ID: 923202460

View in Genome Browser
Species Human (GRCh38)
Location 1:231725492-231725514
Sequence GGGTGAGCTAGTGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 5, 3: 16, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923202460_923202465 4 Left 923202460 1:231725492-231725514 CCTCAATTTGCACTAGCTCACCC 0: 1
1: 0
2: 5
3: 16
4: 98
Right 923202465 1:231725519-231725541 ATTTGCCTGTAATTGAAAGTGGG 0: 1
1: 28
2: 120
3: 210
4: 532
923202460_923202464 3 Left 923202460 1:231725492-231725514 CCTCAATTTGCACTAGCTCACCC 0: 1
1: 0
2: 5
3: 16
4: 98
Right 923202464 1:231725518-231725540 AATTTGCCTGTAATTGAAAGTGG 0: 1
1: 26
2: 102
3: 229
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923202460 Original CRISPR GGGTGAGCTAGTGCAAATTG AGG (reversed) Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902247431 1:15130033-15130055 GGGTGAGATAGAGCAACGTGTGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
902682181 1:18051191-18051213 GGGTGAGCTAGGGCAAATCTTGG - Intergenic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906000801 1:42423154-42423176 GGGTCAGGGAGTCCAAATTGAGG + Intergenic
906234412 1:44195870-44195892 GGGTGGACTAATGCCAATTGAGG - Intergenic
906381558 1:45335485-45335507 GGGTAAGACAGTGCAAATGGAGG - Intronic
907985458 1:59525217-59525239 GGGTGAGCAAGTGCAGAGTCCGG - Intronic
912456237 1:109799469-109799491 GGGTGGGCTAGTTCTAAGTGGGG + Intergenic
916068820 1:161158176-161158198 AGATGAGCTAGTCCAAATTTGGG - Exonic
918190783 1:182172228-182172250 GGGTGAGCTAGTGGGAATCAGGG + Intergenic
918190879 1:182173314-182173336 GGGTGAGCTAGTGGGAATCAGGG - Intergenic
919683407 1:200458136-200458158 GGGTGAGCTATTTGACATTGGGG + Intergenic
919841991 1:201616181-201616203 GTGTGACCTAAGGCAAATTGCGG - Intergenic
923011935 1:230095153-230095175 GGGAGAGCTAGTGCAGAATGTGG + Intronic
923202460 1:231725492-231725514 GGGTGAGCTAGTGCAAATTGAGG - Intronic
924518027 1:244782268-244782290 GGGTGAGAGAATGCAAACTGAGG - Intergenic
1073311908 10:102548986-102549008 GGAAGAGCTTGTGCTAATTGAGG + Intronic
1076330322 10:129659585-129659607 TGATGAGTTAGTGCAAATTGAGG + Intronic
1079129349 11:17738353-17738375 GGTTGAACTAGTGCATGTTGGGG + Intronic
1080989467 11:37513306-37513328 GGGTGAGATATATCAAATTGTGG - Intergenic
1087468958 11:98546615-98546637 TGGTGAGCTAGTGTAATTTTTGG - Intergenic
1090681912 11:129068850-129068872 TGATGAGATACTGCAAATTGAGG - Intronic
1094042479 12:26132631-26132653 CAGGGAGCTAGGGCAAATTGGGG - Intronic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1096443860 12:51670509-51670531 GGGTGAGCTGGAGCAAATCCTGG + Intronic
1096614612 12:52824729-52824751 GGGTGCCTTTGTGCAAATTGGGG + Intronic
1099382450 12:81971413-81971435 TGGTGAGCTAGTGTGATTTGGGG - Intergenic
1099428316 12:82551181-82551203 GGGTGAGCTGAAGCAAAGTGGGG - Intergenic
1101606966 12:106254393-106254415 GGGAGAGCTAGTTCAAATCTTGG + Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1108048451 13:46405723-46405745 AGGTGGGCTAATGCAAATTTAGG - Intronic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1109003180 13:56833640-56833662 AGTTGAGCTGGAGCAAATTGAGG - Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112392206 13:98995837-98995859 GGCTGAGTTAGTGCAAATTGAGG + Intronic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1113976058 13:114228322-114228344 GGGTGACGGAGTGCAGATTGTGG - Intergenic
1120813730 14:88831303-88831325 GGGTGGGCCAATGCAAATTAGGG - Intronic
1129929095 15:79394152-79394174 GGGTGGACTAGTGCACATTTAGG + Intronic
1142144654 16:88487822-88487844 GGGTGAGCTAGGGGAGATGGCGG - Intronic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1142707209 17:1703205-1703227 TGGTGAGCCAGTGAAACTTGAGG - Exonic
1143523649 17:7460683-7460705 GGGTTAACTAGTGCAAATTAGGG + Exonic
1143684366 17:8502340-8502362 GGCTGAGCCAGTGGAACTTGGGG - Intronic
1144303056 17:13941310-13941332 AGGTGAGTCAATGCAAATTGAGG + Intergenic
1147931371 17:43983624-43983646 GGGTGAGCTAGTGGTATCTGAGG - Intronic
1156235420 18:35198857-35198879 GGGTAAGCTAGTATAAATGGAGG - Intergenic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159337062 18:67081956-67081978 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1159337072 18:67082029-67082051 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1159708003 18:71717424-71717446 GGCTGAGCTTGGGCAACTTGTGG - Intergenic
1159874958 18:73800648-73800670 GGGTGAGCTGGTGCCACATGGGG + Intergenic
1160089371 18:75811895-75811917 GGGTGCGCTAGGGCAGATTTGGG - Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1164108091 19:22126389-22126411 TGGTGAGCTAGTGTAACTTTTGG - Intergenic
1165791714 19:38496606-38496628 GAGTGAGCTGGTGGAAAGTGGGG - Intronic
928456726 2:31429054-31429076 GGGTGAGGTAGTGGGAAATGAGG - Intergenic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
933578739 2:84100928-84100950 AAGTGAGCTATTGCAAATGGTGG - Intergenic
938376145 2:130808119-130808141 GTGGGGGCTAGTGCAAACTGGGG - Intergenic
940762492 2:157752413-157752435 GGGTGAGCTAGTGTGATTTTTGG - Intronic
941998995 2:171627603-171627625 GGGTGAGCGAGTGCGAGGTGAGG - Intergenic
942529134 2:176889494-176889516 GGGAGAGCTAATGGAAATGGAGG + Intergenic
944431979 2:199644077-199644099 TGGTGAGCTAGTGTGATTTGGGG + Intergenic
944608942 2:201380570-201380592 GGGTGAGGATGTGCAAACTGGGG + Exonic
1177355761 21:20004702-20004724 GGATGAGTCAATGCAAATTGAGG - Intergenic
1178026796 21:28477635-28477657 GGGTGAGGTAATGCAAATTGAGG - Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1185242915 22:49755981-49756003 GGATGGGCCAATGCAAATTGAGG - Intergenic
950779379 3:15378222-15378244 GGGCAAGCTGATGCAAATTGAGG + Intergenic
951183902 3:19689423-19689445 TGGTGAGCTAGTGTAATTTTTGG - Intergenic
951655889 3:25007902-25007924 GGGTGACCTTGGGCAAATTATGG + Intergenic
957069982 3:75560086-75560108 GGTTGAGTTAGTGGAAACTGAGG + Intergenic
960264559 3:115605612-115605634 GGGTGAACAAGTGCAGATGGTGG + Intergenic
961367913 3:126413134-126413156 GGGAGAGCGAGTGCAGATTGGGG + Intronic
962569381 3:136696597-136696619 GGGGGAGGTTGTGCATATTGGGG + Intronic
962764663 3:138550165-138550187 TGGTGAGCTAGTGTAATTTTTGG - Intronic
965255809 3:166409381-166409403 ATGTGAGGCAGTGCAAATTGTGG + Intergenic
965576615 3:170223446-170223468 GGGTGAGATACTGCAAGGTGAGG + Intronic
974589418 4:63924386-63924408 CAGTGAGCTATTTCAAATTGTGG + Intergenic
986201808 5:5586057-5586079 TGGTGAGTAAATGCAAATTGAGG + Intergenic
992580973 5:78175190-78175212 GGGTGAGCTAAAGCAGAGTGGGG - Intronic
997023511 5:130030154-130030176 AGGTGAGATAATTCAAATTGTGG - Intronic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
998323082 5:141250943-141250965 AGGTGAGTTAATGCAAATTGAGG - Intergenic
998499007 5:142615796-142615818 TGGTGATCAAGGGCAAATTGGGG - Intronic
1001872090 5:175165373-175165395 GGCAGAACTAGTGCAAAATGGGG + Intergenic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1006146722 6:31963835-31963857 AGGTGAGCTAGTGTTAACTGGGG - Intronic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1007573761 6:42911606-42911628 GGGTCAGCTACTGCAGATAGAGG + Intergenic
1007583540 6:42974239-42974261 GGATGAGCTAGGGGAAATGGTGG + Intronic
1008635584 6:53407257-53407279 GGGTGAGGTCGTGAAGATTGAGG + Intergenic
1009606951 6:65882935-65882957 GGGTGTGGTGGTGCACATTGTGG - Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1012237337 6:96834325-96834347 GGATCATCTAGTTCAAATTGAGG + Intronic
1020155235 7:5717926-5717948 GTGTGAGCTAGTACACATGGTGG + Intronic
1020488017 7:8743646-8743668 GGAGGAGCTAGAGCAAAGTGTGG + Intronic
1021015466 7:15526024-15526046 GAGTGAGCTAGTGCGAGCTGCGG - Intronic
1021134097 7:16944658-16944680 GGGTGAGCTAGAGTAAGTTTAGG - Intergenic
1024249728 7:47496869-47496891 GGGTGAGCCTGTGCAAATGCAGG + Intronic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1029479196 7:100802684-100802706 GGGTGAGGTAGTGAAAAGGGCGG - Exonic
1036564001 8:9922602-9922624 GGGGGAGGGAGTGCAAATTCTGG - Intergenic
1041667848 8:60463230-60463252 GAATTAGCCAGTGCAAATTGTGG - Intergenic
1047384074 8:124393562-124393584 TGGAGAGCTAGTGCAATTTTTGG + Intergenic
1056618663 9:88191445-88191467 GGGTGAATTAATGCAAATTAAGG + Intergenic
1058798937 9:108525988-108526010 GGGTGTGCTGGTGCAGAGTGGGG + Intergenic
1060776245 9:126376892-126376914 GGGGGAGCAAGTGCAAGTTTAGG - Intronic
1061762611 9:132860821-132860843 GGGTGGGCTGCTGCAGATTGTGG + Intronic
1188073403 X:25745752-25745774 AGTTGAGCTATTGTAAATTGAGG - Intergenic
1190364636 X:49680108-49680130 GGGTCAGTCAATGCAAATTGAGG + Intergenic
1192568269 X:72181460-72181482 GGGGGATCTGGTGCAAATTAGGG + Intronic
1193208623 X:78779186-78779208 TGGTGAGCTAGTGTAATTTTTGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1196170995 X:112588215-112588237 TGGTGAGCTAGTGCAATTTTGGG - Intergenic