-142449091 TGGTGGGTGTAGATGGAAGTGGG - Intergenic
1050455618 9:5831883-5831905 AAGTGGGGAAAGCTGGAAGTGGG + Intronic
1053346938 9:37384950-37384972 AGGTGGGTAGAGGCAGGAGTGGG + Intergenic
1058536478 9:105965412-105965434 AGGATGGTATAGCTGGTAGTCGG - Intergenic
1185740336 X:2526867-2526889 AGATGGGTGTAGCAGGAAGAAGG + Intergenic
1187245616 X:17550696-17550718 AGGTGGGCAGAGGGGGAAGTGGG - Intronic
1192924237 X:75738684-75738706 GGGTGGGGATAGCTGGAAGAAGG - Intergenic
1194301084 X:92186682-92186704 AGGGGAGTATAGCCAGAGGTTGG + Intronic