ID: 923202262

View in Genome Browser
Species Human (GRCh38)
Location 1:231724168-231724190
Sequence CTCTGTGTGGGGAAGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 951
Summary {0: 1, 1: 0, 2: 11, 3: 95, 4: 844}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923202253_923202262 19 Left 923202253 1:231724126-231724148 CCTTGGTACTTCATTTGGCTTTG 0: 1
1: 0
2: 2
3: 20
4: 206
Right 923202262 1:231724168-231724190 CTCTGTGTGGGGAAGGGGGCAGG 0: 1
1: 0
2: 11
3: 95
4: 844

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923202262 Original CRISPR CTCTGTGTGGGGAAGGGGGC AGG Intronic
900035297 1:402694-402716 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900056918 1:638447-638469 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900208083 1:1440008-1440030 CTCTGGGCGGGGATGGGGCCGGG - Exonic
900525533 1:3126603-3126625 CTCTGTGGTGGGCAGAGGGCTGG + Intronic
900931836 1:5742824-5742846 CGCTGTGGGGAGAAGGGGACTGG - Intergenic
901161201 1:7177687-7177709 CTGTGTGTGGGGAGGGGTACTGG - Intronic
901860765 1:12072949-12072971 CTATGTGTGGGGAAGGGGCAGGG - Intronic
901971861 1:12914536-12914558 CTGTGAGTGGAGAAGGGGTCAGG + Intronic
902013307 1:13287204-13287226 CTGTGAGTGGAGAAGGGGTCAGG - Intergenic
902361176 1:15943374-15943396 GTGGGTGTGGGGGAGGGGGCAGG + Intronic
902447860 1:16478470-16478492 CTCTCTGCAGGGAAGGTGGCTGG + Intergenic
902505973 1:16939202-16939224 CTCCGGGTGGGGGCGGGGGCGGG + Intronic
902506813 1:16944034-16944056 CTCTCTGCAGGGAAGGTGGCTGG - Intronic
902718819 1:18290846-18290868 CTCTGTGTGGTGGAGGCAGCGGG - Intronic
902784226 1:18722615-18722637 CCCTGTGTGGGTGAGGCGGCAGG + Intronic
902822217 1:18950339-18950361 CTTTGCCAGGGGAAGGGGGCTGG + Intronic
903010188 1:20324365-20324387 CTGGGGGTGGGGCAGGGGGCAGG - Intronic
903060408 1:20664861-20664883 CTCTGGCTGGGCAGGGGGGCGGG - Intronic
903280851 1:22249033-22249055 CTGGGTGTGGGGCAGGGGGGAGG + Intergenic
903294935 1:22337680-22337702 GTCTGTGTGTGGAAAGGGGCTGG + Intergenic
903674013 1:25053191-25053213 GTGTGTGTGGGGATGGGGGTGGG - Intergenic
904043668 1:27598292-27598314 GTGTGTGTGGTGGAGGGGGCTGG + Intronic
904443095 1:30544811-30544833 GTCTGTGTCAGGAAGGGGGTAGG - Intergenic
904458827 1:30663492-30663514 CTCAGTTTGGGGAAGAGGGAGGG - Intergenic
904488648 1:30844460-30844482 TCCAGTGTGGGGAAGGAGGCGGG - Intergenic
904500248 1:30908899-30908921 CTCTGGGTGGGGGCGGGGGCTGG - Intergenic
904597689 1:31657151-31657173 CTCTGGGTGGAACAGGGGGCTGG - Intronic
905182888 1:36177739-36177761 TTCTGTGAGAGCAAGGGGGCGGG + Intronic
905239619 1:36573155-36573177 CACTGTGTGGGGGAGGGGCCTGG + Intergenic
905769866 1:40630600-40630622 CTCCTTGTGGGGAAGGGAGAAGG + Intronic
905860795 1:41349882-41349904 CTCCGTGTGGGGAGGGGGTCAGG - Intergenic
905908283 1:41634391-41634413 CACTGTGTGGGGAGAGGGGAAGG + Intronic
906057086 1:42925697-42925719 GTGTGTGTGGGGAGGGGTGCAGG + Exonic
906150436 1:43584312-43584334 CTCTGTGAGGGTGAGGGAGCCGG + Intronic
906163971 1:43671940-43671962 ATCTGTGTGGGGGAGGGAGGTGG + Intronic
906219697 1:44069026-44069048 TTCTGTGAGGGGAGGGGGTCAGG - Intergenic
906688807 1:47779340-47779362 GTGTGTGTGGGGAGAGGGGCTGG + Intronic
907372620 1:54013045-54013067 GTGTGTGTGGGGGAGGCGGCGGG + Intronic
907806896 1:57829720-57829742 ATCTCTGGGTGGAAGGGGGCGGG - Intronic
909965521 1:81904860-81904882 CTCTGTCTCGGGGTGGGGGCAGG + Intronic
910429021 1:87143031-87143053 CGCTGTGTGAGGAGGGCGGCAGG - Intronic
910896120 1:92071249-92071271 GTGTGTATGGGGTAGGGGGCAGG - Intergenic
911151119 1:94597623-94597645 CCCTCTGTGGAGAAAGGGGCTGG + Intergenic
912507064 1:110163674-110163696 CTGTGTGTGAGGACTGGGGCAGG - Intronic
912672589 1:111644774-111644796 CTTTTTTTGGGGAAGGGGGAGGG + Intronic
912688036 1:111782311-111782333 CTAAATGTGGGGAAGGGGCCAGG + Intronic
912949957 1:114113780-114113802 TGCTGTGTGGAGAATGGGGCGGG - Intronic
913189899 1:116404603-116404625 CTCTATGGGGGGAGGGGGGAGGG + Exonic
913195776 1:116454886-116454908 CTCTGAGGAGGGAAGGGGGCAGG - Intergenic
915014875 1:152723735-152723757 CTCTGTTGGGGGGAGGGGGAGGG + Intergenic
915046176 1:153018749-153018771 CCCTGTCTGGTGAAGGGGGATGG - Intergenic
915111206 1:153565679-153565701 CTCTCTGGGAGGGAGGGGGCTGG - Exonic
915243707 1:154541725-154541747 CCCTGTCTGGGGAAGGCTGCTGG + Intronic
915285235 1:154848093-154848115 CTCTGGCTGGGGAGGGGGGGAGG - Intronic
915340076 1:155172671-155172693 AGCTGTGTGGGGAAGGGGAAGGG + Exonic
915364423 1:155306426-155306448 CTCAGTGTGGGGATGGAGACAGG + Intergenic
915560492 1:156684349-156684371 CGCTGAGTGAGGAAGTGGGCAGG - Intergenic
915977937 1:160402660-160402682 CTGTGTGTCGGGAAAGGGCCAGG + Intronic
916123749 1:161551064-161551086 CTCTGTGTGTGGCGGGGGGAGGG - Intergenic
916133635 1:161632427-161632449 CTCTGTGTGTGGCAGGGGGAGGG - Intronic
916549868 1:165839930-165839952 CTCTGTCTGGGGCGGGGGCCGGG - Intronic
916716114 1:167447985-167448007 GTCTGTGTTGGGCAGGGTGCTGG + Intronic
918092516 1:181309771-181309793 CTCAGTGTGGTGAAGGAGGAAGG + Intergenic
918336537 1:183520599-183520621 CTCTGTTGGGGGGAGGGGGAAGG + Intronic
918358056 1:183724575-183724597 CTCTGCTTGTGGAAGGGGGAGGG + Intronic
918412793 1:184277673-184277695 CTCTGTGTGTGGAAGGGGACAGG + Intergenic
918513059 1:185332531-185332553 CTATTTGGGGGGCAGGGGGCTGG + Intergenic
919709297 1:200710369-200710391 GCCTGTGAGGGGAAGGGGGAGGG + Intergenic
919837100 1:201582568-201582590 CTCTGTGTGGGGGAGCTGGCTGG - Intergenic
919856264 1:201708406-201708428 GTTTGAGGGGGGAAGGGGGCAGG - Intronic
919935018 1:202245598-202245620 CTCTGTGGGGCGCAGAGGGCAGG - Intronic
920694816 1:208174276-208174298 TTGTGTGTGGGGTTGGGGGCTGG + Intronic
920832974 1:209481906-209481928 CTCTGTGCTGGGAAGGGGCTGGG - Intergenic
921047014 1:211484930-211484952 CCTTCTGTGGGGAAGTGGGCGGG + Intronic
921752885 1:218817994-218818016 CTCTGTAAGGGGAGGGGGGCGGG - Intergenic
922196336 1:223363591-223363613 CTCGCCGTGGGAAAGGGGGCGGG - Exonic
922257827 1:223908254-223908276 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
922563390 1:226585629-226585651 CTCTGAGTGGGGACTGAGGCGGG - Intronic
923202262 1:231724168-231724190 CTCTGTGTGGGGAAGGGGGCAGG + Intronic
923232396 1:231999497-231999519 CTCTGGGAGGGGAAGGGAGTTGG - Intronic
924239481 1:242027364-242027386 CCCAGTGAGGGGAAGGGGACAGG + Intergenic
924339025 1:243011033-243011055 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
1063090640 10:2863509-2863531 CTCCGGGTGGGCATGGGGGCTGG + Intergenic
1063624290 10:7675023-7675045 TTGTGTGTGGGGGGGGGGGCGGG - Intergenic
1063753166 10:8975594-8975616 GTCTGTCTGTGGGAGGGGGCAGG - Intergenic
1064019352 10:11796778-11796800 GTCTTTTTGGGGAAGGGGGAAGG + Intergenic
1065113545 10:22462781-22462803 CTCTGGGAGGCGAAGGGGGGAGG - Intergenic
1065431396 10:25660998-25661020 CTCTGTCTGGGGAAAGGGGAGGG - Intergenic
1065766197 10:29032062-29032084 CACTATGTGGGGAAGGAGACCGG + Intergenic
1066243605 10:33561313-33561335 CCCTCTGTGGGGATGGGGGTGGG + Intergenic
1066708291 10:38204256-38204278 CTCTGCCTGGGGAAAGGGGAGGG + Intergenic
1066981218 10:42418326-42418348 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
1067030411 10:42875744-42875766 CTCTGGGTGTGGCAGGAGGCTGG + Intergenic
1067228333 10:44389717-44389739 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
1067726329 10:48773990-48774012 CTCTGTGGGGGGAAGGTGGCTGG - Intronic
1068668364 10:59699258-59699280 CTCAGTGTGGGAAAGGTAGCAGG + Intronic
1069609998 10:69766569-69766591 AGCCCTGTGGGGAAGGGGGCAGG + Intergenic
1069613197 10:69789163-69789185 CTCTGTGTGGGGAAGGCTGTGGG + Intergenic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069833638 10:71295725-71295747 CACTGTGCGGGGCAGGGGGCAGG - Intronic
1070602448 10:77875433-77875455 CTCGGTGTGGGGAGGTGGGCAGG - Intronic
1070708372 10:78657949-78657971 CTCTGGGTGGGGGTGGGGGGTGG + Intergenic
1070741583 10:78907048-78907070 CTGTGTGGAGGGAAGGGGACAGG - Intergenic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1071517783 10:86310430-86310452 CCCTGTGTGGGGTAGAGGGGTGG + Intronic
1072554060 10:96501330-96501352 CTCTGTGGGTGGGAGGGGTCCGG - Intronic
1073529288 10:104216640-104216662 CTGTGGGTGGGGAAGGGGAGAGG - Intronic
1073759373 10:106613277-106613299 CTCTGTGCGAGAAAGTGGGCAGG + Intronic
1073960689 10:108924141-108924163 CGCTGTGTGGGTAAGGCTGCTGG - Intergenic
1074033816 10:109717668-109717690 TTCTGAGAGGAGAAGGGGGCAGG - Intergenic
1074080864 10:110167097-110167119 CTCAGGCTGGAGAAGGGGGCTGG - Intergenic
1074095105 10:110304747-110304769 CCTTGTGTGGGGCTGGGGGCGGG + Exonic
1074548355 10:114419702-114419724 TTCTGTGATGGGAAGTGGGCAGG - Intergenic
1074767973 10:116714544-116714566 GTGTGTCTGGGGGAGGGGGCAGG - Intronic
1075053330 10:119199459-119199481 CTCTGTTTGGGGGAGGTGGGAGG - Intergenic
1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG + Intergenic
1075782186 10:125024219-125024241 CACCCTGTCGGGAAGGGGGCAGG - Intronic
1076369154 10:129940742-129940764 CCCTGGGTGGGGAGGGGGCCTGG - Intronic
1076601471 10:131659377-131659399 CTGTGTCTGGAGAAGGGGCCAGG + Intergenic
1076652902 10:132002253-132002275 CTCTGTGTGGGCAGGGAGGATGG - Intergenic
1076820561 10:132936745-132936767 CTCTGTGCTGGGAGGGAGGCAGG + Intronic
1076838672 10:133033821-133033843 CTCTGGGTGGGGATGGCCGCTGG - Intergenic
1077050940 11:566543-566565 CTCTTGGTGGGGAAGAAGGCTGG - Intergenic
1077060752 11:616938-616960 CTCTGTGTAGGGTCGGGAGCGGG + Exonic
1077090722 11:777204-777226 CTCGGGGCGGGGACGGGGGCGGG - Intronic
1077555905 11:3225939-3225961 GTCTGCGTGGGGATGGGGCCAGG + Intergenic
1077971136 11:7192426-7192448 CAGGGTGTGGGGATGGGGGCAGG - Intergenic
1078142498 11:8702395-8702417 CCCTGTGTGGGTGAGGGAGCAGG - Intronic
1078142629 11:8703072-8703094 CTTTGTCTGGGGAGGTGGGCAGG - Intronic
1078334872 11:10455507-10455529 CTGTGTGTGTGGATGGGGGTGGG + Intronic
1078386841 11:10899802-10899824 CTCTGTGCTGGGAGTGGGGCCGG - Intergenic
1078741856 11:14073968-14073990 CTCTGTGGAGGGGAAGGGGCAGG - Intronic
1078822902 11:14900131-14900153 CTCTTTGTGGGTAGGGGGGGTGG - Intergenic
1078913794 11:15758672-15758694 CTCTGACTTGGGGAGGGGGCGGG - Intergenic
1079026230 11:16950072-16950094 GTGTGTGTGGGGCGGGGGGCGGG + Intronic
1079701392 11:23553008-23553030 CTCTGTGTGTGTGAGGGGGTGGG + Intergenic
1080049675 11:27846938-27846960 CTCTGGGTGGGGAAAGAGGGAGG - Intergenic
1080666047 11:34337261-34337283 GGCTGTGTAGGGAAGGAGGCAGG + Intronic
1080881619 11:36326688-36326710 CTCCTTGTGGGGATGGGGGTGGG - Intronic
1082071601 11:47943949-47943971 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
1082824503 11:57567852-57567874 CTTTGTGCGGAGACGGGGGCGGG + Intronic
1083164712 11:60876388-60876410 CTCTAGGTGGAGAAGGGGACAGG + Intergenic
1083268758 11:61560004-61560026 CTCTGAGTGGGGAAGGGTCAGGG - Intronic
1083325811 11:61872474-61872496 ATGTGTGTGGAGTAGGGGGCGGG + Intergenic
1083631274 11:64096777-64096799 CTCCCTGAGGGGAAGAGGGCAGG + Intronic
1083641518 11:64148260-64148282 GGCTGTGAGGGAAAGGGGGCGGG - Intronic
1083802985 11:65057537-65057559 GTGTGGGTGGGGAAGGGGGGTGG + Intronic
1083890264 11:65592421-65592443 CCCTGTACGGGGAAGGGCGCCGG - Exonic
1084813618 11:71631724-71631746 CTCTCTGTGGGGCAGGGCTCCGG - Intergenic
1084856328 11:71990002-71990024 CTTTGCCTGGGGAAGGGGCCAGG + Intronic
1084857425 11:71997967-71997989 CTCAGAGAGGGGAATGGGGCTGG + Intergenic
1084935703 11:72585505-72585527 CTGTGTGTGGGCATGGGGGCTGG - Intronic
1085312293 11:75523985-75524007 TTCTGTGTGGGGACGGGGAGGGG - Intronic
1085399860 11:76229538-76229560 CTCTCTGTGGGGACTGGGACAGG - Intergenic
1085561357 11:77474666-77474688 CTTTCTGTGGGAGAGGGGGCAGG + Intergenic
1085745163 11:79108919-79108941 GTTTGTGTGGGGAATGGGGAAGG - Intronic
1085811017 11:79681103-79681125 ATCTGTGGGGGAAAGGGGGTTGG + Intergenic
1085987359 11:81802729-81802751 CTCATTGTGGGGAAGGAGGTTGG - Intergenic
1086002116 11:81996445-81996467 CTCTCAGTGGAGAAGGGAGCTGG + Intergenic
1087285433 11:96260172-96260194 CTCTGTGTGGTGTTGGGGGATGG + Intronic
1087313323 11:96576881-96576903 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
1087602975 11:100339346-100339368 CTCTCAGTGGAGAAGGGAGCTGG + Intronic
1089012378 11:115141750-115141772 ATCTGGGTGGGGAAGTGGGAGGG - Intergenic
1089284603 11:117397342-117397364 CCCTGTGTGGGGGAGGCGGGGGG + Intronic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089748736 11:120635211-120635233 TTCTGAGTGGGGAAGGGGTTGGG - Intronic
1089790801 11:120942161-120942183 TTCTTTGGGGGAAAGGGGGCAGG + Intronic
1090202012 11:124864025-124864047 CTAGGTGTGGGGGAGGGGGTAGG - Intergenic
1090379689 11:126317773-126317795 CTGTGTGTGGAGAAGTGGGGGGG + Intronic
1090634802 11:128684256-128684278 CTGGGTGTGGGGGGGGGGGCAGG - Intergenic
1090644817 11:128758796-128758818 CACTGTGTCTGGGAGGGGGCAGG + Intronic
1090663954 11:128902503-128902525 GTCTGCATGGGGGAGGGGGCTGG + Exonic
1091055709 11:132416967-132416989 CTCTGTTTTGGGAAGGGGAAGGG + Exonic
1091057389 11:132431517-132431539 CTCTGTGTGGGGAAGGCAACCGG + Intronic
1091259689 11:134224652-134224674 CTCCGGGCGGGGGAGGGGGCGGG - Exonic
1091693626 12:2613265-2613287 CCCTCTGTGGAGAAGGGGGAAGG + Intronic
1091695714 12:2626788-2626810 CTCTCAGTGGGGAAGATGGCAGG + Intronic
1091727340 12:2855184-2855206 GGCTGGGTGGGGAAGGTGGCAGG + Intronic
1092793107 12:12086418-12086440 CCCTGAGTGGGGAAGAGGGGAGG - Intronic
1093000298 12:13988628-13988650 CTGTCAGTGGGGAAGGGTGCAGG - Intergenic
1093235570 12:16605446-16605468 CTGTGTTTGGGCATGGGGGCGGG - Intronic
1093674767 12:21925681-21925703 CTCTCTGTGGTGTAGGGGGGTGG - Intronic
1093766876 12:22973729-22973751 CGCTGTGTGGGCAGGGGGCCTGG + Intergenic
1094141057 12:27182442-27182464 TCCAGTGAGGGGAAGGGGGCTGG + Intergenic
1094251041 12:28361865-28361887 CTGTGTGTGTGGGAGGGGGGCGG + Intronic
1095111992 12:38305779-38305801 ACCTGTGGGGGGAAGGGGGAGGG + Intergenic
1095212444 12:39509875-39509897 CACTGTGTGGGGGAGAGTGCTGG - Intergenic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095940187 12:47721599-47721621 CTCAGGGTGGGGAATGAGGCGGG + Intronic
1095943277 12:47739890-47739912 CTCAGTGTGTGCATGGGGGCAGG - Intronic
1096478601 12:51923613-51923635 CCCTGTGTGGGGATGGGAGGCGG - Intergenic
1096514450 12:52148358-52148380 CTGTGTGTGTGGGATGGGGCAGG + Intergenic
1096626454 12:52898896-52898918 CCCTCTGTGGGGTAGGGGACAGG + Exonic
1096751437 12:53761367-53761389 TTCTGGTTGGGGAAGAGGGCAGG - Intergenic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097417700 12:59333599-59333621 CTCTGTCTGGGGTAGGGGTGGGG - Intergenic
1097769983 12:63572331-63572353 CTCTGCCTGGGGAAAGGGGAAGG + Intronic
1097962438 12:65545819-65545841 TTCTGAGTGGGGCAGGTGGCGGG - Intergenic
1098166110 12:67699613-67699635 GCCTGTGTGGGGAAGTGGGGAGG + Intergenic
1098853117 12:75621291-75621313 CTTTGTGTAGGGTAGGAGGCAGG - Intergenic
1099439845 12:82686835-82686857 ATCTGGGTGGAGAAAGGGGCTGG + Intergenic
1099623180 12:85030521-85030543 CTCTCTGTGGGGAAGAAGACAGG - Intronic
1099730060 12:86489275-86489297 CTCTCAGTGGGGAGGGGAGCTGG - Intronic
1100875767 12:98959891-98959913 CTCTGTTTGTGGAAAGGGGAGGG + Intronic
1100959448 12:99946172-99946194 CTCTGAGTGGGGAAAGGAGGAGG + Intronic
1100984999 12:100195291-100195313 CTCTGTGTGTGTAGGGGGGCTGG - Intergenic
1101046678 12:100813640-100813662 AACTCTGTGGGGAAGTGGGCTGG + Intronic
1101251919 12:102945534-102945556 CTCTGTTTGTGGAAAGGGGAGGG - Intronic
1101686682 12:107030771-107030793 GTGGGGGTGGGGAAGGGGGCAGG + Intronic
1103381299 12:120496199-120496221 CTCACCGTGGAGAAGGGGGCTGG - Intronic
1103594242 12:122013928-122013950 CTCTGGGTGGGGAAGAGGGGAGG + Intergenic
1103678108 12:122672612-122672634 CTCTGGGAGGGGAGAGGGGCTGG - Intergenic
1103983344 12:124750922-124750944 CTTTCTGGGGTGAAGGGGGCGGG + Intergenic
1103995819 12:124829354-124829376 TTCTGTGGGGAGAACGGGGCGGG - Intronic
1104610120 12:130220820-130220842 GCCTGTGTGGGGCAGGGGGGAGG - Intergenic
1104791026 12:131482292-131482314 CCCTGTGTGGGCACTGGGGCTGG - Intergenic
1104926595 12:132317108-132317130 CTCTGTGGGGTGTAGGGTGCAGG - Intronic
1105299250 13:19117878-19117900 CTCTGCCTGTGGTAGGGGGCTGG - Intergenic
1105474501 13:20718843-20718865 ATGTGTGTGGGTGAGGGGGCAGG - Intronic
1105948912 13:25212321-25212343 CTCTGTGAGTGAAAGGGGTCAGG - Intergenic
1106395089 13:29371973-29371995 GTGTGTGTGGGGGGGGGGGCGGG - Intronic
1106621419 13:31374399-31374421 CTCTGTGAGGGGAATGGAGCAGG - Intergenic
1108003544 13:45925839-45925861 CTGTGTGTGTGGTAAGGGGCTGG + Intergenic
1110046905 13:70842560-70842582 CTTTGTGTAGGGAAGGGGAGGGG - Intergenic
1111637096 13:90919644-90919666 GTCTGTGTGTGGGCGGGGGCGGG - Intergenic
1112098010 13:96156632-96156654 CTTTGTGTGGGGAAGAGGATTGG + Intronic
1112449419 13:99495460-99495482 GTCTGTGTGGGGCATGGGGTGGG - Intergenic
1112573109 13:100611738-100611760 CCCTGTGTGTTGAAGGGGACTGG - Intronic
1113047943 13:106176068-106176090 CTCTGTGTGATGGATGGGGCTGG + Intergenic
1113461892 13:110487992-110488014 CTTTGTGGGAGGAAGGGGGAGGG - Intronic
1113467552 13:110522997-110523019 CTCTCTGTGGGGTAGGGTGGGGG - Intergenic
1113557673 13:111251500-111251522 GTCTGGGTGGGGCAGAGGGCAGG + Intronic
1113617248 13:111689545-111689567 TTCAGTGTGGGGGAGGGGGGTGG - Intergenic
1113633194 13:111901808-111901830 CTCTCCCTGTGGAAGGGGGCAGG + Intergenic
1113790197 13:113024292-113024314 CTCAGTGTCAGGAAGGAGGCAGG + Intronic
1113853061 13:113428916-113428938 CTCTGAGTGCGGACTGGGGCCGG + Intronic
1113856076 13:113446129-113446151 CTCTCTGGGGGGGAGGGGGGAGG - Intronic
1113955573 13:114098565-114098587 GTGTGTGTGTGGAATGGGGCTGG + Intronic
1113969109 13:114175207-114175229 GTCTTTGTGGGGGATGGGGCAGG - Intergenic
1114015023 14:18420593-18420615 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1114487488 14:23071576-23071598 CTGTGTGTGCGGATGGGGGAGGG + Intronic
1114562318 14:23602329-23602351 CTCTGTCAGGGGAGGGGTGCCGG - Intergenic
1114604629 14:23986802-23986824 ATCTGTGTGGGGCTGGGGGGAGG - Intronic
1115362959 14:32524298-32524320 CTCTGTGATGGAAAGGGGACAGG + Intronic
1115474357 14:33799713-33799735 CTCTGTGTGGGGCGGGGGGCCGG - Exonic
1115496864 14:34013509-34013531 CTCAGTGTGGGGAAAGAGGACGG - Intronic
1115510026 14:34129788-34129810 CTATGGGTGGGGAAGGGAGGTGG + Intronic
1115766160 14:36625540-36625562 CTCTGTTTGGAGAAGGAAGCCGG - Intergenic
1116718251 14:48455831-48455853 CTGTGTGTGGGGATGGGGGGTGG + Intergenic
1118263098 14:64266886-64266908 CTCTGTCTGGGGGCGGGGGGAGG - Intronic
1118418239 14:65568022-65568044 CTTTTTGTGGGGAAGGGTGGTGG + Intronic
1118638417 14:67769316-67769338 CTCTGTCTGGGGAAGGGCTAAGG + Intronic
1118951990 14:70443295-70443317 CTCTGGGTGGGGAAGGTGTTGGG + Intergenic
1119416904 14:74477025-74477047 GTGTGTGTTGGGAATGGGGCTGG - Intronic
1119416916 14:74477104-74477126 GTGTGTGTTGGGAATGGGGCTGG - Intronic
1119578851 14:75755984-75756006 CTCTGGGTGGGGGTGGGGGGCGG - Intronic
1121009950 14:90513876-90513898 GACTGGGTGGGGAACGGGGCGGG + Intergenic
1121291558 14:92779934-92779956 CTCTGTGTTGGGATGGTGGGTGG - Intergenic
1121357980 14:93231183-93231205 CTCTGTGTCAGGAAGGGCGGCGG - Intergenic
1121464707 14:94107988-94108010 GCCTGTTGGGGGAAGGGGGCTGG - Intronic
1121642805 14:95497141-95497163 CTGTGTGGGGGGACAGGGGCTGG - Intergenic
1122097175 14:99380732-99380754 CTCTGTCTGGGGGAGTGGTCAGG - Intergenic
1122306977 14:100772644-100772666 TTCTGTGTGTGGCAGGGGGTGGG + Intergenic
1122470380 14:101962189-101962211 CTCTGGGCAGGGCAGGGGGCAGG - Intergenic
1122537333 14:102474840-102474862 CTTTGTGTGGGGCAGGGGGAAGG - Intronic
1122802844 14:104240205-104240227 CTCTGTGTGGGCGAGGAGGCTGG + Intergenic
1122807281 14:104266265-104266287 CTCAGGGTGGGAGAGGGGGCAGG - Intergenic
1122919858 14:104875539-104875561 CGCTGTGTGGAGTTGGGGGCCGG + Intronic
1202862008 14_GL000225v1_random:89225-89247 CTCTGGGTTGGGACGGGGTCGGG - Intergenic
1123625865 15:22226536-22226558 CTCTGAGTGGGGCAGGGGCCTGG - Intergenic
1123943266 15:25226858-25226880 CTCCGTTTGGGGAAGGGGGTCGG - Intergenic
1124636164 15:31366321-31366343 CTTGGTGAGAGGAAGGGGGCTGG - Intronic
1125258733 15:37798006-37798028 CTTTGAGAGGGGAAGGAGGCTGG - Intergenic
1125375087 15:39020233-39020255 GTCTGTGGTGTGAAGGGGGCAGG + Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1126273908 15:46853674-46853696 CTCTGTATGGCCAAGTGGGCTGG - Intergenic
1126437068 15:48646574-48646596 CTGTGTGTGGGGGAGGGCGAGGG - Intergenic
1126534203 15:49742664-49742686 CTCTGCGTGTGGAAAGGGGAGGG + Intergenic
1126615435 15:50574054-50574076 CTGGGGGTGGGGGAGGGGGCGGG + Intronic
1128012041 15:64306971-64306993 TTGTGGGTGGGGAGGGGGGCGGG + Intronic
1128063132 15:64747749-64747771 CTCTGTGTGGGGTGCTGGGCTGG - Intronic
1128511199 15:68314945-68314967 CTCTGTGTGGGGAAGGACAGAGG - Intronic
1129638465 15:77348791-77348813 GTTTTTGTGGGGGAGGGGGCGGG + Intronic
1129712092 15:77825612-77825634 CACTGTGTTGGGGTGGGGGCTGG + Intergenic
1129787534 15:78319708-78319730 CTCTGTGTGGGGATGAGGGGTGG - Intergenic
1129951876 15:79599302-79599324 CTTTTTTTGGGGAGGGGGGCAGG - Intergenic
1129985735 15:79918507-79918529 TCCTGTGTGGGGGAGGGGGCTGG - Intronic
1130079721 15:80721940-80721962 CTTTGTGTTGGGAAGGGAGTTGG + Intronic
1130151200 15:81313066-81313088 CCCTGAGTGGGGCAGGAGGCAGG + Exonic
1130323164 15:82856834-82856856 CTCTGGCTGTGGAAGGGGACAGG + Intronic
1131057437 15:89383967-89383989 TTCTGAGGGGGAAAGGGGGCTGG - Intergenic
1131150486 15:90044423-90044445 CTGAGTGTGAGGAAGGGGGCCGG + Intronic
1131786229 15:95914003-95914025 CACTGTGTAGGGAGGGGGGATGG + Intergenic
1132637294 16:957781-957803 CTGTGTGTCGGGTCGGGGGCAGG - Intronic
1132854823 16:2040044-2040066 CTCCCTGTGGGGGTGGGGGCTGG + Exonic
1132944200 16:2523618-2523640 CTCTGTGTGGGGAGGGCTGTGGG - Intronic
1132973450 16:2700199-2700221 CTCTGTGTGAGGGAGGGGACTGG + Intronic
1133041785 16:3064856-3064878 CTCAGCTGGGGGAAGGGGGCTGG + Intergenic
1133118275 16:3590589-3590611 CGCTGTCAGGGAAAGGGGGCTGG - Exonic
1133229862 16:4361348-4361370 CTCGCTGTGGGTAAGGAGGCTGG - Exonic
1133932079 16:10240810-10240832 CACACTGGGGGGAAGGGGGCAGG + Intergenic
1134191562 16:12125299-12125321 AGCTGTGTGGGGAAGGCGGAAGG + Intronic
1134232137 16:12437623-12437645 CTATGGGTGGGGAAGGAGCCAGG - Intronic
1136229172 16:28876973-28876995 GTCAGTGAGGGGAAGGGGCCTGG - Intergenic
1136656052 16:31709947-31709969 CTCAGTGTGGGAAAGGGGTTTGG + Intergenic
1137245164 16:46696896-46696918 CTTTGGGAGGTGAAGGGGGCGGG - Intronic
1137666350 16:50251858-50251880 CTCTGCGTGGGGGAGCAGGCCGG - Intronic
1137770000 16:51008424-51008446 CAGTGTGTGGGGCAGGGGGGAGG + Intergenic
1137944776 16:52723350-52723372 CTCAGTGTGGGGAATGGGAAAGG - Intergenic
1138198013 16:55068490-55068512 CTGTGTGGGGGGGGGGGGGCAGG - Intergenic
1138460165 16:57143300-57143322 CTGTGTGTGGGCATGGTGGCTGG + Intronic
1139711972 16:68782778-68782800 CCCTGTGTGGGGTGAGGGGCAGG - Intronic
1139936085 16:70572186-70572208 CTCTGTGGGAGGAAGGAGGCAGG + Exonic
1140823465 16:78684291-78684313 CTCAGAGTGGGGAAGGGGAGCGG + Intronic
1141676733 16:85521724-85521746 CTCTGTGGAGGGCAGGGGCCTGG + Intergenic
1141787779 16:86213235-86213257 GTCTGTGTGGTGTAGGGGGAGGG - Intergenic
1141802657 16:86321684-86321706 CTGCGTGTGGTGAAGGGGGCTGG - Intergenic
1141804245 16:86332274-86332296 CTCTGGGTTGGGAGAGGGGCTGG - Intergenic
1141835566 16:86536789-86536811 CTCTGTGCGGAGCAGGGGGAGGG - Intronic
1142028550 16:87827176-87827198 CTCTGGGGGGGGACAGGGGCTGG + Intergenic
1142089192 16:88200967-88200989 CTGTGTGTGGGCGAGAGGGCCGG + Intergenic
1142234735 16:88916647-88916669 GGCTGGGTGGGGAAGGGGGATGG + Intronic
1142635086 17:1252104-1252126 CGCTGTTGGGGGAAGGGGGGAGG - Intergenic
1142826779 17:2517772-2517794 CTTGGGGTGGGGAAGAGGGCAGG + Intergenic
1143116075 17:4582514-4582536 TTCTGGGGTGGGAAGGGGGCGGG - Intergenic
1143188507 17:5024425-5024447 CTATGGGTGGGGTGGGGGGCTGG + Exonic
1143495395 17:7309247-7309269 CTATATGTGGGGAAGAGGGGTGG + Intronic
1143727649 17:8860451-8860473 TACTGGGTGGGGAAGGGGGCTGG - Intronic
1143761120 17:9104973-9104995 CTCTGAGTGGGGCAGGGGTGGGG + Intronic
1144417781 17:15068290-15068312 CTTTTTGGGGGGAGGGGGGCAGG + Intergenic
1144452601 17:15393561-15393583 ATCTGGGTGTGGAAAGGGGCGGG - Intergenic
1144675334 17:17158217-17158239 TTCTGAGTGGGGGAGGGGGAGGG - Intronic
1146182396 17:30706573-30706595 CTCTGTAGGGGGAAGTGGGTGGG + Intergenic
1146184720 17:30717366-30717388 CTGTGTGTGGGGAGGGTTGCTGG - Intergenic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146634837 17:34496242-34496264 CCCTCTGTGGCCAAGGGGGCTGG + Intergenic
1146974026 17:37095914-37095936 CTCAGTGTTGGGGATGGGGCGGG - Intronic
1147179492 17:38675065-38675087 GTCTGTGTGCGGAATGGGGACGG - Exonic
1147592830 17:41695914-41695936 CAGCGTGTGGGGATGGGGGCAGG - Intergenic
1147650141 17:42057340-42057362 CTCTGTGTGGGGCTGGGGGTAGG + Intronic
1147867382 17:43562127-43562149 CTCTGCTTGGGGAAGTGGGGAGG + Intronic
1147966337 17:44196230-44196252 GTGTGGGTGGGGAAGGGGGGTGG - Intronic
1148145256 17:45360678-45360700 CTAGGTGTGGGGAAGTGGGGTGG + Intergenic
1148149509 17:45388368-45388390 CGCGGGATGGGGAAGGGGGCTGG + Intergenic
1148153031 17:45407401-45407423 CTCTGTGGGGCCAAGGGTGCTGG - Intronic
1148350847 17:46940962-46940984 CTCAGTGTAGGGAAGGGTCCAGG + Intronic
1148809424 17:50280557-50280579 CTCTGCCTGGAGAAGGAGGCTGG - Exonic
1148822903 17:50370760-50370782 CTCCTTTTGGGGGAGGGGGCGGG + Intronic
1148866200 17:50629950-50629972 GTCTGTGTGGGGGTGGGGACTGG + Intergenic
1149296500 17:55265989-55266011 TTCTGTGCGGGGCAGGGGGCGGG + Intronic
1149522881 17:57331356-57331378 CTCTGAGCTGGGGAGGGGGCAGG + Intronic
1149560533 17:57604955-57604977 TTGTGTGTGGGGAGGGGGGCGGG + Intronic
1149703594 17:58675623-58675645 GTCTGTCTGGGGAAGGGAGATGG - Intronic
1149998364 17:61416732-61416754 CTCCAGGAGGGGAAGGGGGCAGG - Intergenic
1150198296 17:63325053-63325075 CTTTGTGTGGGGTGGGGGGCGGG + Intronic
1151309213 17:73283288-73283310 CTTTTTGTGGGGGAGGGGGTTGG - Intergenic
1151370936 17:73645586-73645608 CTCCATGTCCGGAAGGGGGCTGG - Intergenic
1151732894 17:75921594-75921616 CTCTGTGTGGGACACGGGGACGG + Intronic
1151732971 17:75921821-75921843 CTCTGTGTGGGACACGGGGACGG + Intronic
1151942203 17:77299926-77299948 CTCTGTTTGGGGTAGGAGGAGGG - Intronic
1152078239 17:78171432-78171454 CTCTGGGAGGGGACGCGGGCAGG - Intronic
1152330416 17:79669486-79669508 CTCTGTGTGGGACATGGGCCTGG - Intergenic
1152412805 17:80137720-80137742 CTCTATGGGGGGAGGGGGCCAGG + Intronic
1152474990 17:80512208-80512230 CTCTGGGTGGAGAATGGGCCTGG + Intergenic
1152539501 17:80967830-80967852 CTCTGTGTGCGCAGCGGGGCTGG - Intergenic
1152697097 17:81802964-81802986 CTCTGGGTGGGGAAGAAGACTGG + Intergenic
1152710371 17:81868187-81868209 CCCTGTCCAGGGAAGGGGGCAGG + Exonic
1152814590 17:82399904-82399926 CTCTGGGGAGGGAAGGGGGATGG + Intronic
1153348752 18:4056132-4056154 TTATCTATGGGGAAGGGGGCAGG + Intronic
1153585108 18:6612793-6612815 CTCTCTGTGGAGAAGGAGGCAGG - Intergenic
1153747055 18:8190268-8190290 GGCTGTGTGGGGAGGGAGGCTGG - Intronic
1153872691 18:9334960-9334982 CTCTTGGTTGGGAAGGGGCCGGG + Intronic
1154002516 18:10494521-10494543 GTCAGTGTGGGGAAGGAGGATGG - Intergenic
1154029992 18:10745216-10745238 CTATGGGTGGGGAAGGGACCTGG - Intronic
1154139616 18:11811341-11811363 GTCTGTGAGGGGCAAGGGGCAGG - Intronic
1155333143 18:24738137-24738159 GTGTGTGTGGGGGTGGGGGCTGG + Intergenic
1156494522 18:37517192-37517214 CTCTGAGTGGGGAGAGGGGACGG - Intronic
1157250232 18:46089079-46089101 CTCGGTGTGGGGGATGTGGCAGG - Intronic
1157314967 18:46579484-46579506 CTCACTCTGGGTAAGGGGGCGGG - Intronic
1157525526 18:48377393-48377415 CTCTGCTTGGGGAAGGGGGTGGG + Intronic
1157562018 18:48654966-48654988 GCCTGTGTGGGGTGGGGGGCAGG + Intronic
1157717926 18:49901933-49901955 TGCTGTGTGGGGTATGGGGCTGG - Intronic
1157739918 18:50083341-50083363 CTCTGGGAGAGGAAAGGGGCTGG - Intronic
1158481217 18:57823644-57823666 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
1158920434 18:62186563-62186585 CTGTGGGTGGGGACGGGGGCTGG - Intronic
1158955103 18:62530166-62530188 TTTTGTGTGGAGAAGGGGTCAGG + Intronic
1159213599 18:65362336-65362358 CTTTTTGTGGGGGAGGGGGGAGG + Intergenic
1159760755 18:72422731-72422753 GTCTGTGTGGGGAAGGTGTTTGG - Intergenic
1159828213 18:73241272-73241294 TTTTGTGTGGGGGTGGGGGCGGG + Intronic
1160246878 18:77166246-77166268 CTCTGTGGGAGGAAGGTGGGAGG - Intergenic
1160495973 18:79375635-79375657 CTGAGTGAGGGGAAGGGGCCGGG + Intronic
1160523169 18:79520522-79520544 CTCTGTGTGTGGGGGGGGGAGGG + Intronic
1160527114 18:79544510-79544532 CTCTGTGTGTGGAGGGTGGGCGG + Intergenic
1160718455 19:587024-587046 CTCAGGGTGGGGAGGGGGCCAGG - Intergenic
1160804630 19:986881-986903 CTCTATGTGGGGTTGAGGGCAGG - Intronic
1160835442 19:1122629-1122651 CCCTGCCTGGGGCAGGGGGCGGG - Intronic
1160900753 19:1426961-1426983 CTCTGGCTGGGGTAGAGGGCAGG - Intronic
1160939182 19:1612154-1612176 CTGGGTGTGGGGAAGGGAGAGGG + Intronic
1160990025 19:1856695-1856717 CTCAGTCTGGGGACGGGGTCTGG + Intronic
1161045142 19:2130601-2130623 CTCTCTGTGGAGGAGGCGGCTGG - Intronic
1161202897 19:3025668-3025690 GTGTGGGTGGGGAAGGGGGCGGG + Intronic
1161388349 19:4008456-4008478 GACGGTGTCGGGAAGGGGGCGGG - Intronic
1161426761 19:4207946-4207968 CGCTGGGTGGGGAGGGGCGCTGG - Exonic
1161447478 19:4326769-4326791 GTGTGTGTGGGGGAGGGGGCGGG - Intronic
1161455861 19:4369504-4369526 CCCTGTGAGAGGCAGGGGGCTGG - Intronic
1161512427 19:4679151-4679173 CTCGGTGTGGGGAAGGGCCTCGG - Intronic
1161596791 19:5154665-5154687 GTCTGTGGTGGGACGGGGGCTGG + Intergenic
1162315405 19:9935871-9935893 CCCAGTGTGGGGCAGGGGACGGG - Intronic
1162788840 19:13052777-13052799 CTGTGTGTGTGGACGGGTGCAGG - Intronic
1162793573 19:13075417-13075439 CTCTGGGTGGGGAGTGGTGCCGG - Intronic
1162808590 19:13151441-13151463 ATCAGTGTGGGGCAGGGGTCAGG + Intronic
1162974063 19:14198327-14198349 CTGTGTGTGGGGAGGGTTGCTGG + Intronic
1162976428 19:14209228-14209250 CTCTGTAGGGGGAAGTGGGTGGG - Intergenic
1163035005 19:14565002-14565024 CTGGGTGTGGGGACGGGGTCGGG + Intronic
1163151705 19:15418863-15418885 CTCTGCGTGGGGGATGGGACAGG - Intronic
1163376837 19:16938313-16938335 CACAGTGTGGGAAAGGGGGAAGG + Intronic
1163720796 19:18897296-18897318 CTCGGTGTGGGGCAAGGGGAAGG - Intergenic
1164394295 19:27850366-27850388 GTGTGTGTGGGGAAGGGGTGTGG + Intergenic
1164614698 19:29660038-29660060 CTCTGGTTGTGGAATGGGGCTGG - Intergenic
1164857294 19:31534952-31534974 GCTTGTGTGGGGAAGGGGCCAGG + Intergenic
1165104008 19:33457977-33457999 CTCTGTATGGGTTGGGGGGCGGG + Intronic
1165106845 19:33475345-33475367 TGCTGTGTGGGGCAGCGGGCGGG - Intronic
1165522971 19:36329041-36329063 AGATGTGTGGGGTAGGGGGCAGG + Intergenic
1165944908 19:39436128-39436150 CTCTGTGGGCGGAAGGGGCGGGG + Intergenic
1165996330 19:39846433-39846455 CTCCGGGCGGGGAAGGGGCCCGG - Intergenic
1166409500 19:42547167-42547189 CTGTGTCTGGGGGAAGGGGCTGG + Intronic
1166476034 19:43125415-43125437 CTCTATGTCGGGAAGGGTGAGGG + Intronic
1166566278 19:43767457-43767479 CCCTATGTGGCTAAGGGGGCGGG - Intronic
1166776815 19:45318064-45318086 ATGTGTGTCGGGATGGGGGCGGG + Intronic
1167342328 19:48923071-48923093 GGCTGTGTGGGGAAGGGGCTGGG - Exonic
1167608856 19:50496623-50496645 CTCTGCCTGGGGAAGGGGACAGG - Intergenic
1167643328 19:50693719-50693741 CTCAGCATGGGGAGGGGGGCTGG - Intronic
1167752900 19:51391140-51391162 ATCTGAGAGAGGAAGGGGGCTGG - Intergenic
1167898156 19:52598408-52598430 CTCTGTCTGGGGCAGGGTGGGGG + Intronic
1167982183 19:53284426-53284448 GTCTGGGTGGGGACGGGGGCAGG - Intergenic
1167983960 19:53299547-53299569 GTCTGGGTGGGGACGGGGCCAGG + Intergenic
1168000792 19:53444540-53444562 CTCAGTGAGGGGAATGTGGCAGG - Intronic
1168113514 19:54208280-54208302 ATCTGTGTTGGGAAGGGGTTTGG + Intronic
1168147861 19:54429779-54429801 CCCTGGGTGGGGAGGGGAGCTGG + Intronic
1168196205 19:54775785-54775807 CTCTGTGTGGGTGAGAGGCCAGG - Intronic
1168204566 19:54840027-54840049 CTCTGTGTGGGTGAGAGGCCAGG - Intronic
1168206811 19:54856240-54856262 CTCTGTGTGGGTGAGAGGCCAGG - Intronic
1168338934 19:55612978-55613000 CTGTGGGTGGGGTAGGGTGCAGG + Intronic
1168379731 19:55909870-55909892 CTCAGTGTAGGGAAGGAGGAGGG - Intronic
925092238 2:1164796-1164818 CTCTGTGTAGAGGAGAGGGCGGG + Intronic
925786003 2:7431682-7431704 CACTGGGTGGGGGCGGGGGCCGG + Intergenic
925981877 2:9183942-9183964 CTCTGTGCGGGGGAGGGGCGGGG - Intergenic
926196879 2:10769266-10769288 CACTGTGTGGGAGAGGGAGCAGG + Intronic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
926238878 2:11069750-11069772 CTCTGTGTGGGTGGGGGTGCAGG + Intergenic
926737236 2:16082886-16082908 CACTGTCTGGGCAAGAGGGCAGG + Intergenic
927153476 2:20208930-20208952 CTGTGGGTGGGGAAGGGGCAAGG - Intronic
927275527 2:21259272-21259294 GTGTGTGTCGGGAAGGGGGGAGG + Intergenic
927459714 2:23287520-23287542 CTCTGTCTGGGAAAGGTGCCAGG - Intergenic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
927683903 2:25157914-25157936 CTGTGTATGGGAAAGGGGGCTGG - Exonic
927970988 2:27306379-27306401 CTCTGTGTGGGGGGTGCGGCGGG + Intronic
928315015 2:30238158-30238180 CTCTGTCTGGGGAAGGGTCTTGG + Intronic
928453856 2:31401770-31401792 TTCTCTGTGGGGAAAGGGGGAGG + Intronic
928624115 2:33122026-33122048 ATGTGTGTGTGGAGGGGGGCAGG - Intronic
928997452 2:37308528-37308550 CTCTGGGTGGGGAGGGAGGTGGG - Intronic
929748812 2:44688708-44688730 TTCTGTGTGGGGAAGGGGGAAGG - Intronic
929760996 2:44806080-44806102 CTCCAAGTTGGGAAGGGGGCAGG - Intergenic
930001861 2:46866965-46866987 CTCTGTGTGGGGATGGAGTGGGG + Intergenic
930091499 2:47534518-47534540 CTGTGTGTGGGGGCGGGGGGGGG - Intronic
930124314 2:47783817-47783839 CTCCGGGTGGGGAGGGGGCCTGG + Intronic
930335921 2:50045525-50045547 GTCTGTGAGGGGAAGGAGGAAGG - Intronic
930575801 2:53146865-53146887 CTCAGTGTGAAGAAGAGGGCAGG - Intergenic
930774987 2:55162505-55162527 CCCTGTTCAGGGAAGGGGGCGGG - Intergenic
930798607 2:55419695-55419717 CCCCGGGAGGGGAAGGGGGCTGG - Intronic
931102892 2:59022142-59022164 CTCTGTCTGAGGATAGGGGCAGG + Intergenic
931456621 2:62414539-62414561 CTCTGGGTGGACAAGGGGACTGG + Intergenic
931890044 2:66661731-66661753 GTCAGTGTGGGGAAGTGGGATGG + Intergenic
931989850 2:67779154-67779176 CTCTTTGTGGCGTAGGGGGCAGG + Intergenic
932179163 2:69630321-69630343 CTCTGAGTGGGGCGGGGGGTGGG + Intronic
932491942 2:72127993-72128015 CCCAGGGTGGGGAAAGGGGCAGG - Intergenic
932492731 2:72132143-72132165 ACCTGTGTGTGGGAGGGGGCCGG - Exonic
932572155 2:72943758-72943780 CTCTGGACTGGGAAGGGGGCAGG - Exonic
932837402 2:75050453-75050475 CTCTGGATGGGGAAGGAGGCGGG - Intronic
933694862 2:85210235-85210257 ATGTGTGTGGGGAAGGGGCCAGG - Intronic
934559772 2:95307079-95307101 CTCTTTGTGAGGCAGGGGGTGGG - Intronic
934781216 2:96970950-96970972 CTGGGGGTGGGGATGGGGGCAGG - Intronic
935982028 2:108636804-108636826 CTCTGTGTGGGGAGAGAGGAAGG + Intronic
936097832 2:109547050-109547072 CCCTGGTTGGGGAAGGGGGCTGG - Intronic
936522126 2:113218003-113218025 CTCCGTGTGGGGCAGGCGGGAGG + Exonic
937216696 2:120317669-120317691 ATATATGAGGGGAAGGGGGCAGG - Intergenic
937227546 2:120378442-120378464 CTCTGACTGGGGTAGGGGGTAGG + Intergenic
937350345 2:121156534-121156556 CTCTTGGTGGGGAAGGGGGCCGG - Intergenic
937597188 2:123686407-123686429 AGATGTGTGGGGTAGGGGGCAGG - Intergenic
937628388 2:124069249-124069271 CTCTGACTGTGGAAGGGGGAAGG + Intronic
937879638 2:126855874-126855896 CTCTGTGTAGGGAAGGTGGGAGG - Intergenic
937906656 2:127055860-127055882 CTTTGGGTGGGGCATGGGGCAGG - Intronic
937985576 2:127636725-127636747 CTCTGTGTGTGTTAGGGGACAGG - Intronic
938573785 2:132585549-132585571 CTGTGTGTGCGGACGGGGCCTGG + Intronic
938755710 2:134377189-134377211 CACAGTGTGGGGTATGGGGCTGG + Intronic
938779812 2:134575039-134575061 CTCTGTGGGGGGGTGGGGGAAGG + Intronic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
941528197 2:166631999-166632021 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
944454422 2:199878541-199878563 CTCTCAGTGGGAAAGGGAGCTGG + Intergenic
944977250 2:205068160-205068182 CTCTGTTTGGGGATGGGGCAGGG + Intronic
946231686 2:218295448-218295470 CCCAGTGTGGGGAATGGGGTGGG + Intronic
946388734 2:219402451-219402473 CTCTGTGTGGCTGAGGGGGAGGG - Intergenic
946412722 2:219523016-219523038 CTGTGTGTGCGGGAGAGGGCGGG + Intronic
947731549 2:232434228-232434250 TCCTGTGTGGGGAAGGGGTGAGG + Intergenic
948504006 2:238415627-238415649 CTCTGTGTGGGGCTTGTGGCTGG + Intergenic
948614913 2:239192229-239192251 CTATGTGTGGGGTGGGGGGTGGG - Intronic
1169046336 20:2537044-2537066 CTCTGTGCAGGGCAGGGGGTGGG + Intronic
1169530157 20:6476513-6476535 CTCTGTGTGTGGTGGGGGGATGG + Intergenic
1170273263 20:14552312-14552334 CTCTATGTGGGGGTGGGGGTGGG + Intronic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1170748723 20:19124701-19124723 TTCTGTGGGGGGGCGGGGGCGGG - Intergenic
1171442998 20:25180987-25181009 CCTGTTGTGGGGAAGGGGGCAGG - Intergenic
1172034325 20:32000855-32000877 CCCTGTGTGGGGGAGTGGGGAGG - Exonic
1172163828 20:32886654-32886676 TTCTGTGTGTGGACTGGGGCAGG + Intronic
1172198092 20:33105789-33105811 CTCTGTGAGAGGATGGGGTCAGG + Intronic
1172328653 20:34058076-34058098 CTTTTTGAGGGGAAGGGGGCCGG + Intronic
1172488773 20:35317231-35317253 CTGTGTGTAGGAAAGGGGCCGGG - Intronic
1172515191 20:35528404-35528426 CTCTGTGTGGGGGTGAGGGGAGG - Intronic
1172846095 20:37930741-37930763 CTCTGCATGGGGCAGGAGGCAGG + Intronic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173766240 20:45612274-45612296 CTCTGTGTGTGGAGGGAGACAGG + Intronic
1173911518 20:46674353-46674375 CTCACTATGGGGAAGGGGGCAGG + Intronic
1174363788 20:50044177-50044199 CCCTGGGTGGGGGTGGGGGCTGG + Intergenic
1175001764 20:55636796-55636818 CTTTGTGTGTGGGAGGGAGCAGG - Intergenic
1175084252 20:56445578-56445600 CTCTGGGTGTCGAGGGGGGCCGG - Intronic
1175222570 20:57425819-57425841 CTCTGGGAGCGGAAGGGCGCAGG - Intergenic
1175700642 20:61134489-61134511 ATCTGTGTGGGGCAGGGGACGGG - Intergenic
1175931012 20:62493720-62493742 CGCTGTGCAGGGAAGAGGGCAGG + Intergenic
1175981611 20:62741508-62741530 CATGGTGTGGGGCAGGGGGCCGG - Intronic
1175987890 20:62773067-62773089 CTCTGTGCTGGGGAGGGGGCAGG + Intergenic
1176058745 20:63162555-63162577 CTCTGTCTGGGGTAGGGGGTGGG - Intergenic
1176450597 21:6858431-6858453 CGGTGTCCGGGGAAGGGGGCGGG - Intergenic
1176828767 21:13723449-13723471 CGGTGTCCGGGGAAGGGGGCGGG - Intergenic
1176940286 21:14915634-14915656 CTGTGTGTGTGGATGGGGGTGGG + Intergenic
1177746103 21:25214875-25214897 CTCTCTGTGGGAACCGGGGCGGG - Intergenic
1177773203 21:25539731-25539753 CTCTGTGTGGGGCTTGTGGCTGG - Intergenic
1177819632 21:26016925-26016947 CTTTGTGGGGGGCGGGGGGCGGG + Intronic
1178331202 21:31694055-31694077 ATATGTGTGTAGAAGGGGGCAGG - Intronic
1178337715 21:31758633-31758655 ATCTGTGAGGTGATGGGGGCTGG - Intergenic
1178351702 21:31876217-31876239 CTTTGGGTGGAGAAGGAGGCAGG + Intronic
1178437970 21:32576006-32576028 CTGTGTGTGGGGTGGAGGGCTGG + Intergenic
1178710918 21:34916030-34916052 GTGTGTGTGGGGAAGGGGAGAGG + Intronic
1179474119 21:41632423-41632445 CTCTGTGTGGTTGATGGGGCTGG + Intergenic
1179511479 21:41876894-41876916 CTGTGTGTGGGGAATGGAGCTGG - Intronic
1179587755 21:42384495-42384517 CTGTGTGTGGGGGTGGGGGTAGG - Intronic
1180115512 21:45701252-45701274 CTCAGTGTGAGGAAAGGGACAGG + Intronic
1180439523 22:15351370-15351392 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1181100003 22:20532663-20532685 CTCTAGCTGAGGAAGGGGGCTGG - Intronic
1181422428 22:22811137-22811159 ATCTATGTGGGGATGGGGGATGG + Intronic
1181580702 22:23826513-23826535 CTCTGTGTTGGGATGGGGTGGGG + Intronic
1181620839 22:24090153-24090175 CCCTGTATGGGGAAGGGGTGGGG + Intronic
1182554196 22:31120243-31120265 CTCTTGGTGGGGGAGGGGGGTGG - Intergenic
1183303653 22:37070647-37070669 CACAGTCTGGGGATGGGGGCAGG + Exonic
1183404972 22:37625944-37625966 CTCTGGGTGAGGAAGGGGCCAGG + Exonic
1183590293 22:38775895-38775917 CTGTCTGTGGGGGACGGGGCAGG + Intronic
1183897186 22:40978736-40978758 CTCTGGGTGGGTAAGGGGACAGG - Intergenic
1183960177 22:41406717-41406739 CTCTGTATGGGGAAGAGGGGAGG - Intergenic
1184021961 22:41826928-41826950 CTCTGTCAGTGGTAGGGGGCTGG - Intergenic
1184243888 22:43226355-43226377 CTCTGGGTGGGTGATGGGGCAGG + Intronic
1184464227 22:44659533-44659555 CTGACTGTGGGGAAGAGGGCAGG - Intergenic
1184561742 22:45268024-45268046 CTCTGTGTGCGGCAGAGGGAAGG - Intergenic
1184606341 22:45576811-45576833 CCCTGTGTGGGGAGGGTGGAGGG - Intronic
1185205061 22:49533177-49533199 GGCTGTGTGGAGAAGGGGCCGGG - Intronic
1185225663 22:49650610-49650632 CTGTGTGTGGAGAAGGGTGGAGG + Intronic
1185296169 22:50056389-50056411 CTGCGGGTGGGGACGGGGGCGGG + Intronic
949238142 3:1836131-1836153 CTTTTTTTGGGGGAGGGGGCGGG + Intergenic
949952217 3:9238689-9238711 CTCTGCCTGGGGAAGGGATCCGG - Intronic
950083277 3:10238929-10238951 CTCTGTGGGGAGAAGTGGGGTGG - Exonic
950096076 3:10331425-10331447 GTATGTGTGGGGCAGGGGGATGG + Intronic
950104462 3:10379409-10379431 CTCTGTGTGGGGATACGGGTTGG + Intronic
950176230 3:10876748-10876770 CTCTGTGTGGGAGGTGGGGCGGG - Intronic
950426492 3:12927380-12927402 ACCTGTGTGGGGAAGGGACCAGG - Intronic
950567947 3:13782359-13782381 CTCTGTGTGGGGAGGGAGGTCGG - Intergenic
950612909 3:14137518-14137540 CCTTGTGTGGGGGTGGGGGCTGG - Intronic
951235827 3:20235364-20235386 CTCTGTGTGGGGAAGAGGGTGGG + Intergenic
951494854 3:23315189-23315211 CTCTGCCTGGGGAAAGGGGAGGG - Intronic
952838905 3:37627934-37627956 CTGCCTCTGGGGAAGGGGGCTGG + Intronic
952886976 3:38018003-38018025 CTCTGTGTGGGTGAGGGCGCTGG - Intronic
953119241 3:40023722-40023744 CTCTGTGTAGCACAGGGGGCTGG - Intronic
953184438 3:40625143-40625165 GCCTGTGTGGGGAAGGTGGGAGG + Intergenic
953376428 3:42432065-42432087 CTTGGTCTAGGGAAGGGGGCAGG + Intergenic
953906735 3:46872180-46872202 CTCAGTGAGGGGCAGAGGGCTGG + Intronic
954643218 3:52114688-52114710 CTCTGTGTGGCATAGGGGGCAGG + Intronic
954787558 3:53105412-53105434 CTCTTTTTGGGGGGGGGGGCGGG - Intronic
955312310 3:57901291-57901313 CTCTGTGTGGTAAATGGGGGAGG - Intronic
955479472 3:59374791-59374813 CTCTGTGTGAGGAATTGGGCTGG - Intergenic
955956265 3:64293108-64293130 CCCGGTGTGGGGTAGGGGGTGGG + Intronic
956182112 3:66527284-66527306 CTCTGTATGGGGTGGGGGGCGGG + Intergenic
956427937 3:69155803-69155825 GTGGGTGTGGGGAAGGGGTCAGG + Intergenic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
958033390 3:88142013-88142035 GTGTGTGTGGGGAGGGGGGCTGG + Exonic
958151014 3:89695536-89695558 CTGTGTGTAGGGAGAGGGGCAGG - Intergenic
958265643 3:91434319-91434341 GTGACTGTGGGGAAGGGGGCAGG - Intergenic
958595374 3:96215961-96215983 CTCTGAGTGGGGAATGAGGTAGG - Intergenic
958632559 3:96701619-96701641 CGCTGGGTGGGGAGGGGGGCGGG - Intergenic
959547386 3:107612981-107613003 CTCTGCCTGGGGAAAGGGGAGGG - Intronic
959839707 3:110960140-110960162 CTTGGGGAGGGGAAGGGGGCTGG + Intergenic
960067780 3:113393438-113393460 CCCTAGGTGGGGAAGGGGGTGGG + Intronic
960973670 3:123156396-123156418 CTCAGTGCAGGGAAAGGGGCAGG - Intronic
961378690 3:126483259-126483281 CTGGGTGTGGGGATGGGGGCCGG - Intronic
961631657 3:128304483-128304505 GTCTGTTTTGGGAAGGTGGCGGG - Intronic
962025116 3:131539685-131539707 GTGTGTGTGGGGAAGTGGGGAGG + Intronic
962767641 3:138580117-138580139 CTCTGCCTGGGGAAAGGGGAGGG + Intronic
963266724 3:143247105-143247127 CTCTCTGTGGGGAGAGGGGTAGG - Intergenic
963525513 3:146410169-146410191 AGATGTGTGGGGTAGGGGGCAGG + Intronic
963541877 3:146601751-146601773 TTGTGTGTGGGGCAGGGGGGTGG + Intronic
963810154 3:149768546-149768568 CTCTGTCTGGGGAGGGGGGATGG - Intronic
964774078 3:160256099-160256121 CTCTGGGCGGAGGAGGGGGCTGG + Intronic
965102960 3:164326324-164326346 CCCTCTGTGGGGAACGGGGGAGG + Intergenic
965499753 3:169443358-169443380 CTCTGTGGGGGGAAGGGAAGGGG + Intronic
965814637 3:172624117-172624139 CTCTTCGTGGGGGAGGGGGAAGG - Intergenic
966421012 3:179733988-179734010 CTCAGTGTGTGGATGGTGGCAGG + Intronic
966975085 3:185076009-185076031 CTCTGTGTGGTGGACAGGGCAGG - Intergenic
967234077 3:187367701-187367723 CTCTCTGTGGGGCAGGGCTCGGG - Intergenic
967282304 3:187834042-187834064 CCCTGTGTGAAGAAGGTGGCTGG + Intergenic
968039245 3:195574509-195574531 CACTGTGTGGGGAAGGTCGAGGG + Intronic
968089242 3:195889906-195889928 CGCTGAGTGGGGGAGGGGGATGG - Intronic
968092388 3:195907496-195907518 CCCTGGGTGGGGATGGGTGCAGG - Intronic
968129517 3:196184756-196184778 CTCTGGGCGGGGAATGGGGTGGG + Intergenic
968175582 3:196546859-196546881 CTCTTGGTGAGGAAAGGGGCTGG - Intergenic
968485934 4:861778-861800 CTCTGTATGGGCAGTGGGGCTGG - Intronic
968614816 4:1572653-1572675 CTTGGTCGGGGGAAGGGGGCTGG + Intergenic
968761678 4:2445458-2445480 CTCTCTGTGGGGAGTGGGGGTGG - Intronic
968904734 4:3445975-3445997 GCCTGTGTGTGGAAGGGGGCTGG + Intronic
969470862 4:7388546-7388568 CTGTGGGTGGGGAAGCGGGGAGG - Intronic
969591767 4:8126283-8126305 CTCTGTGTGGGCACGAGGCCTGG - Intronic
969606287 4:8203884-8203906 CTCTGGGCGGGGAACGTGGCAGG - Intronic
970431100 4:15989944-15989966 CTGTGAGTGGGCATGGGGGCTGG + Intronic
970578055 4:17446928-17446950 CTCTTTGTTGGGGAGGGGTCTGG - Intergenic
970919781 4:21380395-21380417 CTCTGTGTGTGGCAGGGTGGGGG + Intronic
971713002 4:30141323-30141345 GTGTGTGTGGGGCAGGGGGCAGG + Intergenic
972288828 4:37672167-37672189 CTCTGGGAAGGGAAAGGGGCTGG - Intronic
972290613 4:37686714-37686736 CTGTGGGTGGGGAAAAGGGCGGG - Intergenic
972745503 4:41928279-41928301 GTGTGTGTGGGGATGGGGGTGGG + Intergenic
972787998 4:42345472-42345494 CACTGTGTGGGGCAGAGGACAGG - Intergenic
973936134 4:55848716-55848738 CTCTTTGTGGGGGTGGGGGGTGG - Intergenic
973993734 4:56436211-56436233 CGCTGGGCGGGGAAGGAGGCGGG - Exonic
975147114 4:70980618-70980640 CACTCTGTGGGGAGGGGTGCAGG - Intronic
975389443 4:73799679-73799701 CTCTATGTGGGGAAGGAGAGTGG + Intergenic
975769311 4:77704110-77704132 TTCTTTGTGGGGGAGGGGGAAGG - Intergenic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
976441136 4:85076075-85076097 CTGTGTGTTGGGTGGGGGGCAGG - Intergenic
976470568 4:85423978-85424000 CTGTGTGTGTGGAAGGGGGGCGG + Intergenic
977292961 4:95182937-95182959 CTCTGTGTGCGGCAGGTGGAAGG - Exonic
977969539 4:103197962-103197984 CTCTAGGCGGGGAATGGGGCAGG + Intronic
978560739 4:110031035-110031057 GTGTGTGTGTGGGAGGGGGCTGG + Intergenic
979238095 4:118424201-118424223 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
979324432 4:119362108-119362130 TTCTGTGATGGGAAGGGGTCAGG + Intergenic
979395094 4:120178160-120178182 CTCTGTTTGTGGAAAGGGGAGGG + Intergenic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
980456831 4:133055007-133055029 CACTGTGGGGGGAGGGGGGAGGG + Intergenic
980524818 4:133976105-133976127 CTCTGTTGGGGGAAGGTGGCAGG - Intergenic
981104624 4:140866426-140866448 CTATGTGTGGGAAAAGAGGCAGG - Exonic
981183391 4:141772352-141772374 CTGTGTGTGGGGGTGGGGGGAGG - Intergenic
981923464 4:150112815-150112837 CTCTGTCCGGGGCGGGGGGCGGG - Intronic
982284973 4:153724985-153725007 AGCTGTGTGGGGGAGCGGGCAGG + Intronic
982455409 4:155603706-155603728 CAGTGTGTGGGGCAGGGGGACGG + Intergenic
982671045 4:158320404-158320426 CTCTGAGTGGGAAGGGGAGCTGG + Intronic
983403366 4:167294293-167294315 CTCGGTGTGGGGAATGGGGTGGG - Intergenic
983467429 4:168112289-168112311 CTCTGTCTGGGGTGGCGGGCTGG + Intronic
983653078 4:170052932-170052954 GTCTGTGGGGAGAAGGGGACAGG + Intergenic
984854777 4:184185468-184185490 CTCTGTGTGGGGTAGCAGGGAGG + Intronic
984991535 4:185385892-185385914 CTCTGTCTCGGGGAGGGGGGGGG + Intronic
985139265 4:186822088-186822110 CGCGGTATGGGGAAAGGGGCTGG + Intergenic
985203128 4:187505312-187505334 TTCTGGGTGGGGAAGGCCGCTGG - Intergenic
985428621 4:189855999-189856021 TTCTGTGTGTGGCAGGCGGCAGG + Intergenic
985519425 5:366064-366086 GTGTGTGTGGGGCAGGGGGTGGG - Intronic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985754027 5:1702482-1702504 CTCTGTGTGGGGGTGGGAGCAGG + Intergenic
985767460 5:1787501-1787523 CTCTGTGTGGGGAGGTGGCGGGG - Intergenic
986286818 5:6365295-6365317 CTCTGTGAGTGGAATGGGTCTGG + Intergenic
986761686 5:10885681-10885703 TCCTTTGTGGGGAAGGGGGATGG - Intergenic
987031531 5:13980695-13980717 CTCTGTGTGGGAAAGTGGAAGGG - Intergenic
987264952 5:16243675-16243697 GTGTGTGTGGGGGTGGGGGCAGG - Intergenic
988483099 5:31645937-31645959 CTCAGTAGGGGGAAGGGGGTGGG + Intronic
988798324 5:34673306-34673328 CTGTGTGAGGGCAATGGGGCAGG + Intronic
989164922 5:38424420-38424442 CTCTGTCTGGGGTAGGGAGCAGG - Intronic
989612820 5:43312002-43312024 TTTTGTGTGAAGAAGGGGGCAGG - Intronic
989736221 5:44710134-44710156 TTTTGTGTGGGGAAGGTGGAAGG - Intergenic
990223019 5:53617046-53617068 CCCTTGGTGGAGAAGGGGGCAGG - Intronic
990888734 5:60624892-60624914 CTGTGTGGGGGGTCGGGGGCAGG - Intronic
990951747 5:61305243-61305265 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
992523153 5:77577302-77577324 TTTGGTGGGGGGAAGGGGGCAGG - Intronic
992896777 5:81252674-81252696 CGCTGTGTGGGGAGGAGGGCAGG - Exonic
993384700 5:87251061-87251083 CTGTGTGGGGGGATGGGGGGTGG - Intergenic
994422013 5:99534271-99534293 CTCTGTGTAGGGATAGTGGCTGG - Intergenic
994591829 5:101783562-101783584 TTCTCTGTGAGGAAGGGGGAAGG - Intergenic
995039361 5:107570643-107570665 GTGTGTGTGGGGGTGGGGGCGGG + Intronic
995260071 5:110093458-110093480 CTCTGTGTGGGCAAGGAGAGAGG + Intergenic
996111288 5:119569694-119569716 GTCTGTGTGGGGATGGGGGTGGG + Intronic
996118149 5:119641969-119641991 CTCTGTGTGGGGGTGGGGGGGGG - Intergenic
997111413 5:131078969-131078991 CTCTGGCAGGGGATGGGGGCAGG - Intergenic
997300714 5:132802203-132802225 GTCTGTGTGGTGGAGGGAGCAGG - Intronic
997335487 5:133106154-133106176 GTGTGTGTGGGGAAGGGTGTGGG + Exonic
997691598 5:135831117-135831139 CTCTGTGGGGGAAATGTGGCTGG + Intergenic
998005100 5:138651525-138651547 GTGTGTGTGGGGGTGGGGGCAGG - Intronic
998037924 5:138932392-138932414 CTCTGCTTGGGGATGGAGGCGGG - Intronic
998507787 5:142686087-142686109 CTCTGAGTGGGGAGAGGGACGGG + Intronic
998660764 5:144234840-144234862 TTTTGTCTGTGGAAGGGGGCAGG - Intronic
998679037 5:144444201-144444223 CTTTGTGTGTGGAGGGGGGAGGG - Intronic
999246910 5:150159975-150159997 CTCTCAGTGGGGCAGGGGGAGGG + Intergenic
999267401 5:150275909-150275931 CTCAGGGAGGGGAGGGGGGCTGG - Intronic
999276423 5:150333685-150333707 CTGTGTGGGGTGAAGGGAGCAGG - Intronic
999629337 5:153553984-153554006 AACTGGGTGGGGAAGGGGGAGGG - Intronic
1000014823 5:157267011-157267033 CTCTGCTTGGGGATGGGGGCAGG + Intronic
1000245953 5:159448736-159448758 CTCTGAGAGGGGAAGGAAGCGGG + Intergenic
1001269739 5:170302305-170302327 CTGTGTGTGGGGCTGGGGGAAGG + Intergenic
1001406999 5:171483569-171483591 GTCTGAGTAGGGAAGGGAGCTGG + Intergenic
1001865510 5:175100884-175100906 ATGTGTGTGGGGTGGGGGGCGGG - Intergenic
1001936066 5:175706872-175706894 CTCTCTATGTGGAAGGGGGAGGG + Intergenic
1001951646 5:175820654-175820676 GGCTGTGTGTGGTAGGGGGCGGG - Intronic
1002058877 5:176614459-176614481 CTCTGTGTGTGGGGGGGGGAGGG + Intergenic
1002705585 5:181159434-181159456 TCCTGGGTGGGGAAGGGTGCTGG - Intergenic
1002738522 5:181416177-181416199 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1003322921 6:5068367-5068389 CTCTGTGTGGGGTGAGGGGCCGG - Intergenic
1003411014 6:5863034-5863056 CTCTGTGAGGAGCAGAGGGCAGG + Intergenic
1003514115 6:6804247-6804269 CTATGGGAGGGGAAGGAGGCAGG + Intergenic
1003637297 6:7844601-7844623 CTGCGGGTGGGGAAGGGGGGTGG - Intronic
1004284153 6:14305088-14305110 CTCTGTGCTGGGAAGAAGGCAGG + Intergenic
1004368110 6:15029081-15029103 CACTGTGTGGGAAGGAGGGCAGG - Intergenic
1005200887 6:23342802-23342824 CTCTTTGTGGGTTGGGGGGCTGG - Intergenic
1005227537 6:23659838-23659860 GTTTGTGTGGAGAAGTGGGCTGG - Intergenic
1005507331 6:26481222-26481244 CAGTTTGTGTGGAAGGGGGCAGG - Intergenic
1005570875 6:27144453-27144475 CTCTGTCTGGGGGGGGGGGGGGG + Intergenic
1005919744 6:30390161-30390183 CTGTGTGTGTGGTGGGGGGCGGG + Intergenic
1006119852 6:31797353-31797375 CTATGTGTTGGGCAGGGGGCTGG - Intergenic
1006376316 6:33673499-33673521 CTTTATGGGGGGCAGGGGGCAGG - Intronic
1006432815 6:34008189-34008211 CCCTGGGGTGGGAAGGGGGCTGG - Intergenic
1006505287 6:34485375-34485397 CTCCGAGTGGGACAGGGGGCTGG + Intronic
1007380261 6:41485720-41485742 GTTGGGGTGGGGAAGGGGGCAGG - Intergenic
1007393982 6:41566796-41566818 CCTTGAGTGGGGCAGGGGGCGGG + Intronic
1007395066 6:41573115-41573137 CTCTGTGTGTGCAGGAGGGCAGG - Intronic
1008906658 6:56684989-56685011 TTCTGTGTGGGGTGGGGGGGTGG - Intronic
1008989724 6:57588335-57588357 GTGACTGTGGGGAAGGGGGCAGG + Intronic
1009178307 6:60486879-60486901 GTGACTGTGGGGAAGGGGGCAGG + Intergenic
1009524670 6:64728880-64728902 CTCTCTGTGGGGAGGGGAGCTGG + Intronic
1011673114 6:89703356-89703378 CCATGTATGGGGAAGGGGGGGGG + Intronic
1011746888 6:90415066-90415088 TTCTGTGTAGGGAAGGGGGCTGG + Intergenic
1012237899 6:96838606-96838628 CTCTGTCTGAGGAGGTGGGCAGG + Intergenic
1012246308 6:96930062-96930084 ATCTGGGTGGGGAAGGGAGGGGG - Intronic
1012541118 6:100363046-100363068 GTGTGTGTGGGGAGAGGGGCAGG - Intergenic
1013524131 6:110958882-110958904 CTGTGTGTGGGGAAGGGAGTTGG + Intronic
1013734056 6:113205353-113205375 GTGTGTGTGGTGAAGGGTGCAGG + Intergenic
1015274098 6:131366732-131366754 CCCTGAGTGGGGCAGGGGGAAGG + Intergenic
1015685113 6:135850685-135850707 CTCTGTCGTGGGAATGGGGCTGG + Intergenic
1016152522 6:140760393-140760415 CTCTGAGCTGGGAAGAGGGCAGG + Intergenic
1016189205 6:141240267-141240289 CCCTGTGTGGCCACGGGGGCAGG + Intergenic
1016456327 6:144234687-144234709 TCCAGGGTGGGGAAGGGGGCTGG + Intergenic
1016741409 6:147533071-147533093 CCTTGGGTTGGGAAGGGGGCTGG + Intronic
1016839196 6:148508802-148508824 CTCCGAGTGGGGAGGGGGGTGGG + Intronic
1017631401 6:156399405-156399427 ACCTTGGTGGGGAAGGGGGCTGG + Intergenic
1018138921 6:160807279-160807301 CTCAGTTTGGGGAAAGGGGTGGG - Intergenic
1018630035 6:165814348-165814370 CCCTGTGTGGAGCAAGGGGCTGG - Intronic
1018750341 6:166798765-166798787 CTGTCTGTGGAGAAGGGGGCAGG - Intronic
1018828416 6:167424072-167424094 CTCTGTGTGGGGGAGCCGCCGGG - Intergenic
1018921297 6:168177708-168177730 GCCTGCGTGGGGAAGGAGGCAGG - Intergenic
1018926436 6:168209932-168209954 CTCTGTGGGGAGCAGGAGGCCGG - Intergenic
1019243625 6:170691729-170691751 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1019388259 7:770753-770775 CTCAGTGTGGGGGAGGGAGATGG - Intronic
1019442745 7:1055693-1055715 CTCTGTGGGGTGAAGGTGGCCGG + Intronic
1019598353 7:1868886-1868908 GTCCGTGTGGGGAAGAGGCCAGG - Intronic
1019811340 7:3167374-3167396 CTGTGTGTGGGGATGGGGATGGG - Intronic
1019851324 7:3561073-3561095 CTAGGGGTGGGGAAGGGGGAAGG - Intronic
1019911401 7:4102504-4102526 CTGCGTGTGGGGAAGGGAGGAGG - Intronic
1019982649 7:4632786-4632808 TTTTGTGGGGGGAAGGTGGCAGG + Intergenic
1020012519 7:4814523-4814545 GACTGTGTTGGGAAGGGGGGTGG + Intronic
1020096338 7:5371429-5371451 CTCTGTCTGGGGTGGTGGGCGGG - Intronic
1020247135 7:6438463-6438485 CTCTGAGGGGGAAAGGGTGCAGG + Intronic
1021006074 7:15396617-15396639 GGATGTGTGGGGGAGGGGGCGGG - Intronic
1021710141 7:23407934-23407956 ATTTGTGGGGGGCAGGGGGCGGG + Intronic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022366916 7:29730435-29730457 CTCTGCCTGGGGAAAGGGGAAGG - Intergenic
1022418066 7:30195273-30195295 GTCTGGGTGAGGCAGGGGGCAGG + Intergenic
1023522815 7:41065845-41065867 CTGTGGGTGGGGAAGGCGGGAGG + Intergenic
1023990936 7:45127853-45127875 CTAGGTGTGGGGTGGGGGGCAGG - Intergenic
1026140188 7:67699065-67699087 CTCTGTTGGGGGAAGTGGGGTGG + Intergenic
1026877466 7:73887693-73887715 CTCAGTCTGGGGTAGGGGTCAGG + Intergenic
1026894565 7:74002811-74002833 CTCTGGGTGAGGCAGGAGGCTGG - Intergenic
1026897468 7:74018534-74018556 CTCTGGGAGGGGCAGGGGGCAGG + Intergenic
1027173290 7:75888005-75888027 CTCTGTGTGGGGTAGGAGCCAGG - Exonic
1027190988 7:75995286-75995308 CTCTGTGGAGGGATGGGGGTGGG - Intergenic
1027232233 7:76279551-76279573 CTCTGTGTAGGGAGGGAGACAGG + Intronic
1027699810 7:81455991-81456013 GTGTGTGTGGGGGAGGGGGTGGG + Intergenic
1027996168 7:85427517-85427539 CTCTGTCTGTGGAAAGGGGAAGG + Intergenic
1028561486 7:92180391-92180413 CTGGGTGTGGAAAAGGGGGCTGG - Intergenic
1028899242 7:96077267-96077289 GTGTGTGTGTGGGAGGGGGCAGG + Intronic
1029148481 7:98463562-98463584 CACTGGGTTGGGGAGGGGGCAGG + Intergenic
1029188301 7:98754944-98754966 TTCTGTGCGGGGGGGGGGGCGGG - Intergenic
1029278007 7:99418987-99419009 CTCTGGTGGGGGAAGAGGGCAGG - Exonic
1029825348 7:103187020-103187042 CTCTGCCTGGGGAAAGGGGAAGG + Intergenic
1030504902 7:110408986-110409008 CACTGTGTGGGGTGGGGGGGCGG + Intergenic
1030547562 7:110916607-110916629 ATCTGTGTGGGGATGGAGGAAGG - Intronic
1031452345 7:121937438-121937460 CTCTGGGTGGGGAAGGCCCCAGG - Intronic
1031944873 7:127829212-127829234 AACTATGTGGGGGAGGGGGCAGG - Intronic
1032132249 7:129239888-129239910 CTCTGTGTGTGGGAAGGGACTGG - Intronic
1032398611 7:131608326-131608348 CTCTGTCTGTTGAAGGGGGATGG + Intergenic
1032442069 7:131949720-131949742 GTCTCTGTGGGGATGGGGGAGGG - Intergenic
1032472688 7:132189825-132189847 CTCTGTGTGAGGGATGGGGGTGG + Intronic
1032582554 7:133116863-133116885 GTGTGTGTGGGGAGGGGGGGCGG - Intergenic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033492348 7:141855716-141855738 CTCTGTGTGGGGAAGGCATACGG - Intergenic
1033658294 7:143387673-143387695 CTCTGTGTGGGGGTGGGGCTGGG + Intronic
1033840669 7:145369960-145369982 TTGTGGGTGGGGAAGGGGTCTGG + Intergenic
1034356467 7:150454147-150454169 CAATGTGAGGGGAAGGGGGTGGG + Intronic
1034487068 7:151372706-151372728 CTCAGTGTGGGGAGGTGGTCAGG + Intronic
1034570892 7:151955556-151955578 GTCTGTGAGTGGAAGGGGGTGGG - Intergenic
1035026959 7:155832557-155832579 CTCGGGGTTGGGAAAGGGGCTGG - Intergenic
1035051130 7:155999566-155999588 CCCTGGGAGGGGAAGGTGGCTGG + Intergenic
1035204684 7:157287502-157287524 GTCTGTCTGGGGAAAGGGTCAGG - Intergenic
1035243319 7:157546425-157546447 CTGTCAGTGGGGAAGGGGGATGG - Intronic
1035414432 7:158671072-158671094 CTCTGTGTGGGGCAGGGGGGTGG + Intronic
1035414455 7:158671154-158671176 CTCTGTGTGGGGCAGGGGGGTGG + Intronic
1035504497 8:116431-116453 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
1035601320 8:898543-898565 CTGTGTGCAGGGAAGGGGCCTGG + Intergenic
1035661123 8:1349541-1349563 ATCTGTGTGTGGATGTGGGCGGG - Intergenic
1036050704 8:5192994-5193016 CTGTTTGTGGGGTAGGGGGACGG + Intergenic
1036183709 8:6606569-6606591 CTCCCTGTGTGGGAGGGGGCAGG - Intronic
1036558817 8:9884241-9884263 ATCTGTGTGGGGCAAGGGGGTGG + Intergenic
1036700352 8:11009079-11009101 AGCTGTGTGGGGAGGGGGGTGGG + Intronic
1037002948 8:13743129-13743151 GTGTGTGTGGGGAGGGGGGCTGG + Intergenic
1037544116 8:19900840-19900862 CTGTTTGTGGGGAAGGGTGGAGG + Intergenic
1037926512 8:22847688-22847710 ATCTTTGTAGGGAAGGGGACAGG - Intronic
1038229491 8:25687020-25687042 CTCTGTGTGGGGTAGAGAGGAGG - Intergenic
1038516052 8:28188472-28188494 CTCCGGGGAGGGAAGGGGGCTGG + Intronic
1038592198 8:28849655-28849677 CACTGTGTGGGGAACGGTCCAGG - Intronic
1039358573 8:36848874-36848896 ATATGTGTGGGGGAGGGGGGTGG + Intronic
1041171595 8:55147959-55147981 CTCTCAGTGGGGACAGGGGCTGG + Intronic
1041292362 8:56319778-56319800 CTCCGGGTGGGGAGGGAGGCTGG + Intronic
1041389873 8:57338773-57338795 CTCTGTGAGGTGGTGGGGGCTGG - Intergenic
1041406226 8:57502184-57502206 CTGTGTGTGGGGTTGGGGGCAGG + Intergenic
1041684179 8:60627504-60627526 ATCTGGGTGGGGAAGGAGGGAGG - Intergenic
1042106049 8:65327259-65327281 TACTGTGTGGGGAACGGGGTTGG - Intergenic
1042140748 8:65676142-65676164 GTGTGTGTTGGGAAGGGGGAAGG - Intronic
1042557328 8:70044416-70044438 TTCTGTGTGGGGAAGGTAGGGGG - Intergenic
1042670262 8:71254841-71254863 CTGTGTGTGTGGTGGGGGGCGGG - Intronic
1043866704 8:85383101-85383123 CTCCTTGTGGGGCAGGGTGCAGG - Intronic
1044727932 8:95208176-95208198 GTGTGTGTGGGGGAGGGGGGGGG + Intergenic
1044832383 8:96262307-96262329 CTCTGGGTGAGGAAGTGGGCTGG + Intronic
1045041258 8:98227001-98227023 CTCTGCCTGGGGAAAGGGGAGGG - Intronic
1045724839 8:105160077-105160099 CTCTGTGTCTGGAAGGTGGTAGG + Intronic
1047336900 8:123944763-123944785 CCCTGTGAGGGAAAGGAGGCTGG - Intronic
1047442371 8:124889328-124889350 CTCTTTGTGGGGTAGGGGTGGGG + Intergenic
1047663908 8:127068708-127068730 CTCTTTCTGGGGAAAAGGGCAGG + Intergenic
1047885297 8:129243678-129243700 GTGTGTGTGGGGGCGGGGGCAGG + Intergenic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048298502 8:133234294-133234316 GTATGTGGGGGGAAGGGGGCAGG + Intergenic
1048832134 8:138487627-138487649 GTGTGTGTGGGGGTGGGGGCGGG + Intronic
1048885747 8:138908039-138908061 CTTTGTGTGGGGGAGTGGGGAGG - Intronic
1048976228 8:139674498-139674520 CTCTGTGAGGGGCAGGGACCCGG + Intronic
1049368265 8:142251324-142251346 TTTTGTGGGGGGAGGGGGGCGGG - Intronic
1049426756 8:142541192-142541214 CTCTGTCAGGGGCAGGCGGCTGG + Intronic
1049441335 8:142611139-142611161 GTCTGTGTGGGGCAAGGGGCAGG + Exonic
1049497864 8:142945114-142945136 CTCTGGGTGGGCAGGTGGGCAGG - Intergenic
1049577776 8:143397660-143397682 CACAGGGTGGGGACGGGGGCTGG - Intergenic
1049694497 8:143976797-143976819 CTCTGGGTGGGGGCCGGGGCGGG - Intergenic
1050296119 9:4207184-4207206 CTCTGTGTCGGGAGGGGAGGTGG - Intronic
1050618563 9:7429117-7429139 CTCTGCTTGAGGAAGGGGGAGGG - Intergenic
1050727856 9:8672839-8672861 CTCTGTGTGGGGGGGGTGGGTGG + Intronic
1051053404 9:12956196-12956218 CCTTGAGTGGGGATGGGGGCGGG - Intergenic
1052102279 9:24463222-24463244 ATCTGTGGGGGGAAAGGGGAAGG - Intergenic
1053004115 9:34593150-34593172 CACTGTGTGAGGAAGCAGGCGGG - Intergenic
1053141079 9:35683084-35683106 CTCTCTATGGGGAGGGGAGCAGG - Intronic
1053151266 9:35744722-35744744 CAATGTGAGTGGAAGGGGGCAGG + Intronic
1053313188 9:37032345-37032367 GTATGTGTGGGGAATGAGGCGGG - Intronic
1053382457 9:37660139-37660161 GCCTGTGTGGGGATAGGGGCTGG + Intronic
1055490873 9:76804318-76804340 TTCCCTGTGAGGAAGGGGGCGGG - Intronic
1056671964 9:88638170-88638192 CTCTGTGTGGTGATTTGGGCTGG + Intergenic
1057082219 9:92181441-92181463 CTCTGTGAGGAGAAGGGGCCAGG + Intergenic
1057147042 9:92765195-92765217 CTGAGTGTGGGGAAGGCCGCGGG - Intergenic
1057303439 9:93899474-93899496 CTCTGTATGAGGAGGGGAGCTGG - Intergenic
1057747236 9:97762059-97762081 CTCTGTGTGGGGTTGGGGTGAGG + Intergenic
1059115867 9:111599619-111599641 CACTGCCTGGGGAAGGCGGCTGG + Exonic
1059450883 9:114370856-114370878 CCCTGGGTGGGGATGGGGGGAGG - Intronic
1059921528 9:119165917-119165939 CTGTGTGTGGGGAACGGGAGTGG + Intronic
1059960727 9:119561783-119561805 CGGGGTGTGGGGAAGGGGGAGGG + Intergenic
1060228251 9:121809091-121809113 CTCTGTGAGGGGTCAGGGGCGGG + Intergenic
1060237050 9:121871856-121871878 CTTTGAGTGTGGAAGGGAGCTGG - Intronic
1060427026 9:123514523-123514545 ATCTGGGTGGGGATGGAGGCAGG + Intronic
1060717416 9:125945384-125945406 CTATGTGTTTGGCAGGGGGCAGG - Intronic
1060886688 9:127159499-127159521 CTCGGTCTGCAGAAGGGGGCAGG - Intronic
1060943277 9:127555670-127555692 CACTGAGTGGGAAAGGGAGCAGG - Intronic
1061196497 9:129109896-129109918 GCCAGGGTGGGGAAGGGGGCTGG + Intronic
1061196511 9:129109932-129109954 GCCAGGGTGGGGAAGGGGGCTGG + Intronic
1061202214 9:129144383-129144405 CGCTGTGTGGGGAAGGGGACAGG + Intronic
1061579290 9:131527020-131527042 CTCTGGGTGGGGCTGGGGCCGGG + Intronic
1061667480 9:132168969-132168991 CTCTGTCTGAGGGTGGGGGCAGG - Intronic
1061670403 9:132185221-132185243 CCCAGGGTGGGGAAGGGGGTCGG - Intronic
1061685847 9:132277230-132277252 TTCTGTGTGGTGATGTGGGCTGG + Intronic
1062263001 9:135672135-135672157 CTCTGAAGGGGGAAGGGGCCAGG - Intergenic
1062271694 9:135712790-135712812 CTCTGTGGGGGGAACAAGGCAGG + Intronic
1062324265 9:136004826-136004848 CCCTGGGTGGGGGAGGGGCCTGG - Intergenic
1062479353 9:136744286-136744308 CTCTCTTGGGGGAAGGGGGTGGG - Intronic
1062564165 9:137156551-137156573 CTCTAGGAGGGGATGGGGGCTGG + Intronic
1062629223 9:137456200-137456222 GTGTGTGTGGGGGGGGGGGCTGG + Intronic
1203518585 Un_GL000213v1:26086-26108 CGGTGTCCGGGGAAGGGGGCGGG + Intergenic
1203603814 Un_KI270748v1:40952-40974 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1185458117 X:320382-320404 CTCTGAGTGGGGCAGGGGCCTGG + Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186102665 X:6173424-6173446 TGCTTTGTGGGGAAGGGGTCTGG - Intronic
1187562747 X:20418221-20418243 CTCTGTGTTGGGAGTGGGGTGGG + Intergenic
1188417741 X:29956464-29956486 CTCTGTGCAGGGGTGGGGGCGGG + Exonic
1188524539 X:31075010-31075032 CTCTCTGAGGAGAAGGAGGCAGG + Intergenic
1188691462 X:33134167-33134189 CTCTGTTTGATGAAGGAGGCTGG - Intronic
1189332878 X:40153926-40153948 CGCCGTGGGGGGCAGGGGGCGGG + Intronic
1189851353 X:45179173-45179195 CTTTGTTGGGGGAAGGAGGCTGG - Intronic
1190162953 X:48047141-48047163 CTATGTGTTGGGAAAAGGGCGGG + Intronic
1190264416 X:48818954-48818976 CTCTGTGTGAGCTAGGAGGCTGG + Intronic
1190279790 X:48922174-48922196 TTCTGTGTGGGGCAGGGGTTGGG - Intronic
1190736138 X:53256833-53256855 CTCAGCTGGGGGAAGGGGGCAGG + Intronic
1190970434 X:55342707-55342729 CTGTGTGTTGGGACGGGGGTAGG - Intergenic
1191133575 X:57040752-57040774 CTCTGTGTAGAGAAGGGGAGGGG + Intergenic
1192185504 X:68944265-68944287 CTGTGTGTGGGGATGAGTGCAGG + Intergenic
1192361965 X:70445859-70445881 CTCTGTGTCTGGCAGGGGGCGGG + Intronic
1192428384 X:71096623-71096645 CTCTGGTCGGGGAAGGGGCCAGG - Exonic
1192442547 X:71185388-71185410 AACTGTGTGGGGATGGGGGTAGG + Intergenic
1193750825 X:85341306-85341328 CTCTGGGTGGTGAAGAGGGTAGG + Intronic
1193815546 X:86101314-86101336 GTCATTGTGGGGGAGGGGGCAGG - Intergenic
1194097982 X:89666543-89666565 CTCTGTGTGGGCTAGAGTGCTGG + Intergenic
1194159321 X:90431593-90431615 CTTTTTGTGGGGAGGGGGGAGGG + Intergenic
1194380187 X:93181446-93181468 CGCTCTGTGGGGCAGGAGGCCGG - Intergenic
1195278843 X:103310501-103310523 CCCGGCGTGGGGAAGGGGCCGGG - Intronic
1195334264 X:103833563-103833585 GTATGTGTGGGGAACGGGGTTGG - Intergenic
1195690449 X:107620020-107620042 CTCTGTCTGGGCAGTGGGGCGGG - Intergenic
1195992115 X:110693149-110693171 GTGTGTGTGGGGGTGGGGGCAGG + Intronic
1197050141 X:122047343-122047365 CTCGGTGGGGGGAGGGGGGCGGG + Intergenic
1197053967 X:122094533-122094555 CTCTGCCTGGGGAAAGGGGAAGG + Intergenic
1197346317 X:125327926-125327948 CTGTGGTTGAGGAAGGGGGCAGG - Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198279415 X:135126907-135126929 GTCTGTCAGGGGAAGGGGACAGG + Intergenic
1198291541 X:135245607-135245629 GTCTGTCAGGGGAAGGGGACAGG - Intergenic
1198341279 X:135715850-135715872 ATCTGTTGGGGGAGGGGGGCTGG - Intronic
1198574773 X:137998136-137998158 CTGGGTTTGGGGCAGGGGGCTGG - Intergenic
1198607401 X:138356560-138356582 ACCTGTCTGGGGAAGGTGGCAGG + Intergenic
1198808632 X:140512303-140512325 GTCTGAGTGGGGAAGTGGGGAGG - Intergenic
1198869532 X:141161190-141161212 CTCTGTCTGGGGGCGGGGGTGGG + Intergenic
1199314826 X:146364171-146364193 CACTGTGAGGGGATGGGGGAGGG + Intergenic
1199878542 X:151954566-151954588 TTCTGTTTGGGGAATGGGGCAGG + Exonic
1199896286 X:152130682-152130704 CACTGTCTGGGGTAGAGGGCTGG - Intergenic
1199951107 X:152706771-152706793 CAGTGTCTGGGGTAGGGGGCTGG + Intergenic
1199958577 X:152761690-152761712 CAGTGTCTGGGGTAGGGGGCTGG - Intergenic
1200081810 X:153580696-153580718 CTGTGTGGTGGGCAGGGGGCTGG + Exonic
1200122750 X:153798811-153798833 CTCTGCGTGCGGAATGGGCCCGG - Intergenic
1200283022 X:154794630-154794652 CACTGTGTGGGGAAGGAGAAGGG + Intronic
1200315933 X:155132999-155133021 CTCTGCCTGTGGAAGGGGGAGGG + Intronic
1200451004 Y:3327932-3327954 CTCTGTGTGGGCTAGAGTGCTGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1202070753 Y:20989654-20989676 CACTTTGTGGGGCTGGGGGCAGG - Intergenic
1202088443 Y:21163431-21163453 CTCTAGGTGGGGTGGGGGGCGGG - Intergenic
1202385875 Y:24325997-24326019 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1202484911 Y:25344131-25344153 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic