ID: 923201840

View in Genome Browser
Species Human (GRCh38)
Location 1:231720219-231720241
Sequence CCAAGGACTTGGTTACTCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923201836_923201840 28 Left 923201836 1:231720168-231720190 CCTCTAGGAGTTTATTGTGAGGT No data
Right 923201840 1:231720219-231720241 CCAAGGACTTGGTTACTCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923201840 Original CRISPR CCAAGGACTTGGTTACTCGC AGG Intronic
900899473 1:5506978-5507000 CAGATGACTTGGGTACTCGCAGG + Intergenic
911402307 1:97391426-97391448 CCAAGTACTTGGTTAATCACTGG - Intronic
920610357 1:207430093-207430115 CAAAGGAGTTTGTTACTGGCAGG + Intergenic
921623140 1:217348713-217348735 ACAAGGAATTGGCTACTTGCTGG - Intergenic
922355813 1:224774245-224774267 CCAAGGAGATGTTTACTCCCAGG + Intergenic
923201840 1:231720219-231720241 CCAAGGACTTGGTTACTCGCAGG + Intronic
1073202716 10:101749296-101749318 ACAAGGGCTTGGTTACCAGCAGG - Intergenic
1076531223 10:131146490-131146512 CCCAGGGCTTAGTTACTTGCTGG + Exonic
1077216918 11:1398820-1398842 CCAAGGACCTGGGTACACCCAGG - Intronic
1078181701 11:9017043-9017065 GCAAGGACTTGCTTACCCTCCGG - Intergenic
1080262437 11:30364192-30364214 CCAAGGACTTGGCTAGTTGTGGG - Intergenic
1083996879 11:66277230-66277252 CCAAAGACTTGCTTTCTTGCAGG - Exonic
1092160285 12:6312021-6312043 CCAAGGGCTTGGTCACTTGTTGG - Intronic
1092960301 12:13590810-13590832 CCAAGGAAATGGTTTCTCACAGG - Intronic
1101882430 12:108634563-108634585 CCACCGAATTGTTTACTCGCTGG - Intergenic
1105988223 13:25590638-25590660 ACAAGGGCTTTGTTACTGGCAGG + Intronic
1108016822 13:46085477-46085499 CACAGGACTCGGTTACTGGCTGG - Intronic
1117190855 14:53289627-53289649 CCAAAGACTTGGTTGCTTGTAGG + Intergenic
1121118242 14:91358480-91358502 CCAGGGACAGAGTTACTCGCTGG - Intronic
1127525297 15:59786742-59786764 CAAAGGACTTGGTTCTTCCCTGG + Intergenic
1128112029 15:65082499-65082521 CCAAGGACCTGCTTCCTTGCTGG + Intergenic
1132557774 16:579985-580007 CCACGGACTAGGGGACTCGCAGG - Intronic
1132653628 16:1032435-1032457 CCAAGGACTGGCTCACTCCCAGG + Intergenic
1133573361 16:7063924-7063946 CCATGGACTTTGGTATTCGCAGG + Intronic
1149722470 17:58860274-58860296 CCATGGCCATGGTTACTCCCAGG - Intronic
1156465903 18:37347725-37347747 CCAAGGACTTGGGTACACAGGGG + Intronic
1162757449 19:12868712-12868734 CCAATGACTTGGTTCTGCGCCGG + Exonic
925467506 2:4121010-4121032 CCAAGGCCTTGGTTCCTCTAGGG - Intergenic
929359724 2:41072546-41072568 CCAAGGACTTTGGTATTAGCGGG + Intergenic
930125095 2:47789656-47789678 CCAAGGATTTGGGTATTCACAGG - Intronic
930258244 2:49116059-49116081 CCAAGATCTTGCTTACTTGCAGG - Intronic
931184525 2:59937284-59937306 CAAAGGACTTGGCTACTCATTGG - Intergenic
938662686 2:133503902-133503924 CCTAGGCCTTGGTTCCTCCCTGG - Intronic
944896842 2:204173869-204173891 CAATGGACTTGGTTTCTCCCTGG - Intergenic
1168868385 20:1108391-1108413 CCAAGGACTTGGGTTCTCTGGGG + Intergenic
1170279289 20:14627311-14627333 CCAAGGCCATGGTTCCTCCCTGG + Intronic
1173201774 20:40960006-40960028 CCGAGGACTTGAGGACTCGCTGG + Intergenic
1182536751 22:31009525-31009547 CCAAAGACTAGGTTACTAGGAGG - Intergenic
973724984 4:53766186-53766208 CCAATGACTTGGTAACTAGCTGG + Intronic
978328892 4:107590094-107590116 CCAAGGACTGGGAGACTCCCTGG + Intergenic
981054271 4:140344294-140344316 CCAAGGACTTGGGTGCTTGTAGG - Intronic
999321204 5:150616184-150616206 TCAAGGTCTTGGTTTCTGGCTGG - Intronic
1011737852 6:90330859-90330881 CCAAGTAATTGGATACTGGCAGG + Intergenic
1016412244 6:143795607-143795629 CTAAGGAGATGGTTACTGGCAGG - Intronic
1018219344 6:161562740-161562762 TCAAGGACTTGGTGACTGACTGG - Intronic
1023431587 7:40097913-40097935 CCAAGGACTAGATTACTACCTGG - Intergenic
1026601442 7:71780921-71780943 CTAAGGACTTGCTGACTCGAGGG - Exonic
1040018703 8:42721315-42721337 CCCAGGACCTGGTTCCTCTCTGG + Intronic
1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG + Intergenic