ID: 923201551

View in Genome Browser
Species Human (GRCh38)
Location 1:231717471-231717493
Sequence CAGAGTCAGCAGAGGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1298
Summary {0: 1, 1: 0, 2: 9, 3: 103, 4: 1185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923201551_923201557 -1 Left 923201551 1:231717471-231717493 CCCGCCTCCCTCTGCTGACTCTG 0: 1
1: 0
2: 9
3: 103
4: 1185
Right 923201557 1:231717493-231717515 GTCTCACTGAGCCATAGGCGTGG 0: 1
1: 0
2: 2
3: 15
4: 91
923201551_923201561 12 Left 923201551 1:231717471-231717493 CCCGCCTCCCTCTGCTGACTCTG 0: 1
1: 0
2: 9
3: 103
4: 1185
Right 923201561 1:231717506-231717528 ATAGGCGTGGGGTCCTGCATTGG 0: 1
1: 0
2: 1
3: 3
4: 76
923201551_923201556 -6 Left 923201551 1:231717471-231717493 CCCGCCTCCCTCTGCTGACTCTG 0: 1
1: 0
2: 9
3: 103
4: 1185
Right 923201556 1:231717488-231717510 ACTCTGTCTCACTGAGCCATAGG 0: 1
1: 0
2: 0
3: 6
4: 139
923201551_923201558 0 Left 923201551 1:231717471-231717493 CCCGCCTCCCTCTGCTGACTCTG 0: 1
1: 0
2: 9
3: 103
4: 1185
Right 923201558 1:231717494-231717516 TCTCACTGAGCCATAGGCGTGGG 0: 1
1: 0
2: 1
3: 5
4: 74
923201551_923201559 1 Left 923201551 1:231717471-231717493 CCCGCCTCCCTCTGCTGACTCTG 0: 1
1: 0
2: 9
3: 103
4: 1185
Right 923201559 1:231717495-231717517 CTCACTGAGCCATAGGCGTGGGG 0: 1
1: 0
2: 1
3: 16
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923201551 Original CRISPR CAGAGTCAGCAGAGGGAGGC GGG (reversed) Intronic
900213761 1:1470082-1470104 GAGAGTCAGCAAAGGGTGGTGGG - Exonic
900479402 1:2890833-2890855 CAGAGCCTTCAGAGGGAGCCTGG - Intergenic
900653870 1:3745398-3745420 CTGAGTCGGGAGAGGGAGGCTGG - Intergenic
900721397 1:4178134-4178156 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
901098271 1:6700293-6700315 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
901197404 1:7447780-7447802 CACACTCAGCACAGGAAGGCAGG - Intronic
901210961 1:7525854-7525876 CACGGTCTGAAGAGGGAGGCAGG + Intronic
901300452 1:8196565-8196587 GAGAGGGAGAAGAGGGAGGCAGG - Intergenic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901673927 1:10871977-10871999 CAGAGTCAGCTCAGGGGGACTGG - Intergenic
901964979 1:12859194-12859216 CAGCGATACCAGAGGGAGGCAGG - Exonic
901966648 1:12873791-12873813 TGGAGTCTGCAGAGGCAGGCAGG + Intronic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902043971 1:13512101-13512123 CAGGGTCACAAGTGGGAGGCTGG + Intronic
902488657 1:16764665-16764687 CAGGCTCAGCTGTGGGAGGCTGG + Intronic
902594265 1:17497453-17497475 GAGACTCAGAAGAGGGAGGATGG - Intergenic
902658243 1:17884199-17884221 CAGGGGCTGCAGAGGTAGGCAGG + Intergenic
903034693 1:20486156-20486178 CAGAGGGGGGAGAGGGAGGCAGG + Exonic
903690694 1:25171384-25171406 CAGAGTGAGCAAAGGGACCCTGG - Intergenic
903793487 1:25910630-25910652 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
903931375 1:26864241-26864263 CAGAGGCAGCAGGGGCAGGAGGG - Exonic
903960720 1:27055762-27055784 CAGAGACAGAAGAGTGAGGTGGG + Intergenic
904039907 1:27577684-27577706 CAGAGTCAGTCCAGGAAGGCTGG + Intronic
904575156 1:31500798-31500820 AAGACTCAGAAGGGGGAGGCTGG - Intergenic
904644400 1:31955075-31955097 CAGAGGCAGGGGAGGCAGGCAGG + Intergenic
904804041 1:33118503-33118525 CTGTGACTGCAGAGGGAGGCAGG + Intronic
905332265 1:37213483-37213505 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
905332417 1:37214617-37214639 AAGAGTCAGCAAAGGGAGATAGG - Intergenic
905429880 1:37914055-37914077 AGGAGTCAGCAAAGGGTGGCAGG - Intronic
905610322 1:39344865-39344887 CAGCGACAGCAGAGAAAGGCAGG - Intronic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906049249 1:42857030-42857052 CAGAGTCAGCAAAGGGAGATAGG - Intergenic
906049675 1:42859766-42859788 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
906081390 1:43091044-43091066 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
906150726 1:43585966-43585988 CAGAATTAGCAGAGGCTGGCAGG - Intronic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
906722116 1:48015831-48015853 GAGAGTCACCGGAGGGAGGCTGG - Intergenic
906819698 1:48916389-48916411 CACAGGGAGGAGAGGGAGGCGGG + Intronic
907124387 1:52036497-52036519 CAGAGGCAGAAGAGGGTGGAAGG + Intronic
907822803 1:57987725-57987747 GAGCGCCAGCAGAGGCAGGCAGG - Intronic
907897346 1:58704118-58704140 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
907978479 1:59456990-59457012 CATATTCAGCAGAGAAAGGCTGG + Exonic
908378568 1:63572795-63572817 GAGAGTCAGCAAAGGGAGATAGG + Intronic
908802581 1:67895969-67895991 CAGAGACGGCAGAGAAAGGCAGG - Intergenic
908821641 1:68093206-68093228 TAGAGTCTACAGAGGCAGGCAGG + Intergenic
908887649 1:68808518-68808540 TACAGCCAGAAGAGGGAGGCTGG + Intergenic
909647568 1:77934621-77934643 CAGAGTCCGAAGAGGGAAGAAGG - Intronic
909975472 1:82041732-82041754 CAGACTCATGAGAGGGAGGAAGG + Intergenic
910003055 1:82360255-82360277 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
910816587 1:91297333-91297355 TGGAGTCTGCAGAGGCAGGCAGG - Intronic
910842496 1:91573833-91573855 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
910848509 1:91627542-91627564 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
911158566 1:94659803-94659825 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
911510109 1:98801148-98801170 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
911966632 1:104380426-104380448 GAGAGTCAGCCAAGGGAGGTAGG - Intergenic
911967751 1:104388517-104388539 GAGAGTCAGCCAAGGGAGGTAGG - Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912815602 1:112825756-112825778 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
912844203 1:113064400-113064422 CAGAGGCAGAAGCAGGAGGCAGG + Intergenic
912960109 1:114188563-114188585 CAGACACAGCAGGGGCAGGCTGG + Intergenic
913244867 1:116862692-116862714 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
914196799 1:145451941-145451963 GAGAAACAGAAGAGGGAGGCGGG + Intergenic
914858394 1:151368391-151368413 CAGAGTCAGCAGATAGAAGTAGG - Intronic
915137590 1:153744282-153744304 CAGACTCAGGACAGGGAAGCAGG - Intronic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915805705 1:158847146-158847168 AAGACTCAGAAGCGGGAGGCTGG + Intronic
915869087 1:159538741-159538763 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
915974246 1:160374786-160374808 AAGAGACAAGAGAGGGAGGCAGG - Intergenic
916205959 1:162316627-162316649 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
916337175 1:163686005-163686027 CAGAGTCTGCAAAGGGAGCAAGG + Intergenic
916648898 1:166816813-166816835 CTGAGCCAGCAGGGGAAGGCGGG + Intergenic
916915400 1:169401190-169401212 TAGAGTCTACAGAGGCAGGCAGG - Intronic
916942305 1:169688606-169688628 TAGAGTCAGCAAAGGGAGATGGG - Intronic
917092951 1:171372268-171372290 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
917095889 1:171398498-171398520 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
917111747 1:171556031-171556053 CAGAGTCTACAGAGTCAGGCAGG + Intronic
917207886 1:172596887-172596909 CGGAGTCTACAGAGGCAGGCAGG + Intronic
917336126 1:173926086-173926108 GAGAAACAGCAAAGGGAGGCTGG + Intergenic
917707257 1:177647105-177647127 AGCAGTCAGCAGAGGGGGGCAGG + Intergenic
917749382 1:178040554-178040576 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
917750190 1:178045811-178045833 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
917794766 1:178525305-178525327 CAGAGTAGGCATGGGGAGGCAGG - Intronic
918002434 1:180510084-180510106 GAGACTCAGCAGGGGGAGGGTGG - Intergenic
918177819 1:182060780-182060802 CAGGGACAGCAAAGGGATGCTGG + Intronic
918567174 1:185948374-185948396 GAGAGTCAGCAAAGGGAGATAGG + Intronic
918568039 1:185953859-185953881 GAGAGTCAGCAAAGGGAGATAGG + Intronic
919190111 1:194205438-194205460 AAGAGTCAGTAGAGGGAAGTGGG + Intergenic
920907750 1:210187901-210187923 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
920908878 1:210195559-210195581 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
921238537 1:213153128-213153150 CTGAGTCAGGAGAGTCAGGCAGG + Intronic
921360841 1:214329840-214329862 CAGAGGCAGCTGAGGGAGGCAGG + Intronic
922406704 1:225321820-225321842 CAGAGTCAGGGGAGGAAGGGTGG - Intronic
922550953 1:226493960-226493982 CAGTGTCTCCAGAGGGAGTCAGG - Intergenic
922598711 1:226833824-226833846 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
922599412 1:226838286-226838308 AGGAGTCAGCAAAGGGAGACAGG - Intergenic
922743049 1:228026613-228026635 GAGACTCAGAAGAGGGAGGTTGG - Intronic
922790072 1:228306401-228306423 CAGAGTCTGCAGGCGGAGGAGGG + Exonic
922845724 1:228682450-228682472 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
923074892 1:230601529-230601551 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923444419 1:234055256-234055278 TAGAGTCTACAGAGGCAGGCAGG + Intronic
923450360 1:234111658-234111680 TGGAGTCAGCAGAGGGAGCATGG - Intronic
923531783 1:234817852-234817874 CAGGCTCAGCTGTGGGAGGCTGG - Intergenic
923956763 1:239031145-239031167 GAGAGTCAGCAAAGGGAGACAGG - Intergenic
923963270 1:239106947-239106969 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
924145517 1:241070675-241070697 CAGAGACAGTGCAGGGAGGCTGG + Intronic
924180304 1:241434174-241434196 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
924181174 1:241439767-241439789 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
924259003 1:242210752-242210774 GAGAGTCAGCAAAGGGAGATAGG - Intronic
924433189 1:244015035-244015057 CAGTGACGGCAGAGGGAGCCAGG + Intergenic
924697884 1:246419240-246419262 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
924719984 1:246613702-246613724 TAGACTCAGAAGAGGGAGACGGG - Intronic
924743723 1:246813491-246813513 GAGAATCAGCAAAGGGAGACAGG - Intergenic
1062785091 10:257973-257995 CAGGGTGAGCAGAGGCTGGCTGG + Intergenic
1062930493 10:1349303-1349325 GAGAGTCAGCGAAGGGAGGTAGG - Intronic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1064145823 10:12825708-12825730 CAGTGTCAGCTGAGGGATTCTGG - Intronic
1064506647 10:16038166-16038188 GAGACTCAGAAGAGGAAGGCTGG + Intergenic
1065282959 10:24158825-24158847 CAGAGTTAGCAGAGTGCTGCTGG + Intronic
1065961290 10:30736282-30736304 TATAGTCAGCAGACGGTGGCTGG - Intergenic
1066437617 10:35408391-35408413 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1067098947 10:43320908-43320930 AAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1067360064 10:45571454-45571476 GAGAGTCAGCAAAGGGAGAAAGG - Intronic
1067360773 10:45575971-45575993 AAGAGTCAGCAAAGGGAGAAAGG - Intronic
1067409830 10:46054649-46054671 AAGAGTCAGCAAAGGGAGATGGG + Intergenic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1067753311 10:48985854-48985876 CAGAGGCAGCAGAGGTAGCCAGG + Intergenic
1067850784 10:49752388-49752410 GAGAGTGAGCCCAGGGAGGCAGG + Intronic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068360528 10:55971782-55971804 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
1068361218 10:55976640-55976662 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1068472280 10:57480426-57480448 CAGAGTCAGAAGTGGTAAGCTGG + Intergenic
1068522608 10:58094177-58094199 GAGAGTCAGCAGACGGAGATAGG + Intergenic
1068576218 10:58687469-58687491 TGGAGTCTACAGAGGGAGGCAGG + Intronic
1068918148 10:62455205-62455227 TGGAGACAGCACAGGGAGGCTGG + Intronic
1069628700 10:69883850-69883872 AAGAGACTGCAGTGGGAGGCTGG + Intronic
1069712565 10:70499450-70499472 CAGAGCCCGCAGTGTGAGGCTGG + Intronic
1069879547 10:71583268-71583290 CTGAGGCCGCAGAGGGAGGCAGG + Intronic
1070701044 10:78601975-78601997 CAGTGCCAGGAGAGGCAGGCAGG - Intergenic
1070797933 10:79227944-79227966 GAGAGCTGGCAGAGGGAGGCTGG + Intronic
1070799557 10:79237191-79237213 CAGAGTAAGCCGAGGGGGACTGG + Intronic
1071187801 10:83063247-83063269 GAGAGTCAGCAAAGGGAGACAGG - Intergenic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1071550287 10:86561335-86561357 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1071915887 10:90295297-90295319 AAGAGTCAGCAAAGGGAGGTAGG - Intergenic
1071916697 10:90300609-90300631 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1071960766 10:90807622-90807644 GAGAGTCAGCAAAGGGAGATAGG - Intronic
1071961618 10:90813143-90813165 GAGAGTCAGCAAAGGGAGATAGG - Intronic
1072010801 10:91301443-91301465 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
1072529845 10:96308687-96308709 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1072885014 10:99265265-99265287 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1072971286 10:100020006-100020028 CTGAGACTGCAGGGGGAGGCAGG + Intergenic
1073014656 10:100388279-100388301 GAGAGTCAGCAAAGGGTGGTAGG - Intergenic
1073100095 10:101001994-101002016 GAGGCCCAGCAGAGGGAGGCAGG + Exonic
1073122890 10:101132897-101132919 CAGGGCCAGCAGAGGAAGGCGGG - Intronic
1073441287 10:103554178-103554200 CAGAGGGGGAAGAGGGAGGCTGG - Intronic
1073683268 10:105727885-105727907 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1074438278 10:113453008-113453030 GAGAGTCAGCTGAGGGAGGAAGG - Intergenic
1074496702 10:113985924-113985946 CAGAGGCAGGAGAGAGAGACAGG + Intergenic
1074540625 10:114362555-114362577 TAGAATCAGCAGAGGGAGCGCGG + Intronic
1074739480 10:116470966-116470988 GAGAGACAGCAGGGGGAGCCAGG + Intronic
1075121681 10:119669255-119669277 CAGAGGCAGCATAGGGAGAGAGG - Intronic
1075619473 10:123915189-123915211 CAGAGTCAGATGTGTGAGGCAGG - Intronic
1075894694 10:125984637-125984659 CAGAGTCATCAGCATGAGGCTGG + Intronic
1076209323 10:128627773-128627795 CAGGGTCAGCAGGGGCACGCTGG + Intergenic
1076221284 10:128734956-128734978 CAGGGTCAGAAGAGGGAGCACGG + Intergenic
1076568227 10:131413209-131413231 CAGAGTCAGCTGGTGGAGGCTGG + Intergenic
1076832674 10:133004496-133004518 AAGAGTCAGCAAAGGGAGCTAGG - Intergenic
1077288735 11:1779154-1779176 CAGAGCCAACAGAGAGAGGCAGG - Intergenic
1077765908 11:5160390-5160412 GAGAGTCAGCAAAGGGAGATAGG + Intronic
1077766729 11:5165801-5165823 GAGAGTCAGCAAAGGGAGATAGG + Intronic
1077883072 11:6366321-6366343 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1077883879 11:6371543-6371565 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1077937391 11:6802138-6802160 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1078002945 11:7512735-7512757 CACAGCCAGCAGGGGAAGGCTGG - Intergenic
1079516207 11:21272445-21272467 TAGAGTCTACAGAGGCAGGCAGG - Intronic
1079611033 11:22432746-22432768 CAGGGTCTGCGGCGGGAGGCGGG + Intergenic
1079700670 11:23541993-23542015 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1079786538 11:24680276-24680298 CAGAAGCAGCACAGGGAAGCTGG - Intronic
1079835330 11:25326892-25326914 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1079873775 11:25831816-25831838 TAGAGTCTACAGAGGCAGGCAGG - Intergenic
1080027419 11:27629165-27629187 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1080028259 11:27634572-27634594 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1080617269 11:33955571-33955593 AAGAGCCAGCTGATGGAGGCAGG - Intergenic
1081008213 11:37774502-37774524 CGGAGTCAGCAAAGGGTGGTGGG - Intergenic
1081567946 11:44271113-44271135 CAAACACAGCAGAGGCAGGCAGG + Intronic
1081593598 11:44444209-44444231 GAGAGGCAGCCGTGGGAGGCGGG + Intergenic
1081768270 11:45628092-45628114 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1081810357 11:45910778-45910800 CACAGTCAGGAGAGGAAGTCGGG - Intronic
1082098801 11:48154297-48154319 GAAAGTGAGCAGAGGGAGACGGG + Intronic
1082284189 11:50301781-50301803 AAGAGGCAGCAGAGGGAGCAGGG - Intergenic
1082579082 11:54844492-54844514 CAGAGTCAGCAAAGGGAGATAGG + Intergenic
1082632611 11:55559683-55559705 AAGAGTCAGCAAAGGGAGAAAGG - Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082879586 11:58024857-58024879 CAGAGTCAGGGCAGGGAGCCAGG + Intronic
1083270421 11:61569500-61569522 CTGGGGCAGCAGAGGGAGCCAGG + Intronic
1083324743 11:61867494-61867516 CAGAGGCAGCAGGGAGAGGCGGG - Intergenic
1083353051 11:62044813-62044835 AAGAGTCAGCAAAGGGAGATGGG + Intergenic
1083534260 11:63454084-63454106 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
1083543214 11:63529412-63529434 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1083700872 11:64476985-64477007 CAGCCTCAGCAGAGGGGGGTAGG - Intergenic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084189457 11:67492367-67492389 CAGAGGCACCTGAGGCAGGCTGG + Intronic
1084201006 11:67558328-67558350 CAGAGAGAGCAGGGGGAGCCTGG - Intergenic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084353709 11:68623084-68623106 AAGAGTCAGCAAAGGGAGATGGG - Intergenic
1084355233 11:68634055-68634077 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
1084357886 11:68651721-68651743 CAGGGACCGCAGAGGGAGGGAGG + Intergenic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084493513 11:69490835-69490857 CAGAGTCTGGAAAGGGAGGTGGG - Intergenic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG + Intronic
1085094960 11:73753002-73753024 CAGAGTCAGGAGCTTGAGGCGGG + Intronic
1085409538 11:76283033-76283055 CAGAGTCAGCAGCAGGGGCCAGG - Intergenic
1085696008 11:78705274-78705296 CAGAGTCAGTGGAGGGAGAGAGG + Intronic
1085934763 11:81127373-81127395 GAGAGTCAGCGAAGGGAGACAGG - Intergenic
1085987686 11:81806451-81806473 AAGAGTCAGCAAAGGGAGATAGG - Intergenic
1085988584 11:81812562-81812584 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1086027286 11:82309162-82309184 CAAGGTCAGGGGAGGGAGGCAGG - Intergenic
1086125568 11:83345281-83345303 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
1086132831 11:83419429-83419451 AAGAGTCAGCGAAGGGAGACAGG - Intergenic
1086301003 11:85426179-85426201 TAGAGTCTACAGAGGTAGGCAGG - Intronic
1086504887 11:87494768-87494790 GAGAGTCAGCAAAGGGAGTTAGG + Intergenic
1086549930 11:88043685-88043707 AAGAGTCAGCAAAGGGAGATGGG - Intergenic
1086550806 11:88049516-88049538 GAGAGTCAGCGAAGGGAGACAGG - Intergenic
1087098784 11:94346008-94346030 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1087103203 11:94384741-94384763 TGGAGTCTACAGAGGGAGGCAGG - Intronic
1087129937 11:94660026-94660048 CAGGGTCAGGGGAGGGAGTCGGG - Intergenic
1087168169 11:95024696-95024718 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1087718875 11:101639399-101639421 TGGAGTCTGCAGAGGTAGGCGGG - Intronic
1087840183 11:102912276-102912298 AGGAGTCAGCAAAGGGAGACAGG - Intergenic
1088253182 11:107879249-107879271 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
1088550775 11:111010324-111010346 CAGGGCCACGAGAGGGAGGCTGG + Intergenic
1088694463 11:112355033-112355055 GAGAGTCAGGGGAGAGAGGCTGG + Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1089171308 11:116513556-116513578 AAGAGTCTGGAGAGGGAGACAGG - Intergenic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1089790748 11:120941790-120941812 TAGAGTCTGCAGAGAGAGCCTGG + Intronic
1089970961 11:122692956-122692978 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1090901247 11:131033565-131033587 CTGAGTCAGCAGGGGAAGGATGG + Intergenic
1090926455 11:131254624-131254646 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1090993706 11:131844950-131844972 CAGAGTCAGCATAGTGAGACAGG - Intronic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1091673217 12:2467579-2467601 CAGAGACAGCAGGGGGTGGCGGG + Intronic
1091848201 12:3673939-3673961 CAGAAGCAGCAGAGCGAGGTGGG - Intronic
1092275886 12:7060728-7060750 CAGAACCAGGACAGGGAGGCTGG + Intronic
1092416464 12:8293837-8293859 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
1092474954 12:8810463-8810485 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1092925134 12:13265213-13265235 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1093016546 12:14161149-14161171 GAGGGTCAGGAGAGGGAGGGGGG + Intergenic
1093072909 12:14724985-14725007 AGGAGTCAGCAAAGGGAGGTAGG + Intergenic
1093812309 12:23505925-23505947 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1093813123 12:23511218-23511240 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
1093925879 12:24907825-24907847 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
1094316384 12:29140450-29140472 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1094329444 12:29275160-29275182 GAGAGTCAGCGAAGGGAGACAGG + Intronic
1094606995 12:31957763-31957785 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1094710451 12:32956711-32956733 CAGAGCCTACAGAGGCAGGCAGG - Intergenic
1094723684 12:33090516-33090538 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1094826615 12:34274140-34274162 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1096154601 12:49334986-49335008 CACAGGCTGCAGAGGGAGGTTGG - Intronic
1096622725 12:52874452-52874474 CTGACTCAGCAGGGGGAGCCTGG + Intergenic
1096906653 12:54942634-54942656 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1096907446 12:54948073-54948095 GAGAGTCAGCAAAGGGAGATAGG + Intronic
1097124892 12:56766196-56766218 GAGAGTCAGCAAAGGGAGATGGG - Intronic
1097173940 12:57132138-57132160 CTGGGACAGAAGAGGGAGGCAGG - Intronic
1097398222 12:59101958-59101980 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1097592105 12:61587364-61587386 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1097592898 12:61592815-61592837 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1097690527 12:62730141-62730163 GAGAGTCAGCAAAGGGAGATAGG - Intronic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1098638941 12:72817101-72817123 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1098654159 12:73007412-73007434 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
1099291616 12:80783218-80783240 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1099292428 12:80788583-80788605 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1100263810 12:92957145-92957167 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
1101345144 12:103879534-103879556 CTGAGGCTGCAGAGGCAGGCAGG - Intergenic
1101387534 12:104271143-104271165 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1101395715 12:104345324-104345346 CAGAGCCAGCTGTGGTAGGCTGG + Intronic
1101401740 12:104394157-104394179 TGGAGTCTGCAGAGGCAGGCAGG + Intergenic
1101436256 12:104667326-104667348 CACAGTGAGCTGAGTGAGGCTGG - Intronic
1101593426 12:106141975-106141997 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1101904817 12:108816670-108816692 CAGAGTCTGCCAAGGGAAGCAGG - Intronic
1101914437 12:108885243-108885265 CTAAGTCTGCAGAGGGAGTCAGG + Intronic
1102117064 12:110410798-110410820 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1102455282 12:113067025-113067047 CACAGACAGCAGTGGCAGGCCGG + Intronic
1102548674 12:113674961-113674983 GAGAGGTGGCAGAGGGAGGCCGG - Intergenic
1102742797 12:115223040-115223062 CAGAGTCAGCAGACGGTGGGTGG + Intergenic
1102780700 12:115562167-115562189 CAATGTCAGCACAGGCAGGCAGG + Intergenic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103922247 12:124405109-124405131 TAGAGTCTGGAGTGGGAGGCAGG - Intronic
1104258159 12:127157949-127157971 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1104579189 12:129997297-129997319 CAGAGGTAGCAGAGGAAGGAAGG + Intergenic
1104877911 12:132049321-132049343 AAGAGTAAGCAAAGGGAAGCAGG - Intronic
1104914767 12:132258904-132258926 CAGAGGCTGCAGTGAGAGGCTGG + Intronic
1104917882 12:132275354-132275376 CAGAGCCAGGAGAGGTTGGCTGG + Intronic
1105332360 13:19429691-19429713 CAGAGTCGGGAGGGGGTGGCAGG + Intronic
1105418308 13:20232018-20232040 CAGAGCCGGCAGAGCGCGGCCGG - Intronic
1105701776 13:22939978-22940000 CAGGGTCCCCAGAGGAAGGCGGG + Intergenic
1106445756 13:29829288-29829310 TAGAGTCTACAGAGGCAGGCAGG + Intronic
1106495768 13:30272980-30273002 CAGAGTCACAGTAGGGAGGCAGG - Intronic
1107276935 13:38688529-38688551 CAGAGTCTTCAGAAGGGGGCTGG - Exonic
1107417310 13:40212573-40212595 CAGAGTCTGTCGGGGGAGGCAGG - Intergenic
1107440478 13:40422980-40423002 CAGACTCCCCAGAGGGAGGAGGG - Intergenic
1107542947 13:41410210-41410232 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1108196655 13:48001879-48001901 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1108419274 13:50232447-50232469 GAGAGTCAGCAGATGGGTGCTGG + Intronic
1108738995 13:53315146-53315168 GAGACTCAGAAGAGGGAGGGTGG + Intergenic
1108804137 13:54132856-54132878 GAGAGTCAGCCAAGGGAGACAGG + Intergenic
1108817606 13:54311125-54311147 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1108912933 13:55578321-55578343 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1108913755 13:55583731-55583753 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1109045473 13:57405683-57405705 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1109498962 13:63213431-63213453 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1109709177 13:66141427-66141449 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1109709975 13:66146700-66146722 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
1110084783 13:71364388-71364410 CAGAGCCATCAGAGAGAGCCTGG - Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110649993 13:77933316-77933338 GAGAGTCAGCGAAGGGAGACAGG + Intergenic
1110729748 13:78866395-78866417 TGGAGTCTGCAGAGGCAGGCAGG - Intergenic
1111769230 13:92575468-92575490 CAGAGCCTGCAGAGGGAACCTGG + Intronic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1113829961 13:113287936-113287958 CTGAGTCTGCTGATGGAGGCTGG - Intergenic
1114303519 14:21399723-21399745 CAGAGTCAGCACAGAAATGCAGG + Intronic
1114562187 14:23601367-23601389 TAGAGTGAAGAGAGGGAGGCTGG - Intergenic
1114770557 14:25425668-25425690 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
1114963046 14:27919239-27919261 GGGAGTCAGCAGAGGGTGGTGGG + Intergenic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115569717 14:34655081-34655103 AAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1115653033 14:35416948-35416970 CAGAGTCAGGAGTGGGAAGAAGG + Intergenic
1115664845 14:35534817-35534839 CAGAGTCTGAAGCGGGCGGCCGG + Exonic
1116490051 14:45495012-45495034 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
1116704395 14:48278565-48278587 GAGAGTCAGCGAAGGGAGACGGG + Intergenic
1116711329 14:48371855-48371877 TGGAGTCTACAGAGGGAGGCAGG + Intergenic
1116727214 14:48575858-48575880 CGGAGTCTACAGAGGCAGGCAGG + Intergenic
1117801648 14:59449670-59449692 GAGAGTCAGCAAAGGGAGATAGG - Intronic
1117981587 14:61347402-61347424 CAGAGAAAGCAGATGAAGGCAGG - Intronic
1118005928 14:61564136-61564158 CAGAGTCAGCACATGCAGGAGGG - Intronic
1118072234 14:62257702-62257724 ATGATGCAGCAGAGGGAGGCAGG + Intergenic
1118415184 14:65528148-65528170 TGGAGTCTGCAGAGGCAGGCAGG + Intronic
1118470987 14:66075181-66075203 CTCAGGCTGCAGAGGGAGGCAGG - Intergenic
1118840017 14:69502862-69502884 CAGAGGGAGCAGAGAGAGGTAGG + Exonic
1119247868 14:73128546-73128568 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
1120250875 14:82060998-82061020 GAGAATCAGCAAAGGGAGACAGG + Intergenic
1120305117 14:82760246-82760268 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1120618715 14:86736945-86736967 GAGAGTCAGCACAGGGAGATAGG - Intergenic
1120661295 14:87254180-87254202 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1121013930 14:90536928-90536950 CAGAGTCCTTAGAGGGAGGCAGG + Exonic
1121063264 14:90937254-90937276 CAGCCTCAGCAGATGGTGGCGGG + Intronic
1121111222 14:91314447-91314469 CAGAGGCTGCAGAGGTGGGCAGG - Intronic
1121389132 14:93559486-93559508 GAGAGTCAGCAAAGGGAGATAGG + Intronic
1121660454 14:95631504-95631526 CAGAGTCAGCAAGTGCAGGCTGG - Intergenic
1121704161 14:95978745-95978767 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1121728028 14:96167096-96167118 CAGAGACTGAACAGGGAGGCAGG - Intergenic
1121826182 14:97011368-97011390 CTGAGACAGCAGAGGACGGCTGG + Intergenic
1121980059 14:98446888-98446910 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1121980831 14:98452311-98452333 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1122179134 14:99943061-99943083 CAGAGTCCCCAGAGTGAGACAGG - Intergenic
1122295054 14:100700812-100700834 CATAGCAAGTAGAGGGAGGCTGG + Intergenic
1122319595 14:100845732-100845754 CAGAGACAACACAAGGAGGCAGG - Intergenic
1122348281 14:101073636-101073658 CTGGGGCTGCAGAGGGAGGCCGG - Intergenic
1122507372 14:102240204-102240226 CAGAGTCAGCAAAGGGAGATAGG - Intronic
1122529013 14:102411625-102411647 GAGAGTCAGCAGAGGGAGATAGG - Intronic
1122536302 14:102465966-102465988 CAGAGTCACCAAATGGGGGCTGG - Intronic
1122544164 14:102513083-102513105 CACAGGCAGTAGGGGGAGGCTGG + Intergenic
1122672411 14:103382871-103382893 CAGAGTTAGCTGTGGGAGGATGG - Intergenic
1122781140 14:104144039-104144061 CAGAGGCTGCACAGCGAGGCTGG - Intronic
1122860195 14:104579116-104579138 CAGACTCAGCAGCGCCAGGCAGG + Intronic
1122878650 14:104680130-104680152 GAGAGTCAGAAGACGGAGGGGGG - Intergenic
1122892050 14:104736569-104736591 CAGGCTCAGCTGAGGGAGACGGG - Intronic
1122946784 14:105014927-105014949 CAGAGTCAGGGGAGGCAGCCAGG - Intronic
1122992062 14:105241126-105241148 CAGAGTCAGCCCCGGGAGGCTGG + Intronic
1123008484 14:105335785-105335807 CAGAGAAAGCTGAGTGAGGCTGG + Intronic
1123218135 14:106831350-106831372 CAGAATCACCAGACGGCGGCTGG - Intergenic
1123882756 15:24690721-24690743 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
1124028279 15:25987020-25987042 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1124621583 15:31277031-31277053 CAGAGTCCACAGAGGCAAGCTGG - Intergenic
1125046404 15:35246140-35246162 GAGAGTCAGCAAAGGGAGATAGG - Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125628886 15:41131698-41131720 GAGAGTCAGCAAAGGGGGGTGGG - Intergenic
1126088479 15:45030907-45030929 CGGAGTCAGCACAAGTAGGCTGG - Intronic
1126154342 15:45551332-45551354 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1126715863 15:51516792-51516814 GAGACTCAGAAGAGGGAGGGTGG - Intronic
1126851849 15:52801871-52801893 TAGAGTCTGCAGAGGGAGGCGGG - Intergenic
1127427117 15:58867468-58867490 CAGAGTCAGCACAGAGGTGCTGG - Intronic
1127449525 15:59103274-59103296 GAGACTCAGAAGAGGGAGGGTGG - Intergenic
1128495442 15:68195888-68195910 TGGAGTCAGCAGAGGGAGCAGGG - Intronic
1128514467 15:68333797-68333819 CAGAGGCTGGGGAGGGAGGCTGG - Intronic
1128600040 15:68988442-68988464 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
1129053358 15:72800875-72800897 CAGAGTCAGACCAGGGTGGCTGG - Intergenic
1129166415 15:73780738-73780760 GAGAGCCAGCAGAGGCAGGGGGG + Intergenic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129238433 15:74237614-74237636 CAGAGTCTGCAGGGGGTGGGGGG - Intronic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1129382469 15:75176918-75176940 TAGAGTCTGCAGTGGAAGGCTGG + Intergenic
1129530641 15:76261571-76261593 CAGAGTCCGCAGCTGCAGGCAGG - Intronic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1129699316 15:77758518-77758540 CAGAGCCAGCAGGGGCAGTCAGG + Intronic
1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG + Intronic
1130962791 15:88674681-88674703 CAGAGCCTGCAGAGGGGGGCTGG - Intergenic
1131430076 15:92380253-92380275 CAGACCCACCAGAAGGAGGCTGG - Intergenic
1131447372 15:92511652-92511674 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132146280 15:99431828-99431850 CTGAGGCAGCAGCGGAAGGCAGG + Intergenic
1132240623 15:100254832-100254854 CAGGGCCAGCCGGGGGAGGCGGG + Intronic
1132717844 16:1301063-1301085 CAGGGCCAGCAGGGGGCGGCAGG + Intergenic
1132883356 16:2171932-2171954 CAGAGTGCGGAGAGGCAGGCAGG - Intronic
1133869939 16:9676915-9676937 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1134008226 16:10832680-10832702 CAGAGTCTCCAGTGGGAGGGGGG + Intergenic
1134213082 16:12294521-12294543 GACAGACAGCAGAGGGAGGCGGG - Intronic
1134589640 16:15442032-15442054 AAGACTTAGGAGAGGGAGGCCGG + Intronic
1135407901 16:22211254-22211276 CACAGTCAGCTGAGGAATGCTGG - Intronic
1135639852 16:24109995-24110017 CTGAGTCAGGAGAGTCAGGCAGG + Intronic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1136012447 16:27372588-27372610 AAAGGCCAGCAGAGGGAGGCAGG - Intergenic
1136477714 16:30524052-30524074 CTGAGGAAGAAGAGGGAGGCTGG + Exonic
1136529693 16:30859759-30859781 CAGAATCAGCAAAGGGTGGTGGG - Intronic
1136537309 16:30907598-30907620 CAGGGTCAGCAGGCAGAGGCGGG + Intergenic
1137421247 16:48336517-48336539 GAGAGTCAGCAAAGGGAGATAGG + Intronic
1137471096 16:48759226-48759248 TAGAGTCTACAGAGGCAGGCAGG - Intergenic
1138652804 16:58471404-58471426 CAGAGTGATCAGAACGAGGCTGG - Intronic
1138805583 16:60085542-60085564 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1138956195 16:61973140-61973162 CAGAGTCAGAAGAGGTAGAAGGG - Intronic
1139230093 16:65275353-65275375 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1139310364 16:66023376-66023398 CACAGGCAGCCGAGGGAGGAAGG + Intergenic
1139381855 16:66537444-66537466 CAGAGGCAGGAAACGGAGGCAGG - Intronic
1139467904 16:67164063-67164085 CAGAGTCCGCAGAGGGGTGGAGG - Exonic
1139599511 16:67978154-67978176 AGGGGTCCGCAGAGGGAGGCTGG - Intronic
1139647600 16:68342795-68342817 CACAGCCTGCAGAGGGATGCTGG - Intronic
1140065595 16:71608770-71608792 AAAAGGCAGAAGAGGGAGGCAGG - Intergenic
1140535502 16:75705604-75705626 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1140993933 16:80242649-80242671 CTGAGTCAGGAGAGTCAGGCAGG - Intergenic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141571090 16:84934045-84934067 CAGAGTCAGCACTGGGATACCGG - Intergenic
1141703188 16:85651675-85651697 CAGAGTCAGAAGAGGGCTGGAGG - Intronic
1141805684 16:86340064-86340086 CAGAGGCTGGAGAGGGAGGTGGG - Intergenic
1142134158 16:88443989-88444011 CTGAAGCAGCAGGGGGAGGCAGG + Intergenic
1142272342 16:89096729-89096751 CAGAGTCGGCCGAGGGAAGGGGG - Intronic
1142278666 16:89136711-89136733 CAGAGGCAGGTGGGGGAGGCAGG - Intronic
1142539495 17:647080-647102 TGGAGGCAGCAGAGGGAGACAGG - Intronic
1142614006 17:1124702-1124724 CAGAGTGAACAGAGGAGGGCTGG + Intronic
1142615947 17:1135181-1135203 CAGAGTGAGCAGAGGGGGAGAGG + Intronic
1142705411 17:1690508-1690530 CTGAGTCAGGAGAGTCAGGCAGG + Intergenic
1142967529 17:3590703-3590725 TCCAGTCAGCAGGGGGAGGCAGG + Intronic
1143382144 17:6503234-6503256 CAGAGTGAGGGGTGGGAGGCTGG - Intronic
1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG + Intronic
1144104303 17:11972070-11972092 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1144409870 17:14990542-14990564 CAGAGGCACCAGTGGGAGACTGG - Intergenic
1144624558 17:16838152-16838174 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1144663026 17:17083668-17083690 CAGAATCTGCAGGGCGAGGCTGG + Intronic
1144881870 17:18434569-18434591 CAGAGGGAGCAGAGCCAGGCAGG + Intergenic
1145024590 17:19458427-19458449 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1145032896 17:19518708-19518730 GAGAGTCAGCAAAGGGCGGTGGG + Intronic
1145056013 17:19704412-19704434 CAGAAGCAGCACAGGCAGGCGGG + Intronic
1145104306 17:20102538-20102560 CAGAGTCAGCTGAGTGTGGCTGG + Intronic
1145150363 17:20509817-20509839 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1145238733 17:21227088-21227110 CGGAGTCAGAAGAAGGAGGATGG + Intergenic
1145260550 17:21352106-21352128 CCAAGTCAGGAGAGGGAGGAGGG + Intergenic
1146059108 17:29595293-29595315 AAGAGCCAGCAGAGGCTGGCTGG - Intronic
1146162294 17:30566459-30566481 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1146165960 17:30588989-30589011 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
1146447302 17:32942615-32942637 TGGAGTCAGGAGAGGGAAGCTGG + Exonic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1146597548 17:34183505-34183527 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1147235861 17:39057045-39057067 CAGGCTCAGCGAAGGGAGGCTGG + Intergenic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1147574386 17:41590190-41590212 CAGAGTCTTCAGAGGGAGTGTGG - Intergenic
1147632861 17:41943439-41943461 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1147759578 17:42788649-42788671 CAAAGTCAGCAGAGGGGAGAAGG - Intronic
1148546382 17:48522319-48522341 CAGAGCCAACAGGAGGAGGCTGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148754029 17:49963149-49963171 GAGAGACAGCGGAGGGAGGGTGG + Intergenic
1149376982 17:56054005-56054027 GAGAATCAGAAGAGGGAGGGAGG - Intergenic
1149648103 17:58255007-58255029 CAGAGCCAGGAGTGGGAGCCAGG - Intronic
1149648185 17:58255607-58255629 CAGAGCCAGGAGTGGGAGCCAGG + Intronic
1149684657 17:58528426-58528448 TAGAACCAGCAGATGGAGGCTGG + Intronic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1150070746 17:62147829-62147851 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1150130731 17:62667290-62667312 CCGAGGGAGCAGAGGGAGGTAGG + Intronic
1150456887 17:65313425-65313447 CAGTGTCTGCAGAGTGGGGCTGG - Intergenic
1150781063 17:68122549-68122571 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
1150819258 17:68421905-68421927 CAGAGTGAGCAGGGAGAGGCTGG + Exonic
1150860406 17:68795550-68795572 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151560330 17:74866392-74866414 CAGGGGCTGCAGAAGGAGGCCGG - Intronic
1151803050 17:76388954-76388976 AGGAGACAGCTGAGGGAGGCTGG - Intergenic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1152259546 17:79259674-79259696 CAGGCTCAGCAAAGGGAGCCCGG - Intronic
1152302965 17:79506216-79506238 CAGAGCCAGAAAAGGGAGGAGGG + Intronic
1152370949 17:79888325-79888347 GAGAGTCAGCTGAGAGACGCTGG - Intergenic
1152520959 17:80856625-80856647 CTGAGTCATCGGAGGAAGGCTGG + Intronic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1152804025 17:82346465-82346487 AAGAGTCAGCAAAGAGAGGTAGG + Intergenic
1152945692 17:83196302-83196324 CAGAGCCACCAAAGGCAGGCAGG - Intergenic
1153025550 18:669242-669264 CAGAGGCACCTGAGGGAGGCAGG + Intronic
1153402395 18:4695191-4695213 TGGAGTCTGCAGAGGCAGGCAGG - Intergenic
1153577706 18:6539335-6539357 CAGAGCCAGGAGAGAGAGGAGGG + Intronic
1153834839 18:8954643-8954665 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1153993898 18:10423191-10423213 CAGAGTCTGTGGAGGGCGGCTGG - Intergenic
1155174380 18:23289929-23289951 GAGAGTCAGCAAAGGGAGATAGG - Intronic
1155892195 18:31284294-31284316 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1155961689 18:32000827-32000849 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1156252196 18:35361479-35361501 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1156284507 18:35678084-35678106 CTGAGTCAGTAGAGAGAGACTGG + Intronic
1156654765 18:39272137-39272159 TAGTGACAGCAAAGGGAGGCAGG - Intergenic
1156915564 18:42462108-42462130 AAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1156916609 18:42469630-42469652 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1156938305 18:42737321-42737343 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1156939195 18:42744185-42744207 GAGAGTCAGCAAAGGGAGATGGG - Intronic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157779813 18:50428237-50428259 CAGAGCAAGCAAAGGGAGGGAGG + Intergenic
1157896336 18:51471864-51471886 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1157905916 18:51570156-51570178 AAGAGTCAGCAAGGGGAGACAGG + Intergenic
1158046945 18:53167923-53167945 CAGAGTCAGAAGTGTGAGTCAGG + Intronic
1158404904 18:57152282-57152304 CAGAATCAGAAGAGGGAGAATGG + Intergenic
1158532640 18:58277319-58277341 CCGAGGCAGCAGAGAAAGGCAGG + Intronic
1158622386 18:59044280-59044302 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1159164968 18:64687206-64687228 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
1159365101 18:67455620-67455642 AAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1160150066 18:76391885-76391907 CAGAGCCAGCAGGAGGAGGCCGG + Intronic
1160527437 18:79545867-79545889 TAGTGACAGCAAAGGGAGGCAGG + Intergenic
1160775219 19:852410-852432 CAGAGGGAGCAGCGGGAGGTTGG - Intronic
1160857255 19:1223191-1223213 CCGAGTCAGCAGAGCCGGGCAGG - Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1160940515 19:1618519-1618541 CAGAGTGAGGAGAGGGAGAGAGG - Intronic
1161086403 19:2337604-2337626 CATCGTCAGCAGGGAGAGGCTGG + Exonic
1161094420 19:2381313-2381335 CAGGGTCAGCAGAGGCAGCTGGG + Intergenic
1161218484 19:3106559-3106581 GAGAGGTTGCAGAGGGAGGCAGG - Intronic
1161237499 19:3205135-3205157 CACAGTGCCCAGAGGGAGGCGGG - Intronic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1161300023 19:3538025-3538047 CAGAGTGAGGAGAGGAGGGCAGG + Intronic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161416792 19:4151752-4151774 CAGAGTGAGGAGAGGAAGACAGG - Intergenic
1161570902 19:5030452-5030474 CAGAGCCTGCAGAGGGGGGTGGG + Intronic
1161575385 19:5051889-5051911 CAGAGGCAGGAGAGGGTGGGCGG - Intronic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161756428 19:6137456-6137478 CAGAGTGAGGAGGGGGAGGGAGG + Intronic
1161782982 19:6305988-6306010 CAGAGACAGATGAGGGAGTCTGG + Intergenic
1161871608 19:6874845-6874867 AAAAGTCAGAAGAGGGAGCCAGG - Intergenic
1162377983 19:10316317-10316339 CAGAGTCAAGGGAGGGAAGCTGG + Exonic
1163097488 19:15070386-15070408 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1163112596 19:15170507-15170529 CAGTGGCAGCAGCGGGACGCTGG + Exonic
1163632166 19:18423081-18423103 CAGAGTGGGCTGAGGGAGGCTGG + Intronic
1163834264 19:19563554-19563576 CAGAGTCCGCAGGGTGAGGAAGG + Exonic
1163837788 19:19585860-19585882 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
1163943933 19:20518927-20518949 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1164003563 19:21129444-21129466 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1164004326 19:21134877-21134899 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1164080547 19:21858390-21858412 CAGAGCCAGCAAAGGGAGATAGG - Intergenic
1164082085 19:21867271-21867293 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1164219073 19:23177269-23177291 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1164236039 19:23335424-23335446 CACAGTCTACAGAGGCAGGCAGG + Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164748957 19:30636894-30636916 CAGAGTCCGCAGAAGAAGTCAGG + Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165248934 19:34514377-34514399 CAGAGTCAGCGAAGGGAGATAGG - Intergenic
1165374733 19:35433756-35433778 CAGAGGCAGCAGAGCCAGCCTGG + Intergenic
1165645799 19:37434897-37434919 AAGAGTCAGCAAAGGGTGGTGGG - Intronic
1166109647 19:40614221-40614243 GAGAGTCAGAAGGGGGAGGCCGG - Intronic
1166116696 19:40660285-40660307 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1166302753 19:41921689-41921711 CAGAGGCAGGAGAGGGATGCAGG + Intronic
1166498447 19:43323608-43323630 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1166499301 19:43329048-43329070 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1166524153 19:43500746-43500768 CAGACTCAGAAGAGTGAGGTGGG - Intronic
1166905060 19:46102295-46102317 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1166906067 19:46109180-46109202 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1166917123 19:46203074-46203096 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1167169802 19:47823545-47823567 CAGAGGCTGCAGAGAGAGGCTGG + Intronic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1168143242 19:54403557-54403579 CAGAGTCAGTAAAGGGTGGTGGG + Intergenic
1168165701 19:54545951-54545973 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1168212434 19:54900280-54900302 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1168320723 19:55508006-55508028 GACAGTGAGGAGAGGGAGGCAGG + Intronic
1168515647 19:57008545-57008567 TAGAGTCAGGTGAGGGAGGATGG + Intergenic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925304439 2:2838409-2838431 CAGAGTCAGATGGGGAAGGCTGG + Intergenic
925434116 2:3821047-3821069 GAGAGTCAGCAAAGGGAGATAGG + Intronic
925440234 2:3879356-3879378 ATGAGTCTGCAGAGGGAAGCCGG + Intergenic
925800700 2:7597501-7597523 CAAAGTGAGCAGTGGCAGGCAGG + Intergenic
926053771 2:9761706-9761728 CAGAGGCAGGAAAGGGAGGGCGG - Intergenic
926992755 2:18697787-18697809 CAGAGTCTAGAGAGGCAGGCAGG + Intergenic
927408677 2:22800631-22800653 CACAGACAGCAGTGGGAGGAAGG + Intergenic
927424798 2:22970285-22970307 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
927436632 2:23072104-23072126 GAGCGTAGGCAGAGGGAGGCTGG - Intergenic
927463790 2:23322021-23322043 CAGAGTGTGCAGAGGGAGATGGG + Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927506916 2:23620756-23620778 CAGAGGTGGGAGAGGGAGGCAGG + Intronic
927571969 2:24167762-24167784 CAGAGTCCACAGTGGGAGGGAGG + Intronic
927957201 2:27216010-27216032 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
928097524 2:28413565-28413587 GAGAGGCAGGGGAGGGAGGCGGG + Exonic
929004343 2:37381110-37381132 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
929030687 2:37647791-37647813 CACAGCCAGCAAAGGGAGTCAGG - Intronic
929077020 2:38086208-38086230 GAGAGTCAGCCAAGGGAGACAGG + Intronic
929383234 2:41378143-41378165 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
929384305 2:41385597-41385619 GAGAGTCAGCAAAGGGAGGTAGG - Intergenic
929427346 2:41856684-41856706 CAGACGCAGTAGAGAGAGGCAGG - Intergenic
930272951 2:49277869-49277891 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
930487625 2:52027284-52027306 GAGAGTCAGCGAAGGGAGACAGG + Intergenic
930954674 2:57192614-57192636 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
930954788 2:57193377-57193399 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
930958007 2:57227526-57227548 AAGAGTCAGCGAAGGGAGACAGG - Intergenic
931469205 2:62521129-62521151 TGGAGTCTGCAGAGGCAGGCAGG + Intergenic
931530693 2:63210997-63211019 CAGAGTCTACAGAGGCAGGCAGG - Intronic
931536806 2:63286548-63286570 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
931870704 2:66456508-66456530 CAGATTCTGAAGAGGGATGCTGG + Intronic
932158892 2:69443106-69443128 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
932159778 2:69449039-69449061 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
932321357 2:70824097-70824119 CAGAGCCAGGAGAGGGAGAGAGG + Intergenic
932821150 2:74902027-74902049 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
932854532 2:75219182-75219204 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
933163418 2:79051681-79051703 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
933271872 2:80241353-80241375 TAGAGTCAGTTGAGGGAGGAAGG + Intronic
933447299 2:82398370-82398392 GAGAGTCAGCAAAGGGAGACAGG + Intergenic
933556234 2:83834477-83834499 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
933589910 2:84221034-84221056 GAGAGTCAGCGAAGGGAGACAGG + Intergenic
933758289 2:85657735-85657757 AAGAGTCAGCAAAGGGTGGTGGG + Intronic
934474538 2:94585736-94585758 TAGAATCTGCAGAGGGAGGCCGG + Intergenic
935270139 2:101427396-101427418 CAAAGCCAGCAAAGGCAGGCCGG - Intronic
935724972 2:106015747-106015769 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
936068538 2:109349978-109350000 CAGAGTCAGGTGCGGGAGACAGG + Intronic
936286785 2:111187343-111187365 CAGAGTCAGGGGAGGTATGCAGG + Intergenic
936793764 2:116183848-116183870 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
936794542 2:116189395-116189417 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
936823556 2:116553310-116553332 TGGAGTCTGCAGAGGCAGGCAGG - Intergenic
936870544 2:117130878-117130900 GAGAGACAGCAAAGGGAGACAGG - Intergenic
937991531 2:127664786-127664808 CAGAGTCAGCTGAGGAGGACAGG + Intronic
938008946 2:127812967-127812989 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
938165118 2:129019355-129019377 GAGAGTCAGCAGAGAGAAGGGGG + Intergenic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
938697587 2:133848583-133848605 CAGAGACAGCCAACGGAGGCTGG - Intergenic
939249638 2:139667336-139667358 CTGATTCAGCAGAGGGAGAGAGG - Intergenic
939460247 2:142489773-142489795 CAGAGTCAGCAAAGGGAGATGGG + Intergenic
939460999 2:142495033-142495055 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
939788010 2:146540176-146540198 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
940149069 2:150578912-150578934 CTGAGGCTGCACAGGGAGGCAGG + Intergenic
940182685 2:150953622-150953644 GAGAGTCAGCAAAGGGAGTTAGG - Intergenic
940508199 2:154582734-154582756 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
940860847 2:158769281-158769303 AGGAGTCAGGAGAGGGAGGGAGG - Intergenic
941528992 2:166641566-166641588 AGGAGTCAGCAAAGGGAGACAGG + Intergenic
941911182 2:170766148-170766170 CAAAGACAGTAGAGGGAGCCTGG - Intergenic
942172819 2:173304282-173304304 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
942514997 2:176742526-176742548 GAGAGACAGCAGAAGCAGGCTGG + Intergenic
942997009 2:182275138-182275160 GAGGGTCAAAAGAGGGAGGCAGG + Intronic
943072770 2:183161165-183161187 CAGAGTTAGCAGAGTGCTGCTGG + Exonic
943299492 2:186180159-186180181 CAGGGGCAGTAGAGGGAGACAGG - Intergenic
943554257 2:189382687-189382709 AAGAGTCAGCAAAGGGTGGTGGG + Intergenic
943737993 2:191378359-191378381 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
943951599 2:194136238-194136260 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
944034929 2:195283123-195283145 TAGAGACATTAGAGGGAGGCTGG - Intergenic
945064586 2:205938107-205938129 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
945362511 2:208908252-208908274 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
945554443 2:211262063-211262085 GAGAGTCAGCAAAGGGAGTTAGG - Intergenic
946023822 2:216659927-216659949 CAGTGACAGCAGGGGGATGCTGG + Intronic
946076136 2:217075222-217075244 CAGTGTCCGCGGAGGAAGGCTGG - Intergenic
946202190 2:218076807-218076829 GGGAGGCAGCAGAGGGAGGCAGG - Intronic
946394561 2:219436608-219436630 CCAAGTCAGGAGAGGGAGCCGGG + Intronic
946804949 2:223462685-223462707 AGGAGTCAGCAAAGGGAGGTGGG - Intergenic
946893754 2:224302246-224302268 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
947015938 2:225619670-225619692 CACAGACAGCATAGAGAGGCAGG + Intronic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
947925171 2:233914886-233914908 TACAGTCAAGAGAGGGAGGCAGG + Intergenic
947926591 2:233927048-233927070 CAGTGTCAGCAAAGCCAGGCAGG - Intronic
948125676 2:235563276-235563298 CAGACACAGCAAAGGGGGGCAGG - Intronic
948251865 2:236535987-236536009 CTGGGCCAGCAGAGGGAGGTGGG + Intergenic
948284437 2:236772939-236772961 TAGAGTCTGCAGAGGGAGTGCGG - Intergenic
948390316 2:237607078-237607100 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
948391173 2:237612537-237612559 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
948807099 2:240457724-240457746 GAGAGGCAGGAGAGGGAGCCAGG - Intronic
1168943583 20:1733234-1733256 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1169159067 20:3360982-3361004 CAATGACAGCAGAGGGTGGCAGG + Intronic
1169660996 20:7978232-7978254 GAGAGAAAGAAGAGGGAGGCTGG - Exonic
1170068376 20:12340364-12340386 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1170069175 20:12345603-12345625 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1170612143 20:17923379-17923401 CTCAGTCAGCAGTGGGGGGCGGG - Intergenic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1170745752 20:19097583-19097605 CAGAGTGAGAAGAGGGAGAGGGG + Intergenic
1170819712 20:19746566-19746588 TAGAGAAAGAAGAGGGAGGCTGG + Intergenic
1171251581 20:23653107-23653129 CATGGTCACCATAGGGAGGCAGG - Intergenic
1171388870 20:24788185-24788207 GAGACTCAGAAGGGGGAGGCTGG - Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172339470 20:34144838-34144860 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1172643366 20:36455147-36455169 CAGAGTAAGAGGAGGGAGGGAGG - Intronic
1172931936 20:38592491-38592513 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
1172932847 20:38598483-38598505 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1172980148 20:38935382-38935404 CAGGGCCACCAGAGGGTGGCAGG - Intronic
1172982387 20:38953720-38953742 CTAAGTCAGGAGAGGGAGGAAGG - Intergenic
1173162851 20:40664933-40664955 CAGAGTCTGGGAAGGGAGGCTGG + Intergenic
1173478734 20:43382684-43382706 CAGAGTCAGCGAAGGGAGATAGG - Intergenic
1173492314 20:43493019-43493041 CAGAGGCAGCAGAAGAGGGCAGG + Intergenic
1173545491 20:43894685-43894707 GGGAGTGAGCTGAGGGAGGCTGG - Intergenic
1173651712 20:44670572-44670594 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1173652640 20:44676655-44676677 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1173665041 20:44757261-44757283 CAGAGTGAGCAAAGGAAGGGTGG - Intronic
1173869493 20:46332568-46332590 CAGAGGCAGCAGCGGGACTCAGG + Intergenic
1174030630 20:47622704-47622726 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1174194080 20:48760631-48760653 CTGAGCCAGGAGAGGGAGGCTGG + Intronic
1174404084 20:50292590-50292612 AAGAGGCAGGAGATGGAGGCTGG - Intergenic
1174820633 20:53723908-53723930 CAGAGTGAGCAGAGGTAGCCTGG + Intergenic
1174885098 20:54325140-54325162 GAGAGTGGGCAGAGGGAGGTAGG + Intergenic
1174926620 20:54767313-54767335 CAGAGTGAGGGCAGGGAGGCAGG - Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175155234 20:56966847-56966869 TAGAGCCTGCAGAGGGAGGACGG - Intergenic
1175163036 20:57022812-57022834 AAGAGCCAGGAGAGGGAGACAGG - Intergenic
1175736155 20:61388688-61388710 CACAGACAGCAGGGGGATGCTGG + Intronic
1175839071 20:62015167-62015189 CAGACCCAACAGAGGGAGGGTGG + Intronic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176287965 21:5028780-5028802 GAGAGGCAGAAGATGGAGGCAGG + Intronic
1177063170 21:16397830-16397852 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1178001684 21:28166807-28166829 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1178565530 21:33680814-33680836 CAGAGTCAGCACAGCCAGGGTGG + Intronic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1178710411 21:34911748-34911770 CAGAGCAAGCCGAGGGAGACAGG - Intronic
1179062079 21:37988536-37988558 GAGAGTCAGCAAAGGGAGATGGG - Intronic
1179403184 21:41102896-41102918 AGGAGTCAGAAGAGGGGGGCCGG - Intergenic
1179869216 21:44234695-44234717 GAGAGGCAGAAGATGGAGGCAGG - Intronic
1179893006 21:44346601-44346623 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1180573112 22:16748325-16748347 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1180607989 22:17075637-17075659 CAGAGACAGAGTAGGGAGGCAGG - Intergenic
1180667905 22:17529315-17529337 CAGAGCAAGCACAGGAAGGCTGG + Intronic
1180980829 22:19877262-19877284 CGGGGTCAGCACAGGGAGGGGGG + Intronic
1181024542 22:20120552-20120574 CAGAGTCGTCTGAGAGAGGCAGG + Intronic
1181115890 22:20632341-20632363 CAGAGGCTGCAGAGGAGGGCTGG + Intergenic
1181167903 22:20993129-20993151 CAGAGTCAGTGGAGGGAGCCGGG + Intronic
1181174331 22:21027318-21027340 GAGAGAGAGCAGAGGGCGGCAGG + Exonic
1181284024 22:21739344-21739366 CAGAGTTAGCAGAGGGGAGGAGG - Intergenic
1181345022 22:22213424-22213446 GAGAGTTGGCAGAGGGAGGGAGG + Intergenic
1182073071 22:27476957-27476979 CAGAGACAGCAGACAGAAGCAGG + Intergenic
1182155904 22:28072769-28072791 CAGAGGTAGCAGGGGGAAGCCGG + Intronic
1182169223 22:28209678-28209700 TGGAGTCTGCAGAGGCAGGCAGG - Intronic
1182354280 22:29715374-29715396 CAGAGGCAACAGACTGAGGCAGG + Intergenic
1182357583 22:29729277-29729299 GAGAGTCTGCAGAGGGGGGCTGG + Intronic
1182511984 22:30826404-30826426 CCAAGTAGGCAGAGGGAGGCTGG - Intronic
1182731954 22:32503068-32503090 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1182732765 22:32508384-32508406 GAGAGTCAGCAAAGGGAGTAGGG - Intergenic
1183046942 22:35227889-35227911 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1183535045 22:38396634-38396656 AAGAGTCAGCAAAGGGAGATGGG + Intronic
1183546171 22:38455688-38455710 CAGCGCGGGCAGAGGGAGGCGGG - Intergenic
1183583468 22:38738989-38739011 CTGAGACAGGAGAGGAAGGCAGG + Intronic
1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG + Intronic
1183601051 22:38840842-38840864 CAGAGGCAGCAGACAGAGGGAGG + Intronic
1183636437 22:39066191-39066213 GAGAGTCAGCAAAGGGAGATAGG + Intronic
1184030790 22:41893171-41893193 CAGAGCCAGCGCAGGGAGTCAGG - Exonic
1184111532 22:42398314-42398336 CAGTGACAGCAGAGGAAGACTGG - Intronic
1184167823 22:42740919-42740941 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1184541813 22:45130888-45130910 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1184595258 22:45509974-45509996 CAGAGGCAGCTGAGGGCGTCAGG - Intronic
1184795311 22:46728753-46728775 CAGAGTCAGCAGCTGGGAGCTGG + Intronic
1184979155 22:48084035-48084057 GAGGGTCTGCAGAGGCAGGCAGG - Intergenic
1185183972 22:49381607-49381629 CAGAGGAAGCAGAGCCAGGCAGG - Intergenic
1185385736 22:50530663-50530685 CAGAGTCAGGAGAGTGGGGAGGG - Intronic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949610333 3:5697714-5697736 CAGAGGGAACAGAGGGAGTCAGG - Intergenic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
950055574 3:10021550-10021572 CAGAGACAACAGTGGGTGGCAGG - Intergenic
950230319 3:11270578-11270600 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
950448978 3:13055054-13055076 CAGAGCCAGGACAGGAAGGCCGG - Intronic
950464832 3:13147317-13147339 CAGACTCAGAAGAGGGAGGGTGG - Intergenic
950540400 3:13609072-13609094 CAGAGCCAGGACAGGGCGGCGGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951029313 3:17863505-17863527 AAGAGTCAGCAGTGGTAGCCAGG - Intronic
951145012 3:19216271-19216293 CAGTGCTAGCAGAGGCAGGCTGG + Intronic
951286591 3:20820992-20821014 TAGAGTCTACAGAGGCAGGCAGG + Intergenic
951299129 3:20972915-20972937 GAGAGTCAGCAGAGGGAGATAGG + Intergenic
951315811 3:21189115-21189137 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
951389244 3:22082588-22082610 TGGAGTCTGCAGAGGCAGGCAGG - Intronic
951584787 3:24204049-24204071 TAGAGTCTACAGAGGCAGGCAGG - Intronic
951775585 3:26307067-26307089 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
951895151 3:27603044-27603066 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
952253770 3:31678261-31678283 TAGAGACACCAGAGGGAGACAGG + Intronic
952296564 3:32067809-32067831 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
952297789 3:32076385-32076407 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
952343043 3:32461030-32461052 AAGAGTCAGCAAAGGGAGATAGG + Intronic
953127491 3:40105763-40105785 CAGAGAGAGAAGAGTGAGGCAGG + Intronic
953177668 3:40566557-40566579 GAGAGTCAGCAAAGGGAGATAGG - Intronic
953320267 3:41964897-41964919 GAGAGTCAGCAGCGGGTGGTGGG - Intergenic
953540063 3:43810479-43810501 GAGAGTCAGGAGAGGCAGTCTGG - Intergenic
953599697 3:44350123-44350145 GAGAGTCAGCAAAGGGAGTTAGG + Intronic
953679649 3:45029851-45029873 AAGAGTCAGCAGGGGAAGGCGGG - Intronic
953840665 3:46387781-46387803 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
954425247 3:50439717-50439739 CAGGGTCTGCAGTTGGAGGCCGG + Intronic
954682954 3:52355732-52355754 CAGCGTGAGCAGAGGGGGACTGG - Intronic
955135497 3:56213557-56213579 CAGAGTCTACAGAGGCAGGCAGG - Intronic
955396620 3:58562301-58562323 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
955401602 3:58595625-58595647 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
955672363 3:61415272-61415294 CACTGGCAGCAGAGGGAGGGAGG + Intergenic
956204682 3:66742951-66742973 CAGATTCAGCAGAGCTATGCTGG + Intergenic
956232925 3:67037958-67037980 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
956233753 3:67043847-67043869 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
956548472 3:70434767-70434789 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
956549252 3:70440100-70440122 TAGAGTCAGCAAAGGGAGATAGG + Intergenic
956709744 3:72028789-72028811 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
957154742 3:76533671-76533693 GAGAGTCAGCAAAGGGAGATAGG + Intronic
957155360 3:76537774-76537796 GAGAGTCAGCAAAGGGAGATAGG + Intronic
957316340 3:78581307-78581329 GAGAGTCAGCAGAGGGAGATAGG + Intergenic
957317649 3:78588567-78588589 GAGAGTCAGCAGAGGGAGATAGG + Intergenic
957893273 3:86387170-86387192 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
958140761 3:89559491-89559513 CAGAGTCACCTGAGGAATGCAGG - Intergenic
958181861 3:90071425-90071447 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
958182892 3:90083283-90083305 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
958183337 3:90086613-90086635 AAGAGTCAGCAAAGGGAGATAGG - Intergenic
958421693 3:93938324-93938346 GAGAGTCAGCAAAGGGAGATAGG - Intronic
959085627 3:101849107-101849129 CTGGGCCTGCAGAGGGAGGCGGG - Intronic
959287873 3:104440025-104440047 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
959400270 3:105892513-105892535 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
959970177 3:112400523-112400545 GAGAGTCAGCGAAGGGAGACAGG + Intergenic
960309644 3:116105454-116105476 CAGAGTCAGCGAAGGGAGGTAGG + Intronic
960310490 3:116110894-116110916 AAGAGTCAGCGAAGGGAGGTAGG + Intronic
960863062 3:122171392-122171414 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
961017918 3:123481772-123481794 CAGAGAGGGCTGAGGGAGGCAGG + Intergenic
961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG + Intronic
961213530 3:125142907-125142929 CAGAGTCAGGGAAGGGAGGAGGG - Intronic
961402710 3:126658310-126658332 TGGAGCCAGCAGATGGAGGCCGG + Intergenic
961713032 3:128841692-128841714 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
961731068 3:128965281-128965303 GAGAGTCAGCAAAGGGAGATAGG - Intronic
961731602 3:128969234-128969256 GAGAGTCAGCAAAGGGTGGTGGG - Exonic
961880695 3:130059446-130059468 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
962414993 3:135173734-135173756 CAGAGTCAGAAGAGTGGAGCTGG - Intronic
962660351 3:137595931-137595953 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
962848498 3:139290446-139290468 CAAAGACAGCCTAGGGAGGCTGG + Intronic
963058265 3:141205191-141205213 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
963059268 3:141211614-141211636 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
964300764 3:155282873-155282895 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
964984125 3:162718142-162718164 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
964993952 3:162851002-162851024 CATAGAAAGAAGAGGGAGGCCGG - Intergenic
965070882 3:163913871-163913893 GAGAGTCAGCGAAGGGAGGTAGG - Intergenic
965262948 3:166506115-166506137 GAGAGTCAGCGAAGGGAGACGGG + Intergenic
965458336 3:168931010-168931032 GAGAGTCAGCAAAGGGAGTTAGG + Intergenic
965458598 3:168933048-168933070 AAGAGTCAGCAAAGGGAGTTAGG + Intergenic
965886384 3:173451659-173451681 TGGAGTCTGCAGAGGCAGGCAGG + Intronic
966055236 3:175678948-175678970 GAGAGTCAGCAAAGGGAGACAGG + Intronic
966233080 3:177670776-177670798 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
966398713 3:179526055-179526077 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
967278327 3:187798260-187798282 CAGAGTCAAGAGAGGAAGACAGG + Intergenic
967495916 3:190144892-190144914 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
967496709 3:190150087-190150109 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
968205329 3:196794643-196794665 CAGAGGCAGAGGAGGGAGGCGGG + Intronic
968605184 4:1532064-1532086 GAGAGTCAGCAGAGTGGAGCAGG - Intergenic
968669731 4:1842654-1842676 CACAGGCAGCAGTGGGAGGCTGG + Intronic
968903413 4:3441357-3441379 CAGAGTCAGAACAGGCAGGTGGG + Intergenic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
969653532 4:8482494-8482516 GAGAGTCAGCAAAGGGAGATAGG + Intronic
970028721 4:11653662-11653684 AAGAGTCAGCTAAGGGAGACAGG + Intergenic
970488472 4:16547681-16547703 TAGAGGCAGCAGTGGGAGGGAGG + Intronic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
970723593 4:19016645-19016667 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
970819889 4:20199150-20199172 AAGAGTCAGCAAAGGGTGGTGGG - Intergenic
970853521 4:20629864-20629886 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
970873715 4:20845491-20845513 GGGAGTCAGCAGAGGGTGGTGGG - Intronic
971233669 4:24821595-24821617 AAAAGTCAGCACAGTGAGGCAGG - Intronic
971553440 4:27981257-27981279 GAGAGTCAGCGAAGGGAGGTAGG - Intergenic
971766186 4:30835190-30835212 CAGAGTCAGCAGATTGAGACAGG + Intronic
972774180 4:42226334-42226356 CAGAGGCAGCAGCCGGAGTCAGG - Intergenic
972784162 4:42311548-42311570 CAGAGACAGCAGAGTGGGTCTGG + Intergenic
973673323 4:53239249-53239271 CTGAGTCAGGAGAGTCAGGCAGG + Intronic
974593421 4:63985029-63985051 GAGAGTCAGCTAAGGGAGGTAGG + Intergenic
974849063 4:67384089-67384111 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
975089039 4:70378680-70378702 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
975152624 4:71037195-71037217 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
975250538 4:72173490-72173512 AGGAGTCAGCAAAGGGAGACAGG - Intergenic
975632782 4:76419519-76419541 CAGAGCCTCCAGAGGGAGGGAGG - Intronic
975755434 4:77567252-77567274 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
975813648 4:78195371-78195393 TGGAGTCTGCAGAGGCAGGCAGG + Intronic
975945169 4:79696832-79696854 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
976087498 4:81421128-81421150 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
976187831 4:82459894-82459916 CAAAGTCAGCAGGGGGATGTGGG - Intronic
976271583 4:83235719-83235741 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
976767873 4:88617573-88617595 CAAAGTCAAAATAGGGAGGCTGG + Intronic
976966314 4:91045884-91045906 GAGAGTCAGCAAAGGGAGATAGG + Intronic
976992312 4:91382306-91382328 TAGAGTCTACAGAGGCAGGCAGG + Intronic
977029486 4:91863917-91863939 TGGAGTCTGCAGAGGCAGGCAGG + Intergenic
977080666 4:92523707-92523729 CAGGTTCAGCAGAGGGACGCAGG + Intronic
978031191 4:103941606-103941628 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
978385066 4:108169879-108169901 CAAAGCCAGAAGAGGGAGGGAGG + Intergenic
978540447 4:109811042-109811064 AAGAGTCGGCAAAGGGAGGTGGG + Intergenic
978756587 4:112309347-112309369 TAGAGTCTGCAGAGGCAGGCAGG + Intronic
979641101 4:123013046-123013068 GAGAGTCAGCAAAGGGAGATAGG + Intronic
979850645 4:125567101-125567123 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
980111431 4:128640987-128641009 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
980284649 4:130767693-130767715 CAGAGTCAGCGAAGGGAGATAGG - Intergenic
980803157 4:137779324-137779346 GAGACTCAGAAGAGGGAGGCAGG - Intergenic
981345666 4:143673691-143673713 TAGAGTCTACAGAGGCAGGCAGG + Intronic
982015099 4:151145551-151145573 AGGAGTCAGCAAAGGGAGACAGG - Intronic
982774194 4:159425484-159425506 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
982791362 4:159595300-159595322 AAGAGTCAGCAAAGGGAGATAGG - Intergenic
983509602 4:168593301-168593323 CAGATCCAGCAGAGAGAAGCTGG - Intronic
983638285 4:169920069-169920091 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
983884153 4:172961995-172962017 GAGAGTCAGCAAAGGGAGATGGG + Intronic
984393918 4:179170213-179170235 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
984436959 4:179720816-179720838 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
984580763 4:181507410-181507432 CAGATTCTGAAGAGGAAGGCAGG - Intergenic
984700287 4:182814624-182814646 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
985895441 5:2748200-2748222 CAGAATTAGCAGAGTGAGGGCGG - Intronic
986078755 5:4366815-4366837 GTGAGTCGGCACAGGGAGGCTGG - Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986502343 5:8414374-8414396 GAGAGTCAGCAAAGGCAGGTAGG - Intergenic
987916358 5:24220004-24220026 TAGACTCAGAAGAGGGAGGATGG - Intergenic
988433847 5:31150389-31150411 GAGAGACAGGAGTGGGAGGCAGG + Intergenic
989231083 5:39086815-39086837 CAGAGTCAGCAGGTCCAGGCTGG - Intergenic
989402417 5:41022591-41022613 TGGAGTCTGCAGAGGCAGGCAGG - Intronic
989613954 5:43320921-43320943 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
990592581 5:57281418-57281440 TAGAAGCAGAAGAGGGAGGCAGG + Intergenic
990833597 5:59988523-59988545 CAGAATCTTCAGGGGGAGGCTGG + Intronic
991052954 5:62292065-62292087 TGGAGTCTGCAGAGGCAGGCAGG - Intergenic
991275667 5:64843903-64843925 GAGGGGCAGCAGTGGGAGGCAGG - Intronic
991734413 5:69618658-69618680 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991780565 5:70128067-70128089 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
991810847 5:70473793-70473815 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991859853 5:71003490-71003512 TAGGGGCAGCAGAGGGAAGCTGG + Intronic
991873013 5:71128386-71128408 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
992631190 5:78682480-78682502 TAGAGTCTACAGAGGCAGGCAGG - Intronic
992960501 5:81953546-81953568 AAGAGTCAGCAAAGGGAGATAGG - Intergenic
993060881 5:83037589-83037611 CAGAGTCATTAGAAGGAAGCAGG + Intergenic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
993273057 5:85819359-85819381 CATACTCAGCAGGGGTAGGCAGG + Intergenic
993688504 5:90970266-90970288 TGGAGTCTGCAGAGGCAGGCAGG - Intronic
993742275 5:91555904-91555926 TGGAGTCTGCAGAGGCAGGCAGG - Intergenic
994082023 5:95717602-95717624 CAGAGGCAGCAGAATGAGACAGG - Intronic
994324565 5:98434835-98434857 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
994758112 5:103819333-103819355 CTGAGGCAGGAGAGGGAGACAGG + Intergenic
995053067 5:107728688-107728710 CAGAGTCAGAAGAGAGAGTGAGG - Intergenic
995414066 5:111889785-111889807 GAGAGTCAGCAAAGGGAGATGGG + Intronic
995471104 5:112503089-112503111 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
995551414 5:113285499-113285521 CAGAGTGAGCAGGGGGAGAGTGG - Intronic
996400689 5:123059038-123059060 AAGACTCAGAAGAGGGAGGGTGG + Intergenic
996509597 5:124304097-124304119 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
996527739 5:124497328-124497350 CAGAGTCAGCGAAGGGAGATAGG - Intergenic
996897105 5:128498016-128498038 GTGAGACATCAGAGGGAGGCAGG + Intronic
997497844 5:134345559-134345581 GAGAGTCAGCAAAGGGAGATGGG + Intronic
997770138 5:136546424-136546446 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
997832196 5:137159491-137159513 GAGACTCAGAAGTGGGAGGCTGG - Intronic
997930595 5:138069532-138069554 CTGAGTTTGCAGAGGAAGGCAGG + Intergenic
998027776 5:138834876-138834898 GAGAGTCAGCGAAGGGTGGCGGG + Intronic
998147031 5:139734796-139734818 CTGGATCAGCAGAGGCAGGCAGG - Intergenic
998403921 5:141863085-141863107 CTGAGCCAGCAGTGGGAGGTGGG - Intronic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
998834442 5:146190318-146190340 ATGGGTCAGCAGAGGTAGGCAGG + Intergenic
999232394 5:150069488-150069510 CAGAGGCTGATGAGGGAGGCAGG - Intronic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
999705567 5:154269717-154269739 CAGTGTCAGTGGAGGGAGCCTGG + Intronic
999814569 5:155163200-155163222 TGGAGTCTGCAGAGGCAGGCAGG + Intergenic
999947231 5:156610641-156610663 TGGAGTCTGCAGAGGCAGGCAGG + Intronic
1000041250 5:157486682-157486704 GAGTGCCAGCAGAGGGAGGAGGG - Intronic
1000103598 5:158037974-158037996 CAGTGGCATCAGAGGGAGACCGG + Intergenic
1000884949 5:166740148-166740170 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
1000885615 5:166744344-166744366 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
1000935085 5:167297726-167297748 GAGAGTCAGCAAAGGGAGATAGG + Intronic
1001069473 5:168572412-168572434 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1001389764 5:171369433-171369455 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1001424509 5:171614672-171614694 CAGAGGCAGCAGTGGGAGGCTGG + Intergenic
1001478028 5:172064819-172064841 CAGAGACAGCAGAGAGTAGCTGG + Intronic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1001537446 5:172508228-172508250 CAGAGCCTCCAGAGGGAGCCTGG + Intergenic
1001571335 5:172732462-172732484 CAGATGCTGCAGAGGGAGGGAGG + Intergenic
1002159927 5:177309059-177309081 AAGACACAGCAGAGGGAGCCTGG + Intronic
1002213099 5:177609900-177609922 CACAGTGATCAGAGAGAGGCTGG + Exonic
1002321207 5:178377144-178377166 CTGAGTCAGCAGTGGGCAGCGGG + Intronic
1002428438 5:179189278-179189300 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1002719099 5:181247029-181247051 CTGGGTCAGCAAAGGGAGCCCGG + Intronic
1002853812 6:1020426-1020448 GAGACACAGCTGAGGGAGGCAGG + Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003150852 6:3547829-3547851 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1003775330 6:9354306-9354328 CAGAGACAAAGGAGGGAGGCAGG + Intergenic
1003892499 6:10575937-10575959 GAGAGTCAGCAAAGGGAGATGGG - Intronic
1004768093 6:18754239-18754261 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1004768923 6:18759575-18759597 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1004806967 6:19212890-19212912 CAGAGTCAGCAAAGTGTGGTGGG - Intergenic
1005373518 6:25158712-25158734 TAGAGTCTACAGAGGCAGGCAGG - Intergenic
1005441455 6:25873550-25873572 CAGAGTCAGCAGAAGATGGTAGG - Intronic
1005450907 6:25971324-25971346 CAGAGTCATGTGTGGGAGGCAGG - Intronic
1005502502 6:26442122-26442144 CAAGGTCTGCAGAGGGAGGTGGG - Intronic
1005584149 6:27259827-27259849 CAAATTCAGAGGAGGGAGGCAGG - Intergenic
1005672577 6:28122320-28122342 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006325639 6:33351684-33351706 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1006360535 6:33584693-33584715 CACAGTCAGGTGAGGGAGGCAGG - Intergenic
1006825089 6:36928771-36928793 CCCAGGGAGCAGAGGGAGGCAGG + Intronic
1007059204 6:38921852-38921874 AAGAGTCAGCGAAGGGAGACAGG + Intronic
1007269855 6:40628235-40628257 CAGAGTCACAAGAGGGAAACCGG + Intergenic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1007836320 6:44676691-44676713 CTGAGTCTGCAGAGGCAGGAGGG + Intergenic
1008154406 6:47996169-47996191 CAGAATCAGGAGAGAGTGGCTGG + Intronic
1008281279 6:49599084-49599106 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1008414567 6:51224870-51224892 TAGAGTCTACAGAGGCAGGCAGG - Intergenic
1008474579 6:51922548-51922570 TAGAGTCTACAGAGGCAGGCAGG + Intronic
1008564234 6:52751574-52751596 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008568548 6:52792853-52792875 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008573003 6:52832856-52832878 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008577382 6:52874066-52874088 CACCTTCAGCAGAGGGAAGCTGG + Intronic
1008671583 6:53774556-53774578 TGGAGTCTGCAGAGGCAGGCAGG - Intergenic
1008978595 6:57457387-57457409 TGGAGTCTGCAGAGGCAGGCAGG + Intronic
1009166734 6:60350346-60350368 TGGAGTCTGCAGAGGCAGGCAGG + Intergenic
1009361356 6:62818389-62818411 TAGAGTCCACAGAGGCAGGCAGG + Intergenic
1009457924 6:63878576-63878598 CAGAGTCTACAGAAGCAGGCAGG + Intronic
1009465307 6:63961508-63961530 GAGAGTCAGCCAAGGGAGACAGG - Intronic
1009476408 6:64097352-64097374 TAGAGTCTACAGAGGAAGGCAGG + Intronic
1009604504 6:65849455-65849477 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1009684355 6:66936947-66936969 CAGTGCCAGCAGAGGGTGGCAGG - Intergenic
1010363211 6:75018868-75018890 GGGAGTGAGGAGAGGGAGGCAGG - Intergenic
1010826477 6:80482897-80482919 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1010876886 6:81117645-81117667 TAGAGTCTACAGAGGCAGGCAGG + Intergenic
1011283451 6:85700345-85700367 TGGAGTCTGCAGAGGCAGGCAGG + Intergenic
1011303542 6:85901827-85901849 GAGAGTAGGCAGAGTGAGGCAGG + Intergenic
1011949891 6:92952399-92952421 TGGAGTCCACAGAGGGAGGCAGG - Intergenic
1012689898 6:102297212-102297234 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
1012976981 6:105791419-105791441 CACAGGCAGCAGAGGGAGGCTGG + Intergenic
1013191823 6:107810199-107810221 CAGAGTGAGAAGAGCGAGCCTGG - Intronic
1013807521 6:114011870-114011892 AAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1013808396 6:114017810-114017832 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1014114615 6:117657841-117657863 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1014842877 6:126240808-126240830 CGGAGTCTACAGAGGCAGGCAGG + Intergenic
1015137517 6:129890571-129890593 CAGAGTGAGCAGGGAGAGCCAGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015264980 6:131281766-131281788 TAGACTCAGCAGAGGGAAGCAGG - Exonic
1015270124 6:131329020-131329042 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1015292016 6:131548003-131548025 TGGAGTCACCAGAGGGATGCAGG - Intergenic
1015801721 6:137066806-137066828 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1016113668 6:140257591-140257613 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1016255893 6:142104888-142104910 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1016842600 6:148539356-148539378 GAGAGTCAGAAGAGGAAGGGTGG - Intronic
1016858216 6:148693523-148693545 CTGAGTCAGGAGACTGAGGCAGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017133666 6:151129692-151129714 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1017178300 6:151525648-151525670 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
1017193515 6:151677798-151677820 CAGAGTTTGCAAAGGGAGGAGGG + Intronic
1017286600 6:152683277-152683299 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1017600049 6:156070437-156070459 TAGAGTCTGCAGAGGAAAGCAGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018302905 6:162422646-162422668 AAGAGTCATAAGAAGGAGGCTGG + Intronic
1018495799 6:164344464-164344486 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
1018521851 6:164657749-164657771 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1018573472 6:165234107-165234129 TAGACTGAGCAGAGGGATGCTGG - Intergenic
1018641387 6:165907484-165907506 CAGAGTCTGCAGAGAGAGTGCGG - Intronic
1018744372 6:166750542-166750564 CAGAGTCAGAAGAGGCACGGAGG - Intronic
1018794274 6:167173897-167173919 CAGCGGCAGCAGTGGGAAGCCGG + Exonic
1018807225 6:167270826-167270848 TGGAGTCTGCAGAGGGAGCCTGG + Intergenic
1018822045 6:167381170-167381192 CAGCGGCAGCAGTGGGAAGCCGG - Exonic
1018901338 6:168053332-168053354 CAGAGCTGGCAGTGGGAGGCTGG - Intergenic
1019328421 7:451018-451040 CAGACTCAGCAGAGGCAGGAAGG - Intergenic
1019404715 7:877382-877404 CGGAGGGAGCAGGGGGAGGCTGG - Intronic
1019453508 7:1112385-1112407 CAGAGTGAGCAGGTGGAGGCCGG - Intronic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019660734 7:2222690-2222712 CAGCTTCAGGAGCGGGAGGCCGG - Exonic
1020315720 7:6904084-6904106 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1020340216 7:7101893-7101915 CTGAGTAGGCAGAGGGAGGTTGG - Intergenic
1020389234 7:7640879-7640901 CAGAGTCAAAAGAGCTAGGCGGG + Exonic
1020408811 7:7867625-7867647 CAGACTCAGTAGAGGGGTGCAGG + Intronic
1020540546 7:9457795-9457817 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1020541433 7:9463862-9463884 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1020793925 7:12660101-12660123 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1020891242 7:13880440-13880462 CAGTGTCAACACAGGCAGGCAGG - Intergenic
1021393333 7:20121048-20121070 GAGAGTCAGCGAAGGGAGACAGG - Intergenic
1021636996 7:22703650-22703672 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
1021637861 7:22709196-22709218 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
1021661139 7:22918810-22918832 GAGAGTCAGCAAAGGGAGTTAGG - Intergenic
1022091407 7:27110262-27110284 GGGAGGCAGAAGAGGGAGGCGGG + Exonic
1022447147 7:30479833-30479855 AAGAGTCAGCAAAGGGAGTTAGG - Intergenic
1022447954 7:30485165-30485187 GAGAGTCAGCAAAGGGAGTTAGG - Intergenic
1022514875 7:30969162-30969184 CAGAGTCAGGTGAGGGGTGCTGG + Exonic
1022708791 7:32832900-32832922 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
1023510432 7:40946469-40946491 AAGAGTCAGCAAAGGGAGTGGGG + Intergenic
1023732882 7:43209073-43209095 CAGGGTTAGGAGTGGGAGGCGGG + Intronic
1023747639 7:43336493-43336515 CAGAGTCCTGAGAGGGAAGCTGG - Intronic
1023753830 7:43397508-43397530 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024697080 7:51868543-51868565 CACAGTCAGCAAAGGGAGATAGG - Intergenic
1024738089 7:52327350-52327372 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1024960453 7:54969341-54969363 CAGAGGCTGCAGGGAGAGGCTGG + Intergenic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1025285255 7:57655356-57655378 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1025604610 7:63030386-63030408 CAGAGTCAGCTGAGGACGGTGGG + Intergenic
1025802682 7:64801909-64801931 CAGAGCCAAAAGAGGAAGGCAGG - Intronic
1026490647 7:70860393-70860415 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1026868061 7:73835320-73835342 CTGAGTCAGGAGAGTCAGGCAGG - Intronic
1026913967 7:74108765-74108787 CAGAGGCAGGAGAGGGGAGCTGG + Intronic
1026940515 7:74285161-74285183 CAGAGGCTGCACAGGGTGGCAGG - Intergenic
1028159087 7:87465442-87465464 CAGAGTCTACAGAGGCAGGCAGG - Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1029000994 7:97154022-97154044 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1029098367 7:98107080-98107102 CTGAGGCAGCGGAGGGAGGCAGG + Exonic
1030267094 7:107631789-107631811 TGGACTCGGCAGAGGGAGGCAGG - Intergenic
1030446032 7:109647259-109647281 GAGAGTCAGCAAAGGGAGACAGG + Intergenic
1030570864 7:111221974-111221996 CACAGTCAGCAGGGGGATGATGG + Intronic
1030574437 7:111268323-111268345 CAGAGATAGAAAAGGGAGGCAGG + Intronic
1031193141 7:118580824-118580846 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1031296358 7:120009512-120009534 GAGAGTCAGCACAGGGAGATAGG - Intergenic
1031776999 7:125917850-125917872 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
1032395647 7:131587959-131587981 GAGAGTCAGCGAAGGGAGACAGG + Intergenic
1032480006 7:132238802-132238824 CAGAGTCACAAGAGGGGGGGGGG + Intronic
1032783883 7:135185694-135185716 CAGGGCCAGCAGAGCCAGGCTGG + Exonic
1033084450 7:138329568-138329590 GAGAGTCAGCAAAGGGTGGCGGG - Intergenic
1033089043 7:138368180-138368202 GAGAGTCGGCAAAGGGTGGCGGG - Intergenic
1033362518 7:140647850-140647872 CAGAGTCAGGAGAAGGAGTGAGG + Intronic
1033541243 7:142357983-142358005 AAGTGTCTGCAGAGGGAGCCGGG - Intergenic
1033583071 7:142753980-142754002 TGGATGCAGCAGAGGGAGGCAGG + Intronic
1033584620 7:142764884-142764906 TGGATGCAGCAGAGGGAGGCAGG + Intergenic
1033586095 7:142775452-142775474 TGGACACAGCAGAGGGAGGCAGG + Intergenic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1033656794 7:143380729-143380751 CAGAGTCAGCTGGGGGGTGCTGG + Intergenic
1034018037 7:147608806-147608828 GAGAGTCAGCAAAGGGAGATAGG + Intronic
1034084245 7:148309511-148309533 GAGAGTCAGCAAAGGGAGATGGG + Intronic
1034085119 7:148315301-148315323 GAGAGTCAGCAAAGGGAGATAGG + Intronic
1034334639 7:150313168-150313190 GAGAGTCAGCGAAGGGAGGTAGG - Intronic
1034413544 7:150953612-150953634 CACAGTCATCAGACAGAGGCAGG + Intronic
1035352912 7:158258983-158259005 CAGCGTCGGTACAGGGAGGCAGG + Intronic
1036104308 8:5823946-5823968 TAGTGTCAGGAGACGGAGGCTGG + Intergenic
1036453955 8:8892517-8892539 GAGAGGCAGGAGAGGGAGTCAGG + Exonic
1036472680 8:9064889-9064911 GAGAGTCAGCGAAGGGAGACAGG + Intronic
1036550230 8:9809179-9809201 GAGAGTCAGCAAAGGGAGTTAGG - Intergenic
1036640009 8:10577212-10577234 GAGAGTCAGCGAAGGGAGGTAGG - Intergenic
1036655552 8:10674857-10674879 AGGAGTCAGCAGAGGCTGGCGGG + Intronic
1036780358 8:11642741-11642763 CAGAGTCAGCTGAGGACGGTGGG - Intergenic
1037009370 8:13821481-13821503 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1037174044 8:15926244-15926266 GAGAGTCAGCGGAGGGTGGTGGG - Intergenic
1037387840 8:18362370-18362392 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1037764725 8:21765537-21765559 TATAGTCAGGAGAGTGAGGCTGG - Intronic
1037941079 8:22951477-22951499 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1038035251 8:23681945-23681967 GAGAGGCGGGAGAGGGAGGCAGG + Intronic
1038463167 8:27733858-27733880 CAGATGCAGCAGCGGGAGGAAGG + Exonic
1038499932 8:28035430-28035452 CATAGTCATCTGAGTGAGGCTGG + Intronic
1038510610 8:28130921-28130943 AGGAGTCAGCCCAGGGAGGCTGG + Intronic
1039476500 8:37841765-37841787 CAGAGTCAGGTGTGCGAGGCGGG + Exonic
1039671609 8:39606779-39606801 GAGAGTCAGCAAAGGGAGATAGG + Intronic
1040394831 8:46987235-46987257 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1040852570 8:51916289-51916311 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1041294246 8:56338359-56338381 TAGAGTCTACAGAGGCAGGCAGG + Intergenic
1041606904 8:59792688-59792710 AATAGTCAGCAGTGGGAGCCAGG + Intergenic
1041665897 8:60444586-60444608 TGGAGTCTACAGAGGGAGGCAGG + Intergenic
1041997727 8:64084184-64084206 TGGAGTCTGCAGAGGCAGGCAGG - Intergenic
1042310856 8:67378322-67378344 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1042638573 8:70906228-70906250 TGGAGTCTGCAGAGGCAGGCAGG + Intergenic
1043469157 8:80544835-80544857 GAAAGTGAGCAGAGGGAAGCTGG + Intergenic
1043485869 8:80698744-80698766 CAGCATCAGCAGAGGCAGCCCGG + Intronic
1043596906 8:81898113-81898135 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
1043717373 8:83504798-83504820 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
1043838254 8:85069036-85069058 GAGAGTCAGCAAAGGGAGATGGG - Intergenic
1044587139 8:93878450-93878472 GAGAGTCAGCAAAGGGAGTTAGG + Intronic
1045778732 8:105838595-105838617 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1046439737 8:114241937-114241959 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1046440497 8:114246968-114246990 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1046934787 8:119875278-119875300 CGGAGTCAGCAAAGGGAGATGGG + Intronic
1047130939 8:122018710-122018732 GAGAGTCAGCAAAGGGTGGTAGG + Intergenic
1047443206 8:124897464-124897486 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1047889186 8:129288461-129288483 AAGACTCAGAAGAGGGAGGGTGG + Intergenic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048327807 8:133452432-133452454 CACAGGCATCAGAGGGAGGGAGG + Intergenic
1048466430 8:134668149-134668171 TGGAGTCTGCAGAGGCAGGCAGG - Intronic
1048584951 8:135767286-135767308 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1048763714 8:137824737-137824759 GAGAGTCAGCAAAGGGAGATCGG + Intergenic
1049257791 8:141623165-141623187 CAGAGTCAGGTGAGTGGGGCAGG - Intergenic
1049494716 8:142924312-142924334 CAGAGGCAGCTGAGAGGGGCAGG + Intergenic
1049495101 8:142926366-142926388 CAGACTCAGCAGGGGCAGGAAGG - Intergenic
1049497671 8:142944027-142944049 CAGAGTCAGCTGGGGGCTGCTGG - Intergenic
1049610672 8:143553399-143553421 CAGAGTGAGCGGCGGGCGGCGGG - Exonic
1049694661 8:143977355-143977377 TGGAGCCCGCAGAGGGAGGCAGG + Exonic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1049975786 9:860448-860470 CAGAGTAAGAAGAGTGAGGGAGG - Intronic
1050034837 9:1424344-1424366 CGGAGTCTACAGAGGCAGGCAGG + Intergenic
1050287024 9:4114127-4114149 CAGAGTGAGTAGAGGGACCCAGG - Intronic
1050308171 9:4327245-4327267 CTGAGAGAGCAGAGGGAGGTGGG + Intronic
1050508995 9:6374726-6374748 TAGAGTCTACAGAGGCAGGCAGG - Intergenic
1051273786 9:15379900-15379922 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1052338846 9:27345614-27345636 CAAAGTCAACAGAGTCAGGCAGG - Intronic
1052696803 9:31888749-31888771 CGGAGTCTACAGAGGCAGGCAGG + Intergenic
1052824690 9:33166635-33166657 CTGATCCAGAAGAGGGAGGCTGG + Intronic
1052855516 9:33404014-33404036 TAGAATCTGCAGAGGGAGGCCGG - Intergenic
1053054264 9:34984906-34984928 CAGAGTCAGAGGAGGGAGGCAGG + Intergenic
1053060230 9:35024768-35024790 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1053320857 9:37097810-37097832 CAGAATCAGCAGAGGGTGGAGGG + Intergenic
1053683528 9:40500366-40500388 TAGAATCTGCAGAGGGAGGCCGG - Intergenic
1053852591 9:42303992-42304014 CACAGTCAGCAGTGATAGGCTGG - Intergenic
1053897142 9:42753694-42753716 CAGAGCCAGCAGGGGGTGGCAGG + Intergenic
1053933510 9:43128684-43128706 TAGAATCTGCAGAGGGAGGCCGG - Intergenic
1054266843 9:62925861-62925883 CGGAGCCAGCAGGGGGTGGCGGG + Intergenic
1054280187 9:63124555-63124577 TAGAATCTGCAGAGGGAGGCCGG + Intergenic
1054296632 9:63335863-63335885 TAGAATCTGCAGAGGGAGGCCGG - Intergenic
1054394649 9:64640369-64640391 TAGAATCTGCAGAGGGAGGCCGG - Intergenic
1054429297 9:65145569-65145591 TAGAATCTGCAGAGGGAGGCCGG - Intergenic
1054501086 9:65875962-65875984 TAGAATCTGCAGAGGGAGGCCGG + Intergenic
1054550336 9:66595315-66595337 CGGAGCCAGCAGGGGGTGGCGGG + Intergenic
1055269382 9:74540241-74540263 CAGAGTGAGCAGAGGGGGCAGGG - Intronic
1055881450 9:81009368-81009390 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1056220710 9:84448310-84448332 CAGAGTCAGAAGTAGGAGACAGG + Intergenic
1056363170 9:85879325-85879347 AAGAGTCAGCAAAGGGAGATGGG + Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056618267 9:88187424-88187446 TAGAGTCTGGAGAGGGAGGCTGG - Intergenic
1056636070 9:88332347-88332369 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1056656532 9:88514234-88514256 GAGAGTCAGCAAAGGGAGCTAGG + Intergenic
1056766201 9:89446216-89446238 CAGAGGCAGCAGAGGGAGATCGG - Intronic
1056856332 9:90132704-90132726 CAGAATCAGCAGCGGAAGGAAGG - Intergenic
1057067800 9:92072010-92072032 GGGAGTCAGCAGAGGGTGGTGGG - Intronic
1057179670 9:93022983-93023005 CAGATTAAACGGAGGGAGGCAGG - Intronic
1057209783 9:93193461-93193483 CCGAGCCAGCAGGTGGAGGCTGG + Intronic
1057392407 9:94650801-94650823 AGGAGTCAGCAAAGGGAGGTGGG - Intergenic
1057747130 9:97761341-97761363 GATTGGCAGCAGAGGGAGGCAGG + Intergenic
1057794607 9:98146289-98146311 CAAAGGCAGCAGGGGAAGGCTGG - Intronic
1058425309 9:104870760-104870782 GAGAGTCAGCAAAGGGAGATAGG + Intronic
1058988830 9:110235364-110235386 TGGAGTCTGCAGAGGCAGGCAGG + Intergenic
1059800085 9:117741458-117741480 GAGAGGTAGCAGAGGCAGGCTGG - Intergenic
1059909932 9:119031832-119031854 CAAACTCAGAATAGGGAGGCAGG + Intergenic
1060485251 9:124042343-124042365 CAGGGCCAGGAGGGGGAGGCAGG - Intergenic
1060691567 9:125665551-125665573 AAGAGTCAGCAAAGGGTGGTGGG - Intronic
1060807765 9:126588266-126588288 CAGGCTCTGCACAGGGAGGCTGG - Intergenic
1060817774 9:126644388-126644410 CAGGCTCAGAAGAGGGAGGGGGG + Intronic
1060933688 9:127504179-127504201 CAGCGTCCGCAGAAGCAGGCAGG + Intergenic
1061034463 9:128105993-128106015 CAGGGACAGCAGGGCGAGGCAGG + Intronic
1061045158 9:128160779-128160801 CCGAGGCACCTGAGGGAGGCAGG + Intronic
1061188775 9:129070102-129070124 CAGAGGAAGCAGTGGGAGGGAGG + Intronic
1061314572 9:129786856-129786878 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1061431739 9:130535651-130535673 CTGAGTGAGCAGCTGGAGGCGGG + Intergenic
1061817635 9:133206269-133206291 CAGACACAGCAGAGGGACACAGG + Intronic
1062145193 9:134985199-134985221 AGGAGGCAGCAGAGGAAGGCGGG - Intergenic
1062439533 9:136563505-136563527 CAGAGCCAGCTGGGGCAGGCTGG + Intergenic
1062596766 9:137303025-137303047 CGTGGGCAGCAGAGGGAGGCAGG - Intergenic
1062697933 9:137884901-137884923 GAGAAACAGAAGAGGGAGGCGGG - Intronic
1185529542 X:806614-806636 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1185654311 X:1671710-1671732 AAGAGTCAGCAAAGGGTGGCGGG - Intergenic
1185889181 X:3809251-3809273 AAGAGTCAGCAAAGGGAGACAGG - Intergenic
1185960203 X:4540571-4540593 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
1185961043 X:4545968-4545990 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1186116311 X:6308246-6308268 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1186453303 X:9691137-9691159 TAGAATCATCAGAGGTAGGCCGG + Intronic
1187086856 X:16050109-16050131 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
1187501300 X:19841206-19841228 GACAGTGAGCAGAGGGAGGTAGG - Intronic
1188043967 X:25404199-25404221 CTGAGTCTACAGAGGCAGGCAGG + Intergenic
1188276478 X:28207292-28207314 CAGAGCCTACAGAGGCAGGCAGG - Intergenic
1188397987 X:29708386-29708408 CAGAGGCTGCAGAGGGGGGCAGG - Intronic
1188552373 X:31378057-31378079 AAGAGTCAGCAAAGGGAGACAGG - Intronic
1191161848 X:57338158-57338180 GAGAGTCAGCAAAGGGAGATAGG + Intronic
1191196651 X:57730969-57730991 TAGAGTCTACAGAGGCAGGCAGG + Intergenic
1191805262 X:65129397-65129419 AAGAGTCAGCAAAGGGAGTTAGG + Intergenic
1191806067 X:65134808-65134830 AAGAGTCAGCAAAGGGAGTTAGG + Intergenic
1192225255 X:69222996-69223018 CAGAGTGAGCAAAATGAGGCAGG + Intergenic
1192495840 X:71616286-71616308 CAGAGCCGGCAGAGGGAGGGAGG + Exonic
1192730868 X:73801554-73801576 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1192922269 X:75719508-75719530 TGGAGTCTGCAGAGGCAGGCAGG + Intergenic
1193035900 X:76950906-76950928 TGGAGTCTGCAGAGGCAGGCAGG - Intergenic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1193558160 X:82982470-82982492 CAGAGTCTGAAAAGGGAAGCTGG + Intergenic
1193851109 X:86538029-86538051 GAGAGTCAGCAAAGGGAGATAGG - Intronic
1193942395 X:87691548-87691570 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1194147629 X:90282326-90282348 AAGAGTCAGCAGACAGAGGAAGG + Intergenic
1194180565 X:90706368-90706390 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1194200975 X:90952510-90952532 GAGAGTCAGCAAAGGGAGATGGG + Intergenic
1194470612 X:94290756-94290778 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1194660363 X:96624316-96624338 AAGAGTCAGCAGAGGGAGATGGG - Intergenic
1194874135 X:99164880-99164902 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1194901715 X:99520238-99520260 CATAGGCAGCAGAGGGTAGCAGG - Intergenic
1195290603 X:103429150-103429172 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1195568862 X:106377129-106377151 AAGAGGTAGCAGAGGGAGCCTGG - Intergenic
1195841144 X:109178677-109178699 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1195841981 X:109184043-109184065 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1196226629 X:113176226-113176248 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
1196774178 X:119323137-119323159 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1196853590 X:119961995-119962017 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1196889107 X:120275240-120275262 CAGAGTCTGGGGAGGGAAGCTGG + Intronic
1196992301 X:121343991-121344013 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1196993011 X:121348363-121348385 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1197286672 X:124603120-124603142 CAGAGTCTCCAGAGGGAGTGTGG + Intronic
1197620196 X:128739277-128739299 CAGAGTCAGGACAGGGACCCAGG - Intergenic
1197793763 X:130280075-130280097 GAGAGTCAGCAAAGGGAGTTAGG - Intergenic
1198123789 X:133621693-133621715 TGGAGTCTGCAGAGGCAGGCAGG - Intronic
1198553496 X:137768914-137768936 TAGAGTCTACAGAGGCAGGCAGG + Intergenic
1198581844 X:138073937-138073959 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
1199073188 X:143502293-143502315 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1199600859 X:149540368-149540390 GAGAATCAGCAGGGGGAGGCAGG - Intronic
1199800791 X:151248645-151248667 CAGAGCCAGAAGGGGGAAGCTGG + Intergenic
1200110216 X:153737131-153737153 CAGAGACAGCACAGCGGGGCTGG - Intronic
1200136805 X:153879205-153879227 CAGAGTGAGAAGAGGCAGGGGGG + Intronic
1200374803 X:155768207-155768229 CAGAGACAGCACAGGATGGCTGG - Intronic
1200527227 Y:4288528-4288550 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1200546820 Y:4527968-4527990 GAGAGTCAGCAAAGGGAGATAGG + Intergenic
1200659966 Y:5945919-5945941 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1200805428 Y:7428510-7428532 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1201233480 Y:11888579-11888601 AAGAGTCAGCAAAGGGAGATAGG + Intergenic
1201483404 Y:14465822-14465844 GAGAGTCAGCAAAGAGAGACAGG - Intergenic
1201581840 Y:15517956-15517978 GAGAGTCAGCAAAGGGAGATAGG - Intergenic
1202062868 Y:20905613-20905635 AAGAGTCAGCAAAGGGAGATAGG - Intergenic
1202162641 Y:21951708-21951730 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1202228715 Y:22634660-22634682 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1202314441 Y:23561507-23561529 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1202361489 Y:24115187-24115209 CAGAGTCTACAGAGGCAGGCAGG + Intergenic
1202363584 Y:24137913-24137935 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
1202507196 Y:25532204-25532226 CAGAGTCTACAGAGGCAGGCAGG + Intergenic
1202509289 Y:25554932-25554954 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
1202556361 Y:26109088-26109110 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic