ID: 923203599

View in Genome Browser
Species Human (GRCh38)
Location 1:231736289-231736311
Sequence GGAAGGTACTGCTTTGGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923203586_923203599 28 Left 923203586 1:231736238-231736260 CCCAGATCAAACAGATAGGCAAG 0: 1
1: 0
2: 1
3: 27
4: 265
Right 923203599 1:231736289-231736311 GGAAGGTACTGCTTTGGGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 170
923203592_923203599 2 Left 923203592 1:231736264-231736286 CCTGTGTCACGGAGGAAACTACA 0: 1
1: 0
2: 0
3: 6
4: 73
Right 923203599 1:231736289-231736311 GGAAGGTACTGCTTTGGGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 170
923203590_923203599 4 Left 923203590 1:231736262-231736284 CCCCTGTGTCACGGAGGAAACTA 0: 1
1: 0
2: 1
3: 8
4: 154
Right 923203599 1:231736289-231736311 GGAAGGTACTGCTTTGGGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 170
923203591_923203599 3 Left 923203591 1:231736263-231736285 CCCTGTGTCACGGAGGAAACTAC 0: 1
1: 0
2: 1
3: 4
4: 91
Right 923203599 1:231736289-231736311 GGAAGGTACTGCTTTGGGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 170
923203587_923203599 27 Left 923203587 1:231736239-231736261 CCAGATCAAACAGATAGGCAAGA 0: 1
1: 0
2: 0
3: 12
4: 185
Right 923203599 1:231736289-231736311 GGAAGGTACTGCTTTGGGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923203599 Original CRISPR GGAAGGTACTGCTTTGGGAG TGG Intronic
900241474 1:1619555-1619577 AGAAGGGACTGCCTTGGAAGTGG + Intronic
902410038 1:16207061-16207083 GGAAGGAGCTGCTGGGGGAGAGG + Exonic
903560677 1:24224766-24224788 GGAAGGCAGGGCTTTGGCAGAGG + Intergenic
903770285 1:25759471-25759493 GGAAGACAAGGCTTTGGGAGTGG - Intronic
906079026 1:43071471-43071493 GGAAGTTGCTGGTTTGGGTGAGG + Intergenic
906179865 1:43808915-43808937 GGAAGGTATTGCCTTAGCAGTGG + Intronic
906186321 1:43864696-43864718 GGAAGGTAATGCTTGGGAAGAGG + Intronic
907425824 1:54378761-54378783 GGAAGGAACCGCTGGGGGAGGGG + Intronic
908573481 1:65434757-65434779 GGAAGGTTCTCAGTTGGGAGAGG - Exonic
910170378 1:84370807-84370829 GGGAGGGACAGCTGTGGGAGTGG + Intronic
910899417 1:92103686-92103708 GGAAGGTAAATCTTTGGGAGGGG + Intronic
912736384 1:112152938-112152960 GGAAGAGGCTGGTTTGGGAGAGG + Intergenic
912869345 1:113289695-113289717 GGAAGGCACTACCTTGGGTGTGG - Intergenic
913926375 1:124898403-124898425 GGAAGGTTCAACTCTGGGAGTGG - Intergenic
913928444 1:124924425-124924447 GGAAGGTTCAACTCTGGGAGTGG - Intergenic
919935616 1:202248724-202248746 GGAAGAGATTGCTTTGCGAGGGG - Intronic
923203599 1:231736289-231736311 GGAAGGTACTGCTTTGGGAGTGG + Intronic
923891184 1:238216532-238216554 GGAAGGTACTGAAATGAGAGGGG + Intergenic
1065480967 10:26193510-26193532 GGTAGGTACTACCATGGGAGAGG - Intronic
1068309701 10:55262244-55262266 GGAAGGAAGTGATATGGGAGGGG + Intronic
1068801610 10:61146898-61146920 GGAAGCTATTGCTTTGGAAAAGG - Intergenic
1069717637 10:70531190-70531212 GGAAGGAACAGCTTGGGCAGAGG + Intronic
1070417832 10:76206841-76206863 GGTAGGCTCTGATTTGGGAGGGG - Intronic
1072455015 10:95567811-95567833 GGAAGGTTGGGGTTTGGGAGAGG + Intergenic
1073576659 10:104631520-104631542 GGAAGATACTTCTTTTGGGGGGG + Intergenic
1075380494 10:122014810-122014832 GGAAGGTACAGGTTTGGGCCAGG - Intronic
1078964355 11:16320598-16320620 GGAAGGAACAGATTTGGGAATGG + Intronic
1081276454 11:41155521-41155543 GCAAAGAACTGCTTTGGGAAGGG - Intronic
1083194072 11:61072573-61072595 GGAAGGTGATGGTTTGGCAGTGG - Intergenic
1085731771 11:79006188-79006210 GGGAGGTACTGATTAGGGAGGGG - Intronic
1085744015 11:79099452-79099474 GGGAGCAAGTGCTTTGGGAGGGG - Intronic
1089452355 11:118607440-118607462 GGGAGGTGCTGCTGTGGGAAAGG + Intronic
1090660220 11:128876852-128876874 GGAAGCAGCTGCTTGGGGAGTGG - Intergenic
1090880020 11:130825186-130825208 GGAAGGGACTGGTGGGGGAGCGG - Intergenic
1091142072 11:133243956-133243978 CGAGGGAGCTGCTTTGGGAGAGG + Intronic
1093219118 12:16398232-16398254 GGAAGGAACTGCAGTGGGACAGG + Intronic
1093710084 12:22320415-22320437 GGAAGGAGCTGCCTTGGGAGTGG + Intronic
1094671037 12:32569493-32569515 GGAAGGAACTGTTTGGGGAAGGG - Intronic
1096692474 12:53329432-53329454 GGGACGCACTGCTTAGGGAGAGG + Intronic
1097046367 12:56189918-56189940 GGAAGGAACTTCTTGGGGAAAGG - Intergenic
1097159485 12:57036244-57036266 GGGAGGCACAGGTTTGGGAGAGG - Intronic
1097893478 12:64801448-64801470 GAAAGGGACTGCTTGGGAAGGGG + Intronic
1099315605 12:81078675-81078697 GCAAGGTTCTGCTTTGGCAGTGG + Intronic
1099503826 12:83447463-83447485 GGAAGGCACTTCTCTGGCAGCGG - Intergenic
1100181954 12:92095557-92095579 GGAAGTAACTGCTTGAGGAGAGG + Intronic
1100813522 12:98363440-98363462 GGCAGCATCTGCTTTGGGAGAGG + Intergenic
1104689899 12:130818006-130818028 GGAAGGCCCTGCAGTGGGAGGGG + Intronic
1105511226 13:21053314-21053336 GGAAGGTCCTTCTGTGGGAGGGG - Intronic
1108479446 13:50853649-50853671 GAAAGGCTCTGCTCTGGGAGTGG - Intergenic
1108531461 13:51330900-51330922 GGAAGTGAGTGCTGTGGGAGAGG - Intergenic
1112436521 13:99394649-99394671 TGAGGGTACGGGTTTGGGAGGGG - Intergenic
1113380009 13:109795669-109795691 GGAAGGGACGGGTTGGGGAGAGG + Intergenic
1114298417 14:21351628-21351650 GGAAGGAACTGCAGTGGGACAGG + Exonic
1115646407 14:35371265-35371287 GGAGGGCACTCCTATGGGAGTGG + Intergenic
1116792526 14:49354602-49354624 GAACAGTACTGCTTTGGGAGTGG + Intergenic
1120917294 14:89721258-89721280 GGAAGTTACAGCTTAAGGAGAGG - Intergenic
1125736739 15:41932336-41932358 GGCAGGGTCTGCTCTGGGAGAGG + Intronic
1127977156 15:64006228-64006250 GGCAGGTGCTGCTTTGGTGGCGG - Intronic
1128004642 15:64227485-64227507 GGCAGGTGCTGTTTTGAGAGAGG - Intronic
1128594276 15:68930218-68930240 GGAAGGAACTGTAATGGGAGAGG - Intronic
1129690830 15:77712410-77712432 TGAAAGTACTGCTTAGGGGGAGG - Intronic
1130083247 15:80753859-80753881 CAAAGGTACTGCTGTGGTAGGGG + Intronic
1132381066 15:101367065-101367087 GGAGGGTACTGCTGGGGGTGGGG - Intronic
1133256365 16:4518885-4518907 GGAAGGTGCTGGTGAGGGAGGGG + Intronic
1136584435 16:31174831-31174853 GGAGGGTCCTCCTTTGGCAGTGG - Intergenic
1137396370 16:48118322-48118344 GGAAGGTTCTGCTTATGGTGGGG - Intronic
1138815503 16:60198913-60198935 GGAAATGACTGCTTTGGGAAAGG + Intergenic
1139665625 16:68453500-68453522 GGAATGGATTGCTTTGGAAGGGG + Intergenic
1139848939 16:69939277-69939299 GGAGGATCCTGCTTTGGGAAGGG + Intronic
1141580672 16:84996423-84996445 GGCAGGCCCTGCTGTGGGAGGGG + Intronic
1144050826 17:11495942-11495964 AGAAAGAACTGCTCTGGGAGAGG - Intronic
1145261570 17:21357768-21357790 GGAAGGGCCTGCTGTGGGAGGGG + Intergenic
1147306368 17:39567036-39567058 GGGAGGCTCTGCTTTGGGAGGGG + Intergenic
1147344263 17:39777993-39778015 TGAAGGTACTGGTTGGGGATGGG - Intronic
1148568555 17:48647938-48647960 GGAAGGGACTGGATTGTGAGGGG - Intergenic
1148856948 17:50584085-50584107 GGAAGGAGCAGGTTTGGGAGAGG + Intronic
1150975068 17:70076594-70076616 AGAAAAGACTGCTTTGGGAGAGG + Intronic
1151815458 17:76469459-76469481 AGAAGGTCTTGCTCTGGGAGGGG - Intronic
1151886567 17:76926268-76926290 GGGAGGCACTGCTTGGAGAGGGG - Intronic
1152281369 17:79386655-79386677 GGAAGGAACTCCTTGGGGAAAGG - Intronic
1152291052 17:79440541-79440563 AGAGGGCACTGCTGTGGGAGAGG - Intronic
1152875977 17:82786415-82786437 TGTGGGTGCTGCTTTGGGAGGGG + Intronic
1154273934 18:12943372-12943394 GGTAGTTACTGCTTGGGGAGGGG + Intergenic
1157328845 18:46688757-46688779 CCAAGGTGCTGCTTTGGGCGGGG - Exonic
1159565714 18:70046413-70046435 GCACGGTACTGCTTGGGGAAAGG - Intronic
1161579389 19:5072338-5072360 GGAAGGGAGTCCTTGGGGAGTGG + Intronic
1162015673 19:7845342-7845364 GAAAGGGACGGCTATGGGAGTGG - Intronic
1163175844 19:15563684-15563706 GGAGGGTCCTGGTCTGGGAGAGG + Intergenic
1163299563 19:16435326-16435348 GGAAGGTACAGCATTAGGATGGG + Intronic
1163725554 19:18921404-18921426 GGAAGGCACAGGTTTGGGATAGG + Intronic
1167804100 19:51767473-51767495 GCAAGGGATTGCTTTGGTAGTGG - Intronic
925234458 2:2265912-2265934 TGAAGGTGCTGCCTGGGGAGAGG + Intronic
926144458 2:10388173-10388195 AGAAAGTACTGGATTGGGAGCGG + Intronic
926606780 2:14906178-14906200 GGTAGGTACTGCTGTGGCGGTGG - Intergenic
928708844 2:33981858-33981880 GGAAGTTACTGCATTGGTCGAGG + Intergenic
932397545 2:71458488-71458510 AGAAGGGACTGCTCTAGGAGGGG - Intronic
934160345 2:89243698-89243720 GGAAAATAATGCTTTGGGAAGGG - Intergenic
934206930 2:89938740-89938762 GGAAAATAATGCTTTGGGAAGGG + Intergenic
938082511 2:128377744-128377766 GGAAGGTGCTGGTCTGTGAGAGG - Intergenic
940007266 2:149019434-149019456 GGTAGGTGCTGCTATGGCAGAGG + Intronic
941465723 2:165824156-165824178 GGAAGATCCTGCTTTTGAAGTGG - Intergenic
944241346 2:197488386-197488408 AGAAGGCATTGTTTTGGGAGGGG - Exonic
945701632 2:213177837-213177859 GGAAACCACAGCTTTGGGAGAGG - Intergenic
946153902 2:217794458-217794480 GGAAAGGGGTGCTTTGGGAGGGG - Intergenic
947308929 2:228778957-228778979 AGAAAGTAAAGCTTTGGGAGGGG + Intergenic
1173865976 20:46312801-46312823 GGAGGGGACTACTTGGGGAGGGG + Intergenic
1174297661 20:49560654-49560676 TGAAGGGAGTGCTCTGGGAGGGG + Intronic
1175704797 20:61168685-61168707 GGAAGGCACTGCTTTAGGGTAGG - Intergenic
1183694302 22:39412403-39412425 GGGAGGGAGTGCGTTGGGAGTGG + Intronic
1184906047 22:47487422-47487444 GGAAGGCACTGCTTTGGGCCCGG + Intergenic
952575591 3:34770306-34770328 CAAATGTACTGCTTTGGTAGGGG + Intergenic
952744882 3:36767518-36767540 AGAAGGCATTGTTTTGGGAGGGG - Intergenic
961546290 3:127636231-127636253 AGAAGGTACTGTTTTGGGGTAGG + Intronic
963508747 3:146221705-146221727 GCAAGGTCCTGCCTTGGTAGAGG - Intronic
964260255 3:154827449-154827471 GTAAAGTCCTGCTTTTGGAGAGG + Intergenic
965450750 3:168834692-168834714 GGAAAGTACTGCATGGAGAGGGG + Intergenic
965514630 3:169607846-169607868 GGAAGGCTCTGCTTGGGGTGGGG + Intronic
966684392 3:182678297-182678319 GGAAGCCACTGCTTGGGAAGCGG - Intergenic
967972687 3:195011112-195011134 GGAAGGCACTGCCTTGGATGTGG - Intergenic
968567081 4:1318670-1318692 GGAAGGTGCTGCTGTGGCCGAGG + Intronic
969720164 4:8889106-8889128 GGAAGCTACTTCTGTGGGGGTGG - Intergenic
971122710 4:23721981-23722003 AGAAGGTATTGTTTTGTGAGTGG - Intergenic
972577238 4:40363313-40363335 GCAAGGGACTGCTTTGGGTTGGG + Intergenic
981660348 4:147158716-147158738 TGAAGATACGGCTTTGGGTGTGG + Intergenic
982024644 4:151239564-151239586 AAAATGTACTGTTTTGGGAGGGG + Intronic
984549990 4:181148209-181148231 GGAATGTACTGATCTGGAAGAGG + Intergenic
984653914 4:182297416-182297438 GGAAGGTGCTGCTTTTTGAATGG + Intronic
989343301 5:40401375-40401397 GGGAGGAAATGCTTTGTGAGAGG - Intergenic
992975127 5:82108855-82108877 GGAAGGAACAGCTAGGGGAGTGG + Intronic
994686592 5:102961880-102961902 GGAAGGTAGTGCTTTGGGTTAGG + Intronic
996180328 5:120410746-120410768 TGAAGGTACTGTTTTGTGTGTGG - Intergenic
998893518 5:146772252-146772274 GTCAGGTACTGTTTAGGGAGTGG + Intronic
1001436952 5:171706814-171706836 GGATGCTACTGCTGTGGGTGGGG - Intergenic
1003601937 6:7525851-7525873 GGAGGGCACTGCAGTGGGAGAGG + Intergenic
1003666877 6:8119503-8119525 GGAAAGTACTTCTCTGGCAGGGG + Intergenic
1003687536 6:8319205-8319227 GGAAGCCACAGCTTTGGGAGTGG + Intergenic
1011432230 6:87300054-87300076 AGAAGGCATTGCTCTGGGAGGGG + Intronic
1013129690 6:107220964-107220986 TGAAGGTACTGATTTGGATGTGG - Intronic
1013750071 6:113395327-113395349 GGTGGGTAATGCTTTTGGAGAGG + Intergenic
1013989417 6:116236396-116236418 GGAAGGTAATGTGCTGGGAGAGG + Intronic
1018796116 6:167186844-167186866 GGAAGGAGCTGCTTTGGAAGAGG - Intronic
1018820205 6:167368213-167368235 GGAAGGAGCTGCTTTGGAAGAGG + Intronic
1018893673 6:167999414-167999436 AGAATGTCCTGCTTTGGGACCGG - Intronic
1019627739 7:2029384-2029406 GGAAGGCAGGGCTTTGGGGGAGG + Intronic
1020601311 7:10277600-10277622 GGAAGGGGCTGCATTGTGAGAGG + Intergenic
1021095148 7:16527123-16527145 GGCAGGTACTGAATTTGGAGGGG + Intronic
1022799110 7:33758626-33758648 AGTAGGTATTGCTTTTGGAGAGG - Intergenic
1023609724 7:41960441-41960463 GGAAGGGAAGGCTTTTGGAGTGG + Intergenic
1024517049 7:50267993-50268015 GGAGGGCACTGCCTTGGGAGGGG - Intergenic
1024570833 7:50721864-50721886 GGCAGGGACTGCTGTGGGAAGGG + Intronic
1031784179 7:126007915-126007937 GGAAGATACGGCATTGGGAATGG - Intergenic
1033929991 7:146508919-146508941 GGAAGGTACTCCTTCTGCAGGGG - Intronic
1037344183 8:17880525-17880547 GGAAGGTAGTTCATAGGGAGAGG - Intronic
1037858502 8:22388532-22388554 GGGAGGTTGTGCTTTGGGTGGGG + Intronic
1038448718 8:27624371-27624393 GGATGGGACTGCTTTGGGGAAGG - Intergenic
1038890425 8:31715672-31715694 GGAAGGAACTGTGTTGGGTGCGG + Intronic
1038971898 8:32646225-32646247 GGAAGGGAGTGCTAGGGGAGGGG - Intronic
1039652160 8:39353697-39353719 GGTGGGGACTTCTTTGGGAGGGG - Intergenic
1041154103 8:54966140-54966162 GGAAGCTTCTGCTTTGTGTGTGG - Intergenic
1043072763 8:75660156-75660178 TGAAGGGACTGATTTGTGAGTGG - Intergenic
1043523705 8:81073814-81073836 GGTAGGGACTGCCTGGGGAGTGG + Intronic
1044331008 8:90920374-90920396 GGAAGATATAGCCTTGGGAGAGG - Intronic
1044484099 8:92729793-92729815 GGAGTGTAGTACTTTGGGAGTGG - Intergenic
1048158594 8:131989965-131989987 GCCAAGTACTGCTTTGTGAGGGG + Intronic
1049751733 8:144287890-144287912 GGAAGTTACGGCCTTGGCAGAGG - Intronic
1051266147 9:15310617-15310639 GGGAGGGACTGCTTTAGAAGGGG - Intergenic
1053477378 9:38392472-38392494 CTAAGGCACTGGTTTGGGAGCGG - Intergenic
1055248149 9:74271896-74271918 GGAGCGTCCTGCTTTGGCAGAGG - Intergenic
1057197228 9:93121800-93121822 GGACGCTGGTGCTTTGGGAGAGG + Exonic
1057290239 9:93801729-93801751 GCAAGGCACAGCTTTGGAAGCGG - Intergenic
1057641592 9:96828253-96828275 GAACGGTACTGCTTTAGTAGAGG + Intronic
1058879099 9:109271265-109271287 GGCAGGTCCTGCTTTGGGCAGGG - Intronic
1059525643 9:114988853-114988875 GATAGGTACTGCTTTGTAAGTGG + Intergenic
1203783126 EBV:112189-112211 GGGAGGTCCAGGTTTGGGAGTGG + Intergenic
1186392783 X:9177899-9177921 GGAAGATAGTGTTATGGGAGAGG + Intergenic
1187309979 X:18132710-18132732 TGAAGGTACAATTTTGGGAGGGG + Intergenic
1188313468 X:28645587-28645609 TGAAAATACTGCTTTGGGAAAGG + Intronic
1188982131 X:36735927-36735949 GGAAGGAAGTGCATTGGGAATGG - Intergenic
1189079789 X:37958933-37958955 GGAATGTACTGGCGTGGGAGGGG + Intronic
1189230109 X:39445461-39445483 GGCAGGTGCTGGTTTGAGAGGGG - Intergenic
1189316414 X:40060082-40060104 TGAATGCACAGCTTTGGGAGAGG - Intronic
1190167811 X:48087739-48087761 AGCAGCTTCTGCTTTGGGAGAGG + Intergenic
1193671212 X:84389188-84389210 GGCATGCTCTGCTTTGGGAGTGG + Intronic
1196138598 X:112236009-112236031 GAAAGCTACTGCTTTGGAGGCGG + Intergenic
1198157299 X:133973829-133973851 GGAAAGTACTGCCCTGGGGGAGG + Intronic
1199620544 X:149696874-149696896 GGAAGGTACAGCAGTAGGAGTGG - Intronic
1199763482 X:150923706-150923728 GGAAAGAATTGCTTTTGGAGGGG + Intergenic