ID: 923208128

View in Genome Browser
Species Human (GRCh38)
Location 1:231778074-231778096
Sequence ATGTCCCTCCAGGCCAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 384}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923208116_923208128 21 Left 923208116 1:231778030-231778052 CCCAGCAGAGCCGTGGGTCTGTG 0: 1
1: 0
2: 2
3: 22
4: 184
Right 923208128 1:231778074-231778096 ATGTCCCTCCAGGCCAGGGATGG 0: 1
1: 0
2: 4
3: 39
4: 384
923208121_923208128 11 Left 923208121 1:231778040-231778062 CCGTGGGTCTGTGGGCCCAAGGA 0: 1
1: 0
2: 2
3: 17
4: 267
Right 923208128 1:231778074-231778096 ATGTCCCTCCAGGCCAGGGATGG 0: 1
1: 0
2: 4
3: 39
4: 384
923208123_923208128 -4 Left 923208123 1:231778055-231778077 CCCAAGGAAAAGAGAATGGATGT 0: 1
1: 0
2: 2
3: 46
4: 486
Right 923208128 1:231778074-231778096 ATGTCCCTCCAGGCCAGGGATGG 0: 1
1: 0
2: 4
3: 39
4: 384
923208117_923208128 20 Left 923208117 1:231778031-231778053 CCAGCAGAGCCGTGGGTCTGTGG 0: 1
1: 0
2: 1
3: 27
4: 175
Right 923208128 1:231778074-231778096 ATGTCCCTCCAGGCCAGGGATGG 0: 1
1: 0
2: 4
3: 39
4: 384
923208115_923208128 25 Left 923208115 1:231778026-231778048 CCAGCCCAGCAGAGCCGTGGGTC 0: 1
1: 0
2: 3
3: 43
4: 500
Right 923208128 1:231778074-231778096 ATGTCCCTCCAGGCCAGGGATGG 0: 1
1: 0
2: 4
3: 39
4: 384
923208124_923208128 -5 Left 923208124 1:231778056-231778078 CCAAGGAAAAGAGAATGGATGTC 0: 1
1: 0
2: 0
3: 20
4: 262
Right 923208128 1:231778074-231778096 ATGTCCCTCCAGGCCAGGGATGG 0: 1
1: 0
2: 4
3: 39
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923208128 Original CRISPR ATGTCCCTCCAGGCCAGGGA TGG Intronic
900237963 1:1601412-1601434 AGGGCCCTCCATGCCGGGGACGG - Intergenic
900342904 1:2197147-2197169 ATGGTCCTCCAGGACAGGGCAGG - Intronic
901736443 1:11315385-11315407 ATCTCTCACCAGGCCAGGCACGG + Intergenic
902983961 1:20144173-20144195 CTGTGCCTCATGGCCAGGGAGGG - Intronic
903367169 1:22812216-22812238 TTGTCCTGCCTGGCCAGGGAGGG + Intronic
903735763 1:25529051-25529073 CTGTGCCCCCAGGCCAGGGCAGG - Intergenic
903778176 1:25806354-25806376 TGGGCTCTCCAGGCCAGGGACGG + Intronic
903921940 1:26805913-26805935 AACTCCCTGCAGTCCAGGGACGG - Intergenic
904540636 1:31230601-31230623 ATCCCTCTCCAGGCCAGGGCAGG + Intronic
904575712 1:31503922-31503944 GAGTCCCTGCAGGGCAGGGAAGG - Intergenic
904889219 1:33765901-33765923 ATGTCCCTCCTAGACAGGGCTGG + Intronic
905764735 1:40591029-40591051 ATGTCCTTGCAGGCCAGGTGCGG + Intergenic
906004087 1:42454332-42454354 ATGCCCCACAAGGGCAGGGATGG - Intronic
906129413 1:43447216-43447238 AGGTGCCTCCAGGTCAGGGCTGG + Intronic
906428194 1:45732067-45732089 ATGTCGCTCCTGGCCAGGCACGG + Intronic
906480270 1:46194870-46194892 GTGTCCCTCCAGCCCAGGGCAGG + Exonic
907751985 1:57271567-57271589 ATGTCCCCTGAGGGCAGGGATGG - Intronic
910870242 1:91826789-91826811 AGGTGCCTCCAGACCAGGGAGGG - Intronic
911400513 1:97368868-97368890 ATGACAATGCAGGCCAGGGAAGG + Intronic
912265264 1:108150908-108150930 TCCTCCCTCCAGGCCAGGCACGG + Intronic
912942949 1:114061143-114061165 CTGCCCCTTCAGGCCAGAGAGGG + Intergenic
914814054 1:151050111-151050133 CTGTCCTTCCAGGACAAGGAAGG + Intronic
914857875 1:151365396-151365418 AGGACTGTCCAGGCCAGGGATGG - Intronic
915760219 1:158304296-158304318 AGGACCCTCCAGGCCTGGCATGG - Intergenic
919942219 1:202296118-202296140 TTGTCCATCCAAGCCAGGGCAGG - Intronic
920345651 1:205304224-205304246 CTGGCGCTCCAGGCCAGGGGTGG + Exonic
922505544 1:226123447-226123469 AGGCCCTGCCAGGCCAGGGAAGG + Intergenic
923208128 1:231778074-231778096 ATGTCCCTCCAGGCCAGGGATGG + Intronic
924403540 1:243717037-243717059 AGATCCATCCAGGCCTGGGAGGG - Intronic
924609039 1:245558595-245558617 AGGTCCCTCCTGGACAAGGAAGG + Intronic
1062920980 10:1279604-1279626 ATGACCCCACAGGCCAGGAACGG - Intronic
1064515354 10:16142051-16142073 TTGTCCCACCAGGCCTGGAAGGG + Intergenic
1066350708 10:34634409-34634431 TTTTCCCTCCAGGGGAGGGAAGG + Intronic
1066389326 10:34966026-34966048 AGGTCCCTGCAGGCCAGGCGTGG - Intergenic
1068011327 10:51455285-51455307 ATGGGCCTCCAGGCCTGTGATGG + Intronic
1072123690 10:92426862-92426884 GTATCCCTCCAGGCCGGGCACGG + Intergenic
1072339062 10:94428580-94428602 ATGTACTTACAGGCCAGGCATGG - Intronic
1072709981 10:97709875-97709897 ATGTCCCCCCAGGGCACAGAAGG + Intergenic
1074268332 10:111927732-111927754 TTGTCCTTCCAGCCCAGGAATGG + Intergenic
1076376022 10:129985599-129985621 ATCTCCAGCAAGGCCAGGGAAGG - Intergenic
1076745425 10:132510372-132510394 ATGTCCCTCAGAGCCAGGCACGG - Intergenic
1077178708 11:1202876-1202898 GTGTCCCTCTGGGCCAGAGAGGG + Intergenic
1077230634 11:1456857-1456879 TGGTCCCGCCAGGCCAGGGAGGG - Intronic
1077697375 11:4406577-4406599 AGGACCCTCCAAGCCAGGCACGG + Intergenic
1078011000 11:7573068-7573090 AAGTTCCTCAAGGCCAGGTATGG - Intronic
1078040843 11:7861374-7861396 ATGACCCTCCAAGCCAGGTACGG - Intergenic
1078200072 11:9173114-9173136 ATGTTGCTCCAGGCCAGGCGCGG - Intronic
1079865117 11:25724522-25724544 AGGACCCTCCAAGCCAGGCATGG + Intergenic
1080004180 11:27387679-27387701 AAGTCCCTATAGGCCAGGTAGGG + Intronic
1081257090 11:40910902-40910924 AGGACCCTCCAAGCCAGGCATGG - Intronic
1081622954 11:44629859-44629881 AAGTTCCTCGAGGGCAGGGAGGG + Intergenic
1081872600 11:46390380-46390402 GTGTCCCTCAAGGCCAGGTTGGG - Intergenic
1083325089 11:61869160-61869182 ATGGCCCACAGGGCCAGGGAGGG - Intergenic
1083418893 11:62542657-62542679 GAGTCCCTCCTGGCCAGGGAGGG - Intronic
1084689839 11:70718645-70718667 ATGTCACAGCAGGGCAGGGAGGG + Intronic
1085285389 11:75356610-75356632 ATGACCCTCCAGGCCCAGCATGG - Intergenic
1086012288 11:82120294-82120316 AGGACCCTCCAAGCCAGGCATGG - Intergenic
1086940573 11:92793792-92793814 ATATCCTTTCATGCCAGGGATGG + Intronic
1089002995 11:115067795-115067817 AAGTCTCTCCAGGGCAGGAAAGG - Intergenic
1089150663 11:116361386-116361408 GAGTTCCTCCAGGACAGGGAAGG - Intergenic
1089300558 11:117496231-117496253 ATGTTCCTGGAGGGCAGGGAGGG + Intronic
1090131324 11:124145397-124145419 ACCTTCCGCCAGGCCAGGGAAGG - Intronic
1091031072 11:132188359-132188381 GTCTCCCTCCAGGCCATGCAAGG + Intronic
1091285474 11:134406177-134406199 CTCGCCCTCCAGACCAGGGAGGG + Intronic
1091899744 12:4135121-4135143 TTGGCCCTCCTGGCCAGGGGTGG - Intergenic
1093480569 12:19600207-19600229 ATGGCCATCTAGGCCAGGCACGG + Intronic
1096090696 12:48898599-48898621 AGGTCATTCCAGGCCAGGCACGG - Intergenic
1096918379 12:55057716-55057738 ATCTCCCTCCAGGGCAGGCAGGG - Intergenic
1098057309 12:66521857-66521879 AGGACCCTCCAAGCCAGGTACGG - Intronic
1099439816 12:82686761-82686783 AGGAGCCTCCAGGCCGGGGAGGG + Intergenic
1100335005 12:93620702-93620724 ATGTCGCTCCAGGCCAGGCATGG - Intergenic
1101335321 12:103791518-103791540 ATTTGGCTCCAGGCCAGGGCTGG - Intronic
1101731545 12:107431318-107431340 AAGTCAATCCAGGCCAGGCATGG + Intronic
1101736999 12:107470696-107470718 AGGTGCCACCAGGCCAGGGTCGG - Intronic
1102358934 12:112266770-112266792 ATGTATCTGCAGGCCAGGCACGG - Intronic
1102541309 12:113621273-113621295 AAAGCCCTACAGGCCAGGGAAGG + Intergenic
1102953569 12:117045651-117045673 ATGTCCCTCAAGGACAGGCTTGG + Intronic
1103921306 12:124400668-124400690 TTCTCCCTACAGGCCAGAGAGGG + Exonic
1104363459 12:128155120-128155142 TTGCCCCTCCAGGCCAGGGGAGG + Intergenic
1104382466 12:128319535-128319557 ATGGGCCACCAGGCCAGGCACGG + Intronic
1104597833 12:130132046-130132068 ATGTCCCTCCAGCCCATGGGAGG + Intergenic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1106801013 13:33255734-33255756 CACTCCCTCCAGGGCAGGGAGGG + Intronic
1108512554 13:51169558-51169580 GTGGGCCTCCAGGCCTGGGATGG - Intergenic
1109516295 13:63446719-63446741 CTGGCCCTCCAGCCCAAGGATGG + Intergenic
1110563724 13:76937102-76937124 ATGTCCCTCCAATCCTGTGACGG + Intergenic
1112178724 13:97054914-97054936 AGGACCCTCCAAGCCAGGCATGG + Intergenic
1112322180 13:98417652-98417674 AGATCCCTCCAGGGCAGAGAGGG + Intronic
1113333179 13:109351988-109352010 ATGTACCCCCTGGCAAGGGATGG + Intergenic
1113932832 13:113977207-113977229 CTGTCCCTCCAGGCAGGAGAGGG - Intergenic
1114425776 14:22621401-22621423 AGGACCCTCCAAGCCAGGCACGG + Intergenic
1114563115 14:23607653-23607675 CTGTCCCTCCAGCCCTGAGAAGG - Intergenic
1115717701 14:36124213-36124235 AGGACCCTCCAGGCCATGCATGG + Intergenic
1117392205 14:55272155-55272177 ATGTCACTGCAGGCCCGGGCGGG + Intronic
1117807885 14:59513522-59513544 AGGACCCTCCAAGCCAGGCACGG - Intronic
1117983419 14:61364161-61364183 AAGTGTCTCCAGGCCAGGCATGG - Intronic
1118904122 14:70011020-70011042 ATCTCCCACCAGACCAGGGCAGG - Intronic
1121440978 14:93949121-93949143 ATGTCCTTCCAGAACAAGGAAGG - Intronic
1122023562 14:98858814-98858836 CTGTCCTGCCAGGCCAGGCACGG + Intergenic
1122156555 14:99753555-99753577 AGGCCCCTCCCTGCCAGGGAGGG - Intronic
1122650115 14:103221439-103221461 ATGTCCCTTCTGACCACGGACGG + Intergenic
1122717822 14:103706032-103706054 TTGTCCCTGCAGCCCAGGGGAGG - Intronic
1122782942 14:104151301-104151323 GTGTCCCCCCAGTTCAGGGAAGG + Intronic
1123127971 14:105963139-105963161 ATGGCCCTGCAGGCCGGGCATGG + Intergenic
1123449553 15:20351325-20351347 CTGTCCCTCCAGCCCACGGAGGG - Intergenic
1123517811 15:21045923-21045945 ATGGCCCTGCAGGCCGGGCATGG + Intergenic
1124085737 15:26549038-26549060 ATGGCCCTCCAGGCAAAGAAAGG - Intronic
1124189613 15:27563437-27563459 TTCACCCTCCAGGCCAGAGAGGG + Intergenic
1124570003 15:30854391-30854413 AGGACCCTCCAAGCCAGGCACGG + Intergenic
1125442830 15:39721970-39721992 CTGACCCCCCAGGCCATGGACGG + Intronic
1125762364 15:42105345-42105367 ATGTTCCACCAGGCATGGGAGGG + Intergenic
1126841611 15:52722880-52722902 ACGACCCACCAGGCCAGGCATGG + Intergenic
1127555873 15:60086916-60086938 ATGAGACTCCAGGTCAGGGACGG + Intergenic
1128437053 15:67663580-67663602 ATGTCTCTCCAGGCCAGGCATGG + Intronic
1129260694 15:74365653-74365675 ATCTTCTTCCAGGCCTGGGATGG - Intronic
1130095116 15:80850097-80850119 ATGGCTGTCCAGGCAAGGGATGG + Intronic
1130234871 15:82124662-82124684 ATGTCCAATCAGGCCAGGGCAGG + Intergenic
1131260534 15:90885196-90885218 ATGTCCCTGCAGGACAGTGGGGG + Exonic
1131666177 15:94573232-94573254 CAGTGCCTCCAGGCCAGGAAGGG - Intergenic
1132224120 15:100127377-100127399 ATGCACCTCCAAGCCAGGGGAGG + Intronic
1132384909 15:101393414-101393436 TTGTCCCTCCAGGGCCGGCAGGG - Exonic
1132685374 16:1159868-1159890 GCGTTCCACCAGGCCAGGGAGGG - Intronic
1132775062 16:1588920-1588942 GTGTCCCCACAGGGCAGGGAGGG - Intronic
1132986197 16:2768920-2768942 CCGTTCCTCCAGGCCAAGGAAGG + Intronic
1133964023 16:10518491-10518513 AGTTGCCTCCAGGCCAGGCATGG - Intergenic
1136375321 16:29862019-29862041 AAGTCCATTCAGGCCAGGGGCGG - Intronic
1136633299 16:31502353-31502375 ATTTCCCTCAAGTCCAGGGTGGG - Intronic
1137626966 16:49915137-49915159 ATGTTCCTCCAGGGTAAGGAAGG + Intergenic
1137734169 16:50711850-50711872 ATGTGCATCCAGGCCTCGGAGGG + Exonic
1138660948 16:58516466-58516488 GTGTCCCTGCAGGCCAGAGGAGG + Exonic
1139167928 16:64592179-64592201 ATGTACTTCCAGGGCAGGTATGG + Intergenic
1139953917 16:70684576-70684598 GAATCCCACCAGGCCAGGGATGG - Intronic
1140317073 16:73908843-73908865 ATATCCCTCTAGACCAGGCATGG + Intergenic
1140412133 16:74747650-74747672 ATGCCTCTCCAAGCCAAGGATGG + Intronic
1141265222 16:82490405-82490427 AGGTCCTTCCAGGCTAAGGAAGG + Intergenic
1142113209 16:88342913-88342935 GTGCCCCTCCAGGTGAGGGAGGG - Intergenic
1143397443 17:6612575-6612597 ATGTCACTTCTGGCCAGGGGCGG + Intronic
1144444001 17:15309595-15309617 TTGTGTCTCCAGGCCATGGAAGG - Intronic
1144578911 17:16447011-16447033 AGGTCCCTGCAGGCTGGGGAAGG - Intronic
1145001750 17:19310163-19310185 GTGTCCCTCCCAGTCAGGGAGGG + Intronic
1145902582 17:28498141-28498163 CGGTCCCACCAGGCCAGAGAAGG + Intronic
1146599833 17:34204828-34204850 ATGACACTCAGGGCCAGGGATGG - Intergenic
1146646096 17:34578580-34578602 CTGTCCCTCCAGAGCAGGGTAGG + Intronic
1147444005 17:40463883-40463905 AAGGCCCTGCAGGCCAGGGAAGG + Intergenic
1148274226 17:46289223-46289245 ATGTCACTGCAGTCCAGGCAGGG - Intronic
1148486593 17:47994981-47995003 ATCTCCATCCAGGCTTGGGAAGG + Intergenic
1149666065 17:58365381-58365403 ATGCTCTTCCAGGCCAGGGTGGG - Intronic
1149931118 17:60756576-60756598 ATGTCACTGCAGCACAGGGATGG - Intronic
1150289548 17:63973506-63973528 CCTTCCCTCCAGGCCAGGGATGG - Intergenic
1150379134 17:64707091-64707113 AGGTCCCTGCACGCCAGGGAGGG - Intergenic
1150408832 17:64925346-64925368 ATGTCACTGCAGTCCAGGCAGGG + Intergenic
1150760636 17:67957811-67957833 ATGTCACTGCAGTCCAGGCAGGG + Intronic
1151512598 17:74570429-74570451 CTGTCCCTCAAGGGCAGCGATGG - Intergenic
1151855850 17:76721272-76721294 TGGTCCCTCCAGGTCAGGGTTGG + Intronic
1152002867 17:77657470-77657492 ATGTTACTCCAGGCAGGGGAGGG + Intergenic
1152339079 17:79714565-79714587 CCGTCCCTCCAGCCCATGGAGGG + Intergenic
1152989363 18:349147-349169 CTGGGCCTCCAGGCCAGTGATGG - Intronic
1154149307 18:11893708-11893730 TTGGCCCTTCAAGCCAGGGATGG - Intronic
1154977756 18:21475644-21475666 AAGTTCATCCAGGCCAGGCATGG - Intronic
1155191496 18:23434865-23434887 ATGTACATCCAGGCCAGGAGTGG + Intronic
1156094500 18:33512418-33512440 ATGTCATGCCAGGCCAGGCACGG - Intergenic
1156290705 18:35747090-35747112 TTCTCCCTCCAGGGCAGGGCAGG - Intergenic
1156297832 18:35808846-35808868 TCCTCCATCCAGGCCAGGGACGG - Intergenic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1157228621 18:45891976-45891998 CTGTCTCTCCAGGCCAGCCAGGG - Intronic
1157521491 18:48348524-48348546 ATGTTGCTCCAGGCCAGGAGTGG + Intronic
1157683646 18:49626283-49626305 ATGTCCCCCAAGGCCATGGAAGG - Intergenic
1158647127 18:59256986-59257008 AGGACCCTCCAAGCCAGGCACGG - Intergenic
1159126655 18:64232112-64232134 AGGACCCTCCAAGCCAGGCACGG + Intergenic
1159922190 18:74236578-74236600 ATTTCCCACTAGGCCAGGGATGG + Intergenic
1160694527 19:476478-476500 ATGACACTGCAGGCCAGGCACGG - Intergenic
1160913132 19:1483918-1483940 ATGTCTCTCCACGTCAGGAACGG + Exonic
1161189514 19:2945245-2945267 AACTCACTCCAGTCCAGGGAGGG + Intergenic
1161229176 19:3163947-3163969 ATGTCCCCCCCAGCCTGGGAGGG - Intergenic
1161330919 19:3687409-3687431 ATGTCCCAACAGGGCAGGAAAGG + Intronic
1162793191 19:13073507-13073529 CCTTCCTTCCAGGCCAGGGATGG + Intronic
1163418784 19:17202721-17202743 ATGCCACTCCAGGTGAGGGAGGG + Intronic
1163613431 19:18312350-18312372 AGGTCCTTCCAGGTCAGGGGTGG + Intronic
1163648603 19:18504167-18504189 TTGTGCCAACAGGCCAGGGACGG + Intronic
1163864915 19:19764952-19764974 ATGTCCATGCTGGCCAGGCATGG + Intergenic
1163892238 19:20027350-20027372 ATGCCCTTCCATGCCAGAGATGG + Intronic
1164683330 19:30150400-30150422 ATGTCGCTCCGAGCCAGGGCTGG - Intergenic
1164952966 19:32354260-32354282 ATGCCCCACCAGGCCGGAGAAGG + Exonic
1165076712 19:33283416-33283438 CTGTGACTCCAGCCCAGGGAAGG - Intergenic
1165918650 19:39277780-39277802 ATGTGCCGCCAGGGCAGGGCTGG - Intergenic
1166139164 19:40796676-40796698 AGGCCCCACCAGGCCAGGGAAGG - Exonic
1166569435 19:43784559-43784581 AGCTGCCTCCAGCCCAGGGAGGG + Intergenic
1167212917 19:48144792-48144814 AGGTCCCTTCTGGCCAGGCACGG - Intronic
1167521562 19:49958851-49958873 TTGGCCCTCCAGGACCGGGAGGG + Exonic
1167606133 19:50481988-50482010 ACGTCACTACAGGTCAGGGAGGG - Intronic
1167767908 19:51496620-51496642 ACGTCCCTCCAGGCCGGGAAGGG + Intronic
1167772478 19:51529932-51529954 CTGGCCCTCCAGGACAGGGAGGG + Exonic
1168713179 19:58513129-58513151 ATGTCCATCAAGGTCGGGGAGGG + Intergenic
925342064 2:3144826-3144848 ATGTTCCTGCAGGTCAGGGCAGG - Intergenic
926645581 2:15287192-15287214 ATGTCCATCAAGCCCAGGAAGGG + Intronic
927459596 2:23286577-23286599 ATGTGCCTCTGAGCCAGGGATGG - Intergenic
929225994 2:39512228-39512250 ATGTCTTTCCAGGTTAGGGAAGG + Intergenic
929526565 2:42708895-42708917 GTGTCCCGCCAGGCCATGCAGGG + Exonic
930971976 2:57407611-57407633 ATGTCTCTGCAGGCAAGGGCGGG - Intergenic
931059349 2:58509264-58509286 ATGTGCATGCAGGGCAGGGAAGG + Intergenic
932411498 2:71550511-71550533 ATCTCCCAGGAGGCCAGGGATGG - Intronic
932454940 2:71843555-71843577 CTGTCCCTCCAGGACAGGCCTGG + Intergenic
932518006 2:72373343-72373365 ATGTCTGCCCAGGCCAGGCACGG - Intronic
932592356 2:73075079-73075101 ATTTCCCTCCAGTCCCTGGAGGG - Exonic
934521699 2:95024072-95024094 AAAGCCCTCCAGGCCAGGTAAGG + Intergenic
935074203 2:99724561-99724583 AGGTCACTCCAGGCCAGGTGCGG - Intronic
935074920 2:99731976-99731998 AACACCTTCCAGGCCAGGGATGG + Intronic
935218725 2:100994186-100994208 AAGCCCCCCCAGGACAGGGAAGG - Intronic
937042783 2:118834690-118834712 AAGTTCCTCCAGGCCTGGGTGGG + Intergenic
937909803 2:127069947-127069969 AGTTCCCTCCAGGCCAGAGCAGG + Intronic
937926680 2:127173242-127173264 ATTTCCCTCAAAGCAAGGGAAGG + Intergenic
938380370 2:130832991-130833013 ATGTAACTCAAGGCCAGGCACGG + Intergenic
938842335 2:135175162-135175184 ATGTCCCTCGGTGGCAGGGAGGG - Intronic
939181657 2:138810103-138810125 ATTTCCCTCCTGGCCACAGAAGG - Intergenic
943258922 2:185632702-185632724 ATGTCCCCAGAGGCCAGGCACGG + Intergenic
944025584 2:195162486-195162508 TTGTCCCTCCAGCCCAGAGCTGG + Intergenic
944049745 2:195454316-195454338 ATTTCCCTCAAGGGCAAGGAGGG - Intergenic
944155624 2:196604293-196604315 ATGTCCCTGGAGTCCAGAGAGGG - Intergenic
944269047 2:197760399-197760421 ATGCACCCCCAGGCCAGCGAAGG + Intronic
947031167 2:225797489-225797511 TTGTACCTCCAGAACAGGGAAGG - Intergenic
947517077 2:230815301-230815323 ATGATCCTCTAAGCCAGGGAAGG - Intronic
948992753 2:241563116-241563138 ATGCCTCTCCAGGGCAGAGATGG - Intronic
1170310029 20:14982458-14982480 CTGTGCCTCCAGGCCTGTGATGG - Intronic
1170793967 20:19530677-19530699 ATGTCCCTGCTGTCTAGGGATGG - Intronic
1171075102 20:22114972-22114994 AGGACCCTGCAGGCCAGGCACGG - Intergenic
1172000651 20:31773578-31773600 ATGGCACTTCAGGCCAGGCATGG - Intronic
1172613226 20:36266826-36266848 AGGTCCCACCAGGCCAAGGATGG - Intronic
1175123805 20:56736782-56736804 ATGTACCTCCAGGCCGGGCGTGG + Intergenic
1175151001 20:56934169-56934191 ATGGCCCCCAAGGCCAGGCATGG - Intergenic
1175541049 20:59747847-59747869 GTGCCCTTCCAAGCCAGGGACGG - Intronic
1175679392 20:60974950-60974972 ATCTCCCTCCATGCTAGGCATGG + Intergenic
1175823305 20:61923532-61923554 ATGTCCTTCCAGTCCACGGCAGG + Exonic
1176040173 20:63060992-63061014 ATGTCCCATCAGGGCCGGGAGGG + Intergenic
1176041772 20:63069503-63069525 AACTCCCTCCCGGCCAGGCACGG - Intergenic
1176183960 20:63767835-63767857 AAGTCCATCCAGGCCTGGGCTGG + Intronic
1176188447 20:63794772-63794794 GTGCTCCTCCAGGCCAGGGCAGG - Intronic
1179110700 21:38442694-38442716 CTCTCCCTCCTGGCCAGGCATGG - Intronic
1181167927 22:20993240-20993262 CTGCTCCTCCAGGCCTGGGAAGG - Intronic
1181432260 22:22888650-22888672 ATGTGCCTCCTGCCCAGTGAGGG + Intronic
1181490457 22:23258034-23258056 CTGTCCCCCCAGGGCAGGGTAGG - Intronic
1181613615 22:24036571-24036593 ATCACCCTCCAGGTCAGTGAGGG + Intronic
1181734444 22:24870685-24870707 GAGTCCCTTCTGGCCAGGGATGG + Intronic
1182521520 22:30887417-30887439 AAGTCCCTGCAGGCCTGGGGAGG - Exonic
1182942082 22:34286470-34286492 ATGTTCCTCCAGCCCTGGGGTGG + Intergenic
1183245184 22:36687825-36687847 AAGTGGCTACAGGCCAGGGAAGG + Intronic
1183469564 22:37998312-37998334 AACTCCCTCAAGGCCAGGGCCGG + Intronic
1183685520 22:39359329-39359351 ATGCCCCCCCAGGCCGGGCACGG + Intronic
1185184693 22:49391969-49391991 ATGCCCGGCCTGGCCAGGGAGGG - Intergenic
949259310 3:2086543-2086565 ATGTCCAACCAGGCCAGGCACGG + Intergenic
949391696 3:3569348-3569370 ATGTCCTTACATGGCAGGGATGG - Intergenic
950778655 3:15372584-15372606 TTGTCCCTCCAGCCCAGTGGGGG - Intergenic
951670347 3:25174516-25174538 ATGTCCATGAAGGCCATGGAGGG - Intronic
952715129 3:36472315-36472337 CTGTGCCTCCAGGCCTGTGATGG + Intronic
952990324 3:38826076-38826098 CTGTTCCCCCAGGCCAGAGATGG + Intergenic
953171569 3:40512087-40512109 CTGTCCCTCCAACCCTGGGAGGG + Intronic
953331675 3:42058632-42058654 GGTTCCCTCCAGGCCAGGCATGG - Intronic
953473590 3:43186918-43186940 ATGGCCCTCCAGAACAGGGAGGG - Intergenic
953634184 3:44648618-44648640 ATGTCGCCCCAGACCAGGGATGG - Intergenic
953996692 3:47525256-47525278 ATATCCCTTCAGGCCAGGCACGG + Intergenic
954316379 3:49803871-49803893 ATGCCCCTCCAGTCCTGGGCAGG + Intronic
954417346 3:50399785-50399807 AGGCCCCACCTGGCCAGGGATGG - Intronic
954625749 3:52021096-52021118 GTCTCTCTCCAGGCCAGGGCAGG - Intergenic
955415373 3:58686631-58686653 ACGGCCCTGCAGGCCAGGAAGGG - Intergenic
955478156 3:59360585-59360607 AGGACCCTCCAAGCCAGGCATGG + Intergenic
956589488 3:70898595-70898617 AGGACCCTCCAAGCCAGGCACGG + Intergenic
958618478 3:96526990-96527012 ATGACCCACCAAGCCAGGCACGG - Intergenic
960497417 3:118391789-118391811 ATGTTCCTTCAGGCCAGGCGCGG - Intergenic
960587614 3:119334638-119334660 ATATCCCTGCTGGCCAGGGATGG - Intronic
960658121 3:120028702-120028724 ATGTCCTTGCAGGCCATGGTGGG + Intronic
960917571 3:122712536-122712558 ATGTCAATCCTGGCCAGGCATGG - Intronic
960983383 3:123253421-123253443 ATGTCCCTGCTGGCCAGGCACGG + Intronic
961326962 3:126114684-126114706 CGGTCCCTCCAGGGCAGGTAGGG + Intronic
961647144 3:128398629-128398651 GTGTCCCTGCAGGCCCGGCAGGG - Intronic
962902884 3:139776312-139776334 ATGACACTGCAGGTCAGGGAAGG - Intergenic
963883609 3:150555217-150555239 ATGTGCATACAGGCCAGGCATGG - Intronic
964247608 3:154671663-154671685 AGGACCCTACAGGCCAGGGGAGG - Intergenic
964978383 3:162647458-162647480 CTGTTCCTCCAGGCCTGTGATGG - Intergenic
966600038 3:181765850-181765872 TTGTTCCTGCAGTCCAGGGAGGG + Intergenic
966810259 3:183837559-183837581 TTGTCACTGCAGGGCAGGGATGG - Intronic
966905372 3:184520475-184520497 ATCTCCCTCCCCACCAGGGAGGG - Intronic
967569896 3:191016231-191016253 AGGACCCTCCAAGCCAGGCACGG + Intergenic
967963264 3:194941867-194941889 ATCTTCCCACAGGCCAGGGAGGG - Intergenic
967974614 3:195026189-195026211 ATGTCCACCCAGGCCAGGAGCGG + Intergenic
969294713 4:6263090-6263112 AAGCCCCTCCAGGGCAGGTACGG + Intergenic
969623857 4:8292656-8292678 GTGTACATCCAGGGCAGGGAGGG - Intronic
969872587 4:10114140-10114162 ATCTACATCCAGCCCAGGGAGGG + Intronic
970257577 4:14184533-14184555 ATCTCCCTTCAGACCTGGGAGGG + Intergenic
972872659 4:43319653-43319675 ATGTCCCTCCAGCCTAGGGATGG - Intergenic
974061727 4:57041827-57041849 AGGTGCCTCCTGGCCAGGCATGG - Intronic
976116781 4:81736472-81736494 TAGTCCCTCCAGTCAAGGGATGG - Intronic
977712074 4:100137811-100137833 ATGTCACTAAAGGCCAGGCATGG - Intergenic
977779221 4:100960697-100960719 ATATCCATCCATTCCAGGGATGG + Intergenic
977925400 4:102694834-102694856 ATAAGCCTTCAGGCCAGGGAGGG - Intronic
978455045 4:108879735-108879757 ATGTACCACCAGGCCGGGCACGG - Intronic
980911278 4:138996946-138996968 AGTTCCCTCCCGGCCAGGCATGG - Intergenic
983470246 4:168146197-168146219 ATGCCACTCAAGGCCAGGCATGG - Intronic
983505358 4:168547428-168547450 ATCTCCTTCCAGGCCAGGCATGG + Intronic
983784560 4:171715512-171715534 TGGTTCCTTCAGGCCAGGGAGGG + Intergenic
984043973 4:174774107-174774129 GAGTCCCACCAGGCCAAGGAAGG + Intronic
985051742 4:185998500-185998522 AAGACCCTCCAGGCCAGGCGTGG - Intergenic
985827765 5:2205330-2205352 ATGTCACGCCAGGGCATGGAGGG + Intergenic
989103486 5:37840227-37840249 CTCTCCCTGCAGCCCAGGGAGGG - Intergenic
994051699 5:95369472-95369494 ATCTTCCTCCAGGCTAGGTAAGG - Intergenic
994172070 5:96668885-96668907 GTGTCCCTCTAGACTAGGGATGG - Intronic
994266587 5:97723563-97723585 AGGACCCTCCAAGCCAGGCACGG + Intergenic
994644348 5:102450636-102450658 TGGTGCCTCCAAGCCAGGGAGGG - Intronic
994865248 5:105260347-105260369 ATATCACTCCAGGCCAGAAAGGG + Intergenic
995690381 5:114819068-114819090 AGGACCCTCCAAGCCAGGCATGG + Intergenic
998136596 5:139677311-139677333 ATCCCCTTCCAGGCCAGGAAGGG - Intronic
999373365 5:151069576-151069598 TTTTCCCTCTGGGCCAGGGAGGG - Intronic
1000347047 5:160322942-160322964 ATGTCCCTCAAGGCCAGGCGCGG + Intronic
1001367865 5:171162379-171162401 AGGTCCCTCTTGGCTAGGGAAGG + Intronic
1001802504 5:174556437-174556459 ATTTCACTTCAGGCCAGGCATGG + Intergenic
1002419856 5:179139800-179139822 AGGGCCCTCCAGGACAGGGCTGG + Intronic
1003585801 6:7388205-7388227 ATGTCACTCCAGGCTATGGATGG - Intronic
1003621593 6:7705538-7705560 TCGTCCCTTCAGGCCAGGCATGG - Intergenic
1003703226 6:8494222-8494244 AGGTCACTCAAGGACAGGGAGGG - Intergenic
1004272715 6:14210210-14210232 ACGTGCCTCGAGGCCAGGCATGG + Intergenic
1004883552 6:20031589-20031611 ATTTCCCTCCAGGCCAGTGGGGG - Intergenic
1005854826 6:29852848-29852870 ATGTCCTTCCAGGACTGGGCTGG + Intergenic
1006338127 6:33431629-33431651 CTCCCCCTCCAGTCCAGGGAGGG + Intronic
1006397916 6:33799030-33799052 CTCTGCCTCCAGGCCAGGCAGGG + Intronic
1006836674 6:37003032-37003054 AGGCGCCCCCAGGCCAGGGAGGG + Intergenic
1007393754 6:41565552-41565574 ATGTCCCCCCAGGTGAGGGGTGG - Intronic
1007661745 6:43490907-43490929 TTCTCCCTCCAGGCTTGGGAAGG + Intronic
1007735155 6:43977775-43977797 GTCTCCCTCGAGGCCAGGCAGGG - Intergenic
1008050577 6:46896456-46896478 ATCTACCTCCAGTCCAGAGAAGG - Intronic
1008441865 6:51540813-51540835 ATGTCCCTCCGGGGCAAGAATGG - Intergenic
1008874137 6:56307508-56307530 AGGACCCTCCAAGCCAGGCACGG + Intronic
1009468160 6:63999592-63999614 ATTTCCCTGTAGGCCAGGGAGGG - Intronic
1011303098 6:85896745-85896767 AGGACCCTCCAAGCCAGGCATGG + Intergenic
1011306790 6:85936226-85936248 AGGACCCTCCAAGCCAGGTACGG + Intergenic
1011551519 6:88535086-88535108 TTGCCCTTCCAGGCAAGGGAAGG + Intergenic
1012003301 6:93681358-93681380 ATGTACCTACAGGCAAGGGAGGG + Intergenic
1012931861 6:105325872-105325894 AAGTCCCTTAAGGCCAGAGAAGG + Intronic
1016495162 6:144653293-144653315 ATCTCCCTCTTGGCCAGGCACGG + Intronic
1018288506 6:162265828-162265850 ATGTGCCTACAGGTCAGCGAGGG - Intronic
1018777090 6:167027581-167027603 ATGTCTCTCCAGAAGAGGGAAGG - Intronic
1018808663 6:167281373-167281395 TTCTCACTCCTGGCCAGGGAGGG - Intronic
1019368474 7:647514-647536 ACGTACCTCCAGGCCAGGCGCGG + Intronic
1019434438 7:1014908-1014930 CCGTCCCTGCAGGGCAGGGAGGG - Intronic
1019751339 7:2732259-2732281 ATAATCCTCCAGGCCAGGCACGG + Intronic
1024747135 7:52420961-52420983 AAGTCACTCCAGCCCAAGGACGG + Intergenic
1025869213 7:65415128-65415150 AGGACCCTCCAAGCCAGGCACGG - Intergenic
1026972795 7:74478194-74478216 CTGTCCCTCCACGCAAGGGGCGG - Intronic
1027933321 7:84568689-84568711 TTGTCCTGCTAGGCCAGGGATGG + Intergenic
1029573933 7:101390713-101390735 AAGTGGCTCCAGGCCAGGCATGG - Intronic
1029618721 7:101676677-101676699 CTGTCCCTCCAGGCGAGGCTGGG - Intergenic
1030561476 7:111092172-111092194 CTGTCCCTTCAGACCAGCGAGGG - Intronic
1031034027 7:116767277-116767299 ATGTCACACCTGGCCAGGGTTGG + Intronic
1031102604 7:117500578-117500600 ATGTCCCATCAGGCCAGGCGCGG - Intronic
1031403008 7:121347446-121347468 ACCTTCCTCCAGGCCAGTGAGGG - Intergenic
1032268766 7:130385609-130385631 ATGTGCCTGAAGGGCAGGGAAGG + Intronic
1032589862 7:133182103-133182125 ATACCCTTCCAGGCCAGGCACGG + Intergenic
1033421397 7:141207764-141207786 GTGTCCCACCAGTCCAGGGATGG + Intronic
1033502463 7:141965739-141965761 ATTTCCCTCCAGCCCAGGACAGG + Intronic
1034011276 7:147531644-147531666 ATGGGCCTCCAGGCCTGTGATGG + Intronic
1034406253 7:150904420-150904442 ATGTCCCTCCAGGACAGTGGTGG + Intergenic
1034429231 7:151032866-151032888 ATGGCGCCCCAGGCCAGGGAGGG + Intronic
1034434062 7:151054766-151054788 GTGTCCCTCCAGGTGAGAGATGG - Intronic
1034708683 7:153171155-153171177 CTGACACTCCAGGACAGGGAGGG - Intergenic
1034915384 7:155034652-155034674 ACCTCCCTCCCGGACAGGGAGGG - Intergenic
1035375131 7:158402663-158402685 ATGTTCCTGCAGGGAAGGGAAGG + Intronic
1036212749 8:6855377-6855399 ATGCCTCTACAAGCCAGGGAAGG - Intergenic
1037308428 8:17529825-17529847 ATGTCCCTCTGGGCCAGGCGTGG - Intronic
1037760392 8:21738106-21738128 TTGTCCCTCCATGCCAGACAAGG + Intronic
1038179757 8:25215141-25215163 ATGGTTCTTCAGGCCAGGGAAGG + Intronic
1039353914 8:36794630-36794652 AAGTCCATCCTGGCCAGGCATGG + Intronic
1042784293 8:72530764-72530786 ATATCCCTACTGGCCAGGCAAGG - Intergenic
1045463313 8:102445668-102445690 ATGTCACATCAGGCCAGGCACGG - Intergenic
1045836158 8:106524064-106524086 ATTCCACTCCAGGCCAGGGATGG - Intronic
1047102387 8:121692395-121692417 ATGACCCTACTGGCCAGGCACGG + Intergenic
1047991387 8:130290297-130290319 AAGTCCTTCAAGGGCAGGGATGG + Intronic
1048480784 8:134790722-134790744 ATTTTCCTTCAGGCCAGGCATGG + Intergenic
1048991611 8:139763820-139763842 ATGTTCCAGCAGGCCAGTGATGG + Intronic
1049469369 8:142768616-142768638 GTGGCCATCCAGGCCAGGGATGG - Intronic
1049569883 8:143364400-143364422 ATGTCCCTCCCGGCCGCTGAGGG - Intergenic
1050286589 9:4108988-4109010 ATGTCTCTCTAGACCGGGGAAGG - Intronic
1050510917 9:6394462-6394484 ATGTACATCTAGGCCAGGCATGG + Intergenic
1051745119 9:20288236-20288258 AGGAACCTCAAGGCCAGGGAAGG + Intergenic
1052903366 9:33814479-33814501 ATCACCCTCCAGGTCAGGGTGGG + Intergenic
1053016188 9:34663647-34663669 ATGTTCCTCCAGGCCCAGGAAGG - Intronic
1053547019 9:39034042-39034064 ATGGCACTCCTGGCCAGGCATGG + Intergenic
1053578146 9:39373439-39373461 AAGCCCCTGCAGGCCTGGGAAGG + Intergenic
1053811337 9:41855702-41855724 ATGGCACTCCTGGCCAGGCACGG + Intergenic
1053842675 9:42201494-42201516 AAGCCCCTGCAGGCCTGGGAAGG + Intergenic
1054099731 9:60932226-60932248 AAGCCCCTGCAGGCCTGGGAAGG + Intergenic
1054121128 9:61207847-61207869 AAGCCCCTGCAGGCCTGGGAAGG + Intergenic
1054586611 9:66974658-66974680 AAGCCCCTGCAGGCCTGGGAAGG - Intergenic
1054619257 9:67331737-67331759 ATGGCACTCCTGGCCAGGCACGG - Intergenic
1055314160 9:75016737-75016759 AAGTCCCTCCAGGTCATTGATGG + Intronic
1055803993 9:80072625-80072647 ATTTCCTTCAAGCCCAGGGAGGG - Intergenic
1056100358 9:83294960-83294982 AGGTCCCTCCAGGCCAGGCTAGG + Intronic
1056521680 9:87407760-87407782 GAGTCCCTACAGGCCAGGCACGG - Intergenic
1057213866 9:93217713-93217735 GTGTCCCTCTAAGCCAGGAATGG - Intronic
1057299006 9:93865761-93865783 CTGTCCCACCAGGGCAGGGCAGG - Intergenic
1057807107 9:98227464-98227486 ATGTAACTCCTGGCCAGGCACGG + Intronic
1057873170 9:98733286-98733308 AAGTCCCTGCTGGCCACGGAGGG - Exonic
1058208439 9:102136496-102136518 AAGTCCCTTCTGGCCAGGCACGG - Intergenic
1058261496 9:102838789-102838811 ATGTATTTCCAGGCCAGGTATGG + Intergenic
1059151072 9:111950205-111950227 ATGCCCCTCTAGGCCGGGCATGG + Intergenic
1059561789 9:115341679-115341701 AGCTGCCTCCAGGCCTGGGATGG + Intronic
1060217532 9:121747213-121747235 TTTTTCCTACAGGCCAGGGAGGG + Intronic
1060302554 9:122383770-122383792 ATGACCTTCCAGGGCAGGGCAGG - Intronic
1060920961 9:127419936-127419958 ATGTTCCCCCAGGGCAGGCACGG - Intergenic
1061655055 9:132083121-132083143 ATGGCCATCCAGGCCAGGCGTGG + Intergenic
1186311003 X:8319163-8319185 ATAAATCTCCAGGCCAGGGATGG - Intergenic
1186488261 X:9950723-9950745 AAGTCACTGCAGCCCAGGGATGG + Intergenic
1186894658 X:13993713-13993735 ATATACATCCAGGCCAGGCATGG - Intergenic
1188103605 X:26121312-26121334 ACCTCCCTCCAGCACAGGGATGG + Intergenic
1189481172 X:41393386-41393408 ATTTCCTTCCAGGCCAGGCGCGG - Intergenic
1190797084 X:53755915-53755937 TTGTCCCTCCAGGTGAGGTATGG + Intergenic
1192391027 X:70728519-70728541 AGGACCCTCCAAGCCAGGGGTGG - Intronic
1192527787 X:71862341-71862363 ATGGGCCTCCAGGCCTGGGATGG + Intergenic
1192633861 X:72800107-72800129 GAGACCCTGCAGGCCAGGGAAGG - Intronic
1192647849 X:72920694-72920716 GAGACCCTGCAGGCCAGGGAAGG + Intronic
1193196601 X:78639540-78639562 GTTCCCCTCCAGGCTAGGGAGGG - Intergenic
1193698506 X:84737954-84737976 GACTCCCTCCAGGCCAGGGCTGG + Intergenic
1195011062 X:100732269-100732291 ATGTCCTTCCAGGTTAGGAATGG + Intergenic
1195258467 X:103110808-103110830 TTGTCCCTCCAGGCCAGGCATGG - Intergenic
1195669756 X:107459581-107459603 ATTTCCCTCCAATCCAGGGCTGG - Intergenic
1197762362 X:130036853-130036875 AAGTCTCTCCAGGCCAGGTGCGG + Intronic
1198213200 X:134533983-134534005 ATGCACCTCCAGGACTGGGAAGG - Intergenic
1199511253 X:148625573-148625595 ATGTCCATCCAGTCCAGAGGAGG - Intronic
1199715439 X:150504443-150504465 TTGTTCTTCCAGGCCAGGGCAGG - Intronic
1200244508 X:154515963-154515985 AGGCCCCTCCTGGCCAGGCAGGG - Exonic
1200284246 X:154805351-154805373 ATGACCCTCAAGGCGAGCGAGGG - Exonic
1202085209 Y:21129303-21129325 AGGACCCTCCAAGCCAGGCATGG + Intergenic