ID: 923206038

View in Genome Browser
Species Human (GRCh38)
Location 1:231759836-231759858
Sequence CTTATTGAGGCCATGACTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 86}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923206038_923206048 1 Left 923206038 1:231759836-231759858 CCCTTAGTCATGGCCTCAATAAG 0: 1
1: 0
2: 1
3: 6
4: 86
Right 923206048 1:231759860-231759882 GAAGGGAGAAAGGACAAGGGGGG 0: 1
1: 1
2: 11
3: 172
4: 1616
923206038_923206046 -1 Left 923206038 1:231759836-231759858 CCCTTAGTCATGGCCTCAATAAG 0: 1
1: 0
2: 1
3: 6
4: 86
Right 923206046 1:231759858-231759880 GAGAAGGGAGAAAGGACAAGGGG 0: 1
1: 1
2: 23
3: 180
4: 1436
923206038_923206047 0 Left 923206038 1:231759836-231759858 CCCTTAGTCATGGCCTCAATAAG 0: 1
1: 0
2: 1
3: 6
4: 86
Right 923206047 1:231759859-231759881 AGAAGGGAGAAAGGACAAGGGGG 0: 1
1: 1
2: 18
3: 180
4: 1578
923206038_923206044 -3 Left 923206038 1:231759836-231759858 CCCTTAGTCATGGCCTCAATAAG 0: 1
1: 0
2: 1
3: 6
4: 86
Right 923206044 1:231759856-231759878 AAGAGAAGGGAGAAAGGACAAGG 0: 1
1: 0
2: 23
3: 222
4: 1788
923206038_923206045 -2 Left 923206038 1:231759836-231759858 CCCTTAGTCATGGCCTCAATAAG 0: 1
1: 0
2: 1
3: 6
4: 86
Right 923206045 1:231759857-231759879 AGAGAAGGGAGAAAGGACAAGGG 0: 1
1: 1
2: 30
3: 341
4: 1873
923206038_923206043 -9 Left 923206038 1:231759836-231759858 CCCTTAGTCATGGCCTCAATAAG 0: 1
1: 0
2: 1
3: 6
4: 86
Right 923206043 1:231759850-231759872 CTCAATAAGAGAAGGGAGAAAGG 0: 1
1: 0
2: 1
3: 42
4: 533
923206038_923206049 25 Left 923206038 1:231759836-231759858 CCCTTAGTCATGGCCTCAATAAG 0: 1
1: 0
2: 1
3: 6
4: 86
Right 923206049 1:231759884-231759906 AACTAAGTTGTGAGCCACAGAGG 0: 1
1: 0
2: 0
3: 14
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923206038 Original CRISPR CTTATTGAGGCCATGACTAA GGG (reversed) Intronic
900834076 1:4986437-4986459 CTTGTCGAGGCCATGAAAAATGG - Intergenic
902037321 1:13467343-13467365 CTCCATGAGGTCATGACTAATGG - Intergenic
903969566 1:27109866-27109888 CTTCTTGTGGCCATGGTTAACGG - Intronic
908075071 1:60507922-60507944 TTTTTTAAGGCCATGAATAAAGG + Intergenic
908494479 1:64680529-64680551 GGTATTGAGGCCATGATTATAGG - Intronic
911708410 1:101041272-101041294 CTTATTGAGGACTGGAGTAAAGG - Intergenic
913698963 1:121355838-121355860 TGTATGTAGGCCATGACTAATGG + Intronic
914138582 1:144924207-144924229 TGTATGTAGGCCATGACTAATGG - Intronic
918716776 1:187798847-187798869 CTTATTGAGCAAATGACTAAAGG + Intergenic
920486375 1:206374545-206374567 TGTATGTAGGCCATGACTAATGG + Intronic
922017629 1:221667437-221667459 CTTATTCAGGCAAAGACTCAAGG + Intergenic
923206038 1:231759836-231759858 CTTATTGAGGCCATGACTAAGGG - Intronic
923246797 1:232139947-232139969 ATTATTGAGGCCATGTCTGTAGG + Intergenic
1066307158 10:34156661-34156683 CTTAGTGAGGGCTTGACTTAGGG - Intronic
1077497777 11:2894830-2894852 CAAATTGAGGCCTGGACTAAGGG + Intronic
1077661699 11:4074421-4074443 CTCTTTGATGCCATGACTCATGG + Intronic
1080225406 11:29954653-29954675 CTTTTTGTGGCCATTGCTAATGG - Intergenic
1081213971 11:40371620-40371642 CTTATTGAGCCAACAACTAATGG + Intronic
1083346050 11:61993075-61993097 ATTATAGAGGCCATGTCAAAAGG - Intergenic
1086904174 11:92400007-92400029 CTTATTGAGGCACAGACTATTGG + Intronic
1087496008 11:98891384-98891406 CTTATTGGGACCTTGAGTAAAGG - Intergenic
1089913161 11:122124239-122124261 CTTATTGCTGACATTACTAAAGG + Intergenic
1091222386 11:133937011-133937033 TTTATTGATGCCGTCACTAATGG + Intronic
1091461328 12:645698-645720 CTGACTCATGCCATGACTAAGGG - Intronic
1092079346 12:5701427-5701449 CTTATTAGGTCCAGGACTAAGGG - Intronic
1093659672 12:21739917-21739939 CTTTTTGATGCCATTACAAATGG + Intronic
1096362019 12:50996196-50996218 CTTATGGAGGTCAGGAGTAAAGG - Intronic
1097486487 12:60209731-60209753 CTTATGGAGTCCCTGACTGAAGG - Intergenic
1099598576 12:84701516-84701538 CTTATTGAGGCTATAGCAAAAGG - Intergenic
1107460505 13:40597531-40597553 CTTGTTGAAGCCATGACTAAGGG - Intronic
1108065769 13:46576279-46576301 CTTATTTAGGGCCTGCCTAAAGG - Intronic
1109901208 13:68773842-68773864 CTTATTCAGGCCATCACATATGG - Intergenic
1111897872 13:94163506-94163528 CTTATTGTGGATTTGACTAAGGG - Intronic
1113527123 13:110989088-110989110 CTTAATGGTGCCATGATTAAGGG + Intergenic
1116170774 14:41399447-41399469 CTTTTTGAGGCCTTGACTTTGGG + Intergenic
1120449377 14:84647230-84647252 GTTATCAAGACCATGACTAATGG - Intergenic
1122500387 14:102194236-102194258 CTTATCGAGGCCATAATCAAAGG - Intronic
1125056400 15:35362641-35362663 CTCTTTGGGGCAATGACTAAAGG - Intronic
1127569812 15:60230924-60230946 CTTATAAAGGCAATGACTCAGGG - Intergenic
1128679287 15:69636222-69636244 CATATTGAGGCTATGATTTAGGG - Intergenic
1129627157 15:77213939-77213961 GTTATTGAGGCCAGGAGTTAGGG - Intronic
1133876891 16:9743404-9743426 CTTATTCAGGGGATGACAAAAGG + Intergenic
1134894459 16:17872159-17872181 TTTATAGAGGCCAAGACTCAGGG - Intergenic
1136640991 16:31564933-31564955 CTTATTGAGGCCATGATGAGTGG - Intergenic
1140634658 16:76897984-76898006 CTTACTGGGAACATGACTAAGGG - Intergenic
1141403658 16:83772905-83772927 CTTATTGTAGCCTTGAATAAAGG - Intronic
1142922933 17:3207041-3207063 CTTATAGTAGCCCTGACTAATGG - Intergenic
925183445 2:1831501-1831523 GTTGTAGAGGACATGACTAATGG - Intronic
929629129 2:43441097-43441119 ATTATTGTGGCCATGCCTGATGG + Intronic
931938237 2:67222637-67222659 TTTATTCAAGCCATGACTGATGG + Intergenic
932647707 2:73521803-73521825 TTTATAGAGGCCATGATTTATGG + Intronic
940178921 2:150909912-150909934 CTTATTGTGGCAATTATTAAGGG + Intergenic
941225511 2:162842202-162842224 ATTATTGCAGCCATGACTATGGG + Intergenic
947316229 2:228862230-228862252 CTTATTGAATGCATGAATAAAGG - Intronic
1169245601 20:4022140-4022162 CTGACTCAGGCCATGACTGAGGG + Intergenic
1170054889 20:12191215-12191237 ATTATTCAGTCCATTACTAAAGG - Intergenic
1176808338 21:13514341-13514363 CTTATTTAGGGGATGACTATTGG - Intergenic
1180689536 22:17700669-17700691 CTTATTGAGGAAATGCCTAATGG + Intronic
1180787866 22:18557054-18557076 CTTCTGGAGGCCATGACTCTGGG + Intergenic
1181233870 22:21438252-21438274 CTTCTGGAGGCCATGACTCTGGG - Intronic
1181244777 22:21496579-21496601 CTTCTGGAGGCCATGACTCTGGG + Intergenic
1182869763 22:33635713-33635735 TTTATTGAGGCCATTACTGTGGG - Intronic
1184088127 22:42278072-42278094 TTTAGTGAGGCCACGACTCAGGG + Intronic
954914879 3:54140208-54140230 CTTTTTGAGGCCAGGAATGACGG - Intronic
956083417 3:65584055-65584077 ATTTTTGAGGCCCTGACTAATGG - Intronic
957412725 3:79861797-79861819 CTTACTGAGAACTTGACTAAAGG + Intergenic
957612879 3:82491304-82491326 CTTATTGAATACATGAATAAAGG - Intergenic
957960677 3:87247290-87247312 CATATTGAGCTTATGACTAATGG + Intronic
965124104 3:164601868-164601890 CTTATTGAGTACTTGACAAAAGG - Intergenic
967748183 3:193083283-193083305 TTTATTGTGTCCATGCCTAAGGG + Intergenic
972446994 4:39153831-39153853 TTTATTGAGGCCATGTATAGTGG - Intergenic
980110189 4:128628620-128628642 CTTATTAGGTCCAGGACTAAGGG + Intergenic
983817412 4:172149373-172149395 CATATTGAAGCCATGACCTATGG + Intronic
990196549 5:53323428-53323450 TCTATTGAGGCTATGGCTAATGG - Intergenic
992719249 5:79543614-79543636 CTTTGGGAGGCCAAGACTAATGG - Intergenic
1001142893 5:169160092-169160114 CTTGTTTAAGCCATTACTAAGGG + Intronic
1011677555 6:89749724-89749746 CTTATTGATGCCATGAGAAAAGG - Exonic
1018502052 6:164421893-164421915 CTTATTGAGAACTTGAGTAAAGG + Intergenic
1028070971 7:86450144-86450166 CTTATTCAGGCCCTGGATAAAGG + Intergenic
1028673981 7:93437063-93437085 CTTATTAATTTCATGACTAAAGG - Intronic
1029576833 7:101408908-101408930 CTTCTTGAGGCCATGCCTCTAGG - Intronic
1032068505 7:128790578-128790600 TTTATTCAGGCTATGACTACTGG - Intergenic
1032869025 7:135960883-135960905 CTTATTGAGCCCATGTCTTTTGG - Intronic
1042183054 8:66111272-66111294 CTAAGTGAGGCCAAGAATAATGG + Intergenic
1047314577 8:123720842-123720864 CTTATGGAGGCCAAGACTGAAGG - Intronic
1186725006 X:12348307-12348329 CTTACTTAGGCCATAAGTAAAGG + Intronic
1188532673 X:31159742-31159764 CTTCTAGAGCCCATGGCTAATGG - Intronic
1191154541 X:57257715-57257737 CTTATTGGTGCCATTACAAATGG - Intergenic
1194006574 X:88501716-88501738 GTTTCTGAGGCCATGATTAATGG + Intergenic
1194341375 X:92710341-92710363 CTTATTGAAGCCATGATCCAGGG - Intergenic
1197706254 X:129636760-129636782 CTTCATGAGGCCATGAGTTAGGG - Intergenic
1198447549 X:136733079-136733101 CTTATTAAACTCATGACTAAAGG + Intronic
1200612003 Y:5336092-5336114 CTTAGTGATGCTGTGACTAAAGG - Intronic
1200649726 Y:5827053-5827075 CTTATTGAAGCCATGATCCAGGG - Intergenic