ID: 923208819

View in Genome Browser
Species Human (GRCh38)
Location 1:231784574-231784596
Sequence AGAGTAATCTGACCAAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923208819_923208820 3 Left 923208819 1:231784574-231784596 CCTGATTTTGGTCAGATTACTCT 0: 1
1: 0
2: 0
3: 16
4: 161
Right 923208820 1:231784600-231784622 ATATTTTCTTACTATAATCCAGG 0: 1
1: 0
2: 1
3: 35
4: 325
923208819_923208821 8 Left 923208819 1:231784574-231784596 CCTGATTTTGGTCAGATTACTCT 0: 1
1: 0
2: 0
3: 16
4: 161
Right 923208821 1:231784605-231784627 TTCTTACTATAATCCAGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923208819 Original CRISPR AGAGTAATCTGACCAAAATC AGG (reversed) Intronic
901101758 1:6724528-6724550 AGAGGATTCTGACCAAAGTAAGG - Intergenic
906904339 1:49873143-49873165 AGAGTAATATGGCCTATATCAGG + Intronic
909789906 1:79663008-79663030 AGAGTAATGTGATTAAATTCTGG - Intergenic
911158798 1:94662052-94662074 AGAGTAATATGGCCTATATCAGG - Intergenic
911763233 1:101640721-101640743 AGAGGAGTCTGACTAAAATTTGG + Intergenic
912157997 1:106946036-106946058 AGTGTACTCTGAGAAAAATCTGG - Intergenic
912780762 1:112545329-112545351 ATAGTAATATGAATAAAATCAGG - Intronic
913699986 1:121365120-121365142 TGAGTAATCTGACCATAATTGGG + Intronic
914040535 1:144045574-144045596 TGAGTAATCTGACCATAATTGGG + Intergenic
914137552 1:144914905-144914927 TGAGTAATCTGACCATAATTGGG - Intronic
917271114 1:173275557-173275579 AAAATAATCTGACCAACAGCAGG + Intergenic
920487403 1:206383841-206383863 TGAGTAATCTGACCATAATTGGG + Intronic
921087327 1:211807817-211807839 AGAGTACTTTGCCCAAACTCAGG - Intronic
921696872 1:218221838-218221860 AAAATAAACTGACAAAAATCAGG + Intergenic
923208819 1:231784574-231784596 AGAGTAATCTGACCAAAATCAGG - Intronic
1063283818 10:4661370-4661392 AAGGTAATATGAGCAAAATCTGG - Intergenic
1063796437 10:9518211-9518233 AAAATAATCTGTCCAGAATCTGG - Intergenic
1064626367 10:17266017-17266039 AGACTAGTCTGGCCAAAATGGGG + Intergenic
1065282820 10:24157165-24157187 AGACTAATCATACCAAAGTCTGG - Intronic
1065846824 10:29751389-29751411 ATAGTACTATGACCAAAACCAGG - Intergenic
1066434018 10:35380063-35380085 AGTGTAACCTAACCAATATCTGG - Intronic
1069037575 10:63661493-63661515 AGAGTGAGCTGACCAAACTCAGG + Intergenic
1074364871 10:112849797-112849819 AGGGAAATCTGAACAAAATATGG - Intergenic
1078141994 11:8699636-8699658 ACAGTCATCTGACAAAGATCTGG + Intronic
1078425719 11:11249398-11249420 AGAGGAATCTGACCCATGTCAGG + Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1082689649 11:56284395-56284417 AGAGAAATATAACCAATATCAGG + Intergenic
1083333546 11:61910310-61910332 AGGGAAATCTGACCCAATTCTGG + Intronic
1085291558 11:75403898-75403920 AGAATAATTTGACCAGAGTCCGG - Intronic
1088362154 11:109002156-109002178 AGTGTAGTCTCACCATAATCAGG + Intergenic
1088688046 11:112301172-112301194 AGAGTATGATGATCAAAATCAGG + Intergenic
1091178483 11:133582077-133582099 AGAGTGATCTGACGTACATCCGG - Intergenic
1091969645 12:4775527-4775549 AGAGTACAATGATCAAAATCAGG - Intronic
1093049742 12:14491430-14491452 AAATAAATCTGACCAAATTCAGG - Intronic
1093472357 12:19516190-19516212 AGAGTAATCTACCAAAAATTTGG + Intronic
1095473954 12:42566131-42566153 AGAGTGATCCGTCCAAAATGAGG - Intronic
1097447597 12:59691579-59691601 AGAGCAATCTGAGCAACATGAGG - Intronic
1097835074 12:64264835-64264857 AGAGTAGACTGAAGAAAATCAGG + Intronic
1097859085 12:64500183-64500205 ATAATACTCTGAACAAAATCTGG - Intronic
1099820357 12:87701064-87701086 GGAGTAATCTGACTTACATCTGG - Intergenic
1099938888 12:89161214-89161236 AGAGAAATTCAACCAAAATCTGG + Intergenic
1100285622 12:93163755-93163777 AGCGTAGTCTGACCAACATGAGG + Intergenic
1100680865 12:96919098-96919120 AGAGAAAAGTGACCAAAATTGGG - Intronic
1100895166 12:99173874-99173896 ATAGGTATATGACCAAAATCTGG + Intronic
1105269857 13:18862569-18862591 ATAGTAATCAGACCAGAAACAGG + Intergenic
1105351387 13:19619398-19619420 AGAGGAATCTGACTAAAGTGTGG - Intergenic
1107848264 13:44542343-44542365 ATATTAATCTGAGCAAGATCTGG - Intronic
1110098150 13:71558070-71558092 AGAGAAAAATGATCAAAATCAGG - Intronic
1110680325 13:78303115-78303137 AGGGTAATCTGACAAAAACACGG + Intergenic
1110903619 13:80857257-80857279 ATAGTAATCTGCCAAAAAACAGG - Intergenic
1113279161 13:108769637-108769659 AGAGCAATCTGAGCAAGACCGGG + Intronic
1113549146 13:111178390-111178412 AAGGTAAACTGACAAAAATCTGG - Intronic
1114882295 14:26801121-26801143 AGAGTAATCTCATCAAAACTTGG + Intergenic
1115490890 14:33957218-33957240 AAACAAATCTGAACAAAATCAGG - Intronic
1116279269 14:42881269-42881291 AGAGTAACCTGATCTATATCTGG - Intergenic
1117713036 14:58552048-58552070 AGAGGCATATGACCAAAAGCAGG - Intergenic
1117829141 14:59733060-59733082 AAAGCAGTCTGACCACAATCTGG - Intronic
1124945730 15:34263508-34263530 AGAGGCATCTGACAAAAATTCGG + Intronic
1126413620 15:48396231-48396253 AGAGGTATCTGACAAGAATCTGG - Intergenic
1126419038 15:48452093-48452115 AGATTAATCTGACCCAGCTCAGG + Intronic
1126497963 15:49313375-49313397 AGAGCAAGCTGACCAGAATCTGG - Intronic
1127051435 15:55088352-55088374 AGAGAAATTTAACCAAAATTTGG - Intergenic
1128631445 15:69272545-69272567 GGAGTAACCTGAGCAAAAACAGG + Intergenic
1128642734 15:69351745-69351767 TGAGAAATCTGACAAAATTCAGG + Intronic
1130434104 15:83879775-83879797 AGAATAAGCAGACAAAAATCAGG - Intronic
1135735939 16:24931789-24931811 AGGGAAATCTGAACAAAATGTGG + Intronic
1143931498 17:10433019-10433041 ACAGTAATATGACAAAAATGGGG - Intergenic
1146557130 17:33835227-33835249 ACAGTAACCTGTCCAAATTCAGG - Intronic
1147176560 17:38659446-38659468 AGAGGCATCTGACCAGAAGCGGG - Intergenic
1147877759 17:43633434-43633456 AGAGCACTCTGACTAGAATCTGG + Intergenic
1148933688 17:51147939-51147961 AGATCAGTCTGACCAAAATGGGG - Intergenic
1155034561 18:22014964-22014986 AGACCAACCTGACCAAAATGGGG + Intergenic
1155633656 18:27924614-27924636 ACAGTAAGATGATCAAAATCTGG + Intergenic
1155650897 18:28140281-28140303 AGAGTAACCAGACAAAAAACAGG + Intronic
1155755516 18:29490193-29490215 AAGGTAATCTGATAAAAATCTGG - Intergenic
1155898187 18:31354969-31354991 AGAGTAATCCAACCAACTTCCGG + Exonic
1159848458 18:73495499-73495521 AGAGAATTGTAACCAAAATCAGG + Intergenic
1163137494 19:15323225-15323247 AGAGAAATTTGATCAGAATCTGG - Intronic
1165789108 19:38480637-38480659 AGAGAAATCTGAACACAAACTGG - Intronic
1167850539 19:52197995-52198017 TTAATAATCTGAACAAAATCAGG + Intronic
926701269 2:15805497-15805519 AGAGTAATGTGATCAGATTCAGG + Intergenic
927455839 2:23248544-23248566 GGAGTAATCTAACCAGAATATGG + Intergenic
928506655 2:31960782-31960804 AGAGCAGTCTGACCAACATGGGG - Intronic
932862800 2:75312086-75312108 AGAGTGATCTGGCCAATAGCAGG + Intergenic
933466241 2:82656294-82656316 AAAGTAATCTGTACACAATCAGG + Intergenic
935138407 2:100328848-100328870 AGAGTAATCAGAAAATAATCTGG + Intergenic
937876424 2:126829105-126829127 AGAGAAATCTGAACACATTCTGG + Intergenic
938624479 2:133093407-133093429 ATAGTAATGTGAACAAATTCAGG - Intronic
939756290 2:146116315-146116337 AGAGTAAGCTGAGAACAATCTGG + Intergenic
939771900 2:146331547-146331569 AGAGTCATATTACTAAAATCAGG - Intergenic
940032272 2:149276199-149276221 ACAGTAATTTGACAAAAGTCAGG - Intergenic
941302565 2:163822027-163822049 AGAGTAATCTGATCAATAAATGG - Intergenic
941378118 2:164755955-164755977 AGAGTAAGGTGAACAAAAGCTGG - Intronic
942310399 2:174651219-174651241 AGAGTAATCTGAGCATATACAGG - Intronic
942449964 2:176102865-176102887 AGAGAAGTCAGACCAAAATTCGG - Intergenic
945582546 2:211613577-211613599 CTAATAATCTGACCAAAATGTGG + Intronic
945830698 2:214781156-214781178 AGAGGAATCTAAGCAAAAGCTGG - Exonic
946808861 2:223500797-223500819 GAAGTAACTTGACCAAAATCCGG - Intergenic
1169521885 20:6382854-6382876 AGAGTAATCTCACCGAGATAGGG - Intergenic
1170160867 20:13308939-13308961 AGAGGACTCTCAGCAAAATCTGG + Intergenic
1170385536 20:15812142-15812164 ATTGTAAACTGAACAAAATCAGG + Intronic
1170932021 20:20777572-20777594 AGAGTAAACTGAACAAAACCAGG + Intergenic
1176149061 20:63579718-63579740 AAATTAATCTGACCCAAATATGG + Intergenic
1178878875 21:36433015-36433037 AGAGTAAGCAGACAAAAAGCAGG - Intergenic
1179066575 21:38030163-38030185 AGAGTAATCTGAGGACATTCAGG + Intronic
1179768465 21:43594063-43594085 AGAGTAATTACACCAAAAGCTGG + Intronic
1181663757 22:24374968-24374990 AGACTAAAGTTACCAAAATCAGG + Intronic
1184459594 22:44629504-44629526 AGACCAGCCTGACCAAAATCGGG + Intergenic
949184395 3:1172689-1172711 TCAGTCATCTCACCAAAATCCGG + Intronic
951679275 3:25277537-25277559 AGAGTAAAATGAGCAAAATAAGG + Intronic
951952088 3:28210970-28210992 TAAATAATCTGAACAAAATCTGG + Intergenic
953552299 3:43912989-43913011 AGAGTGATTTTACCAAAATAAGG + Intergenic
954659431 3:52219059-52219081 AGACTATTCTGGCCACAATCAGG - Intergenic
958689767 3:97448931-97448953 AAAGTAATGTGGCCAAAATGTGG + Intronic
958762166 3:98321918-98321940 AAATTAATCTGACAAAAATCAGG - Intergenic
959794452 3:110407158-110407180 TAAGTAACCTGTCCAAAATCAGG - Intergenic
962084088 3:132172542-132172564 ACAGTAATCTCACGAAAATCAGG - Intronic
962213710 3:133501772-133501794 AGAGTAATTTGCACAAAATTTGG - Intergenic
963386497 3:144601545-144601567 AGAGTAAACTGCACAACATCAGG - Intergenic
963866823 3:150370385-150370407 AGAGGAATCTGCCCACACTCAGG + Intergenic
964080425 3:152747435-152747457 AGAGTAAGCTGAGCAATATAAGG + Intergenic
964156900 3:153596589-153596611 AGAGTCATTTGAATAAAATCTGG + Intergenic
966084382 3:176050345-176050367 AGAGTAATATAATCAAAATTTGG - Intergenic
967894030 3:194382758-194382780 TGGTTAATCTGAGCAAAATCAGG + Intergenic
968339160 3:197940424-197940446 AGAGTGATTTGACCAAAGTTTGG - Intronic
970395657 4:15662898-15662920 AGATTATTCTGACAAAGATCTGG - Intronic
971333046 4:25698171-25698193 GGAGTAAGCTCCCCAAAATCTGG - Intergenic
972053226 4:34766871-34766893 AGAGTTATCTGAGTAAATTCTGG + Intergenic
972952995 4:44352182-44352204 AGTGTAATCTGACAAAAGTCTGG - Intronic
975183179 4:71370537-71370559 AGAGTAATTTGCCCAAAGTCAGG - Intronic
975640202 4:76492869-76492891 GGAGTAATCTCAACAAAATTTGG + Intronic
976365154 4:84224958-84224980 AAAAAAATCTGACCAAAATGAGG - Intergenic
978739553 4:112121382-112121404 TGAGTGTTCTGTCCAAAATCAGG + Intergenic
982848806 4:160284162-160284184 AGAGAATAATGACCAAAATCAGG + Intergenic
983675702 4:170289917-170289939 AGAGGACTCTCACCAGAATCTGG - Intergenic
984274538 4:177594008-177594030 AGAGTAGTCAGACCAAGAACTGG - Intergenic
987506053 5:18774397-18774419 AATGTAATCAGACCAAAATAGGG - Intergenic
988792495 5:34621464-34621486 AGAGGAATTTGCCCAAAGTCTGG + Intergenic
989479457 5:41913227-41913249 AAAGTAATCTGATTAAATTCTGG - Intronic
989610429 5:43285720-43285742 AGAATATTATGACCAAATTCAGG + Intergenic
989786885 5:45343362-45343384 AGAGAAATCAGACCAAATGCTGG + Intronic
994300932 5:98146607-98146629 GGAGTAATCTGGGTAAAATCAGG - Intergenic
995771330 5:115673985-115674007 AGACTAAACTTACTAAAATCAGG - Intergenic
995951189 5:117715986-117716008 AGAGCAATCTGAGAATAATCAGG - Intergenic
997151047 5:131495561-131495583 AGAGGAATTTGAAAAAAATCTGG - Exonic
1000808478 5:165828713-165828735 AGAGCAATCAGATAAAAATCAGG - Intergenic
1005326304 6:24704102-24704124 AGAGTAAAATTACCAAACTCAGG - Exonic
1011034148 6:82955236-82955258 AGAGTAATCTAAACCAAATATGG - Intronic
1012908738 6:105096134-105096156 AGGGGAAGCTGACCAAAAGCTGG + Intergenic
1014371101 6:120608690-120608712 GGGGTTATCTGTCCAAAATCTGG + Intergenic
1014789119 6:125651775-125651797 ACAGTAGACTTACCAAAATCAGG + Intergenic
1016026049 6:139288162-139288184 AGAGTAATCTGAGATAAAACTGG + Intronic
1016818032 6:148321642-148321664 AGACTAAGCTCATCAAAATCAGG + Intronic
1017044146 6:150331311-150331333 AAATAAATCTGACTAAAATCCGG - Intergenic
1021440628 7:20670213-20670235 AGAGAAATCTGAATAAAATATGG + Intronic
1028637367 7:93004697-93004719 AGAGTAATCTGACCATGATATGG + Intergenic
1034824428 7:154248665-154248687 AGAGCAATCTGGCCAAGATGGGG + Intronic
1035473547 7:159127120-159127142 TGAGTCATCTGAAGAAAATCCGG - Intronic
1041391047 8:57347649-57347671 AGATGAATCTGACCCATATCAGG - Intergenic
1041606693 8:59790097-59790119 AAAGTAATCTGAACAAAGTATGG + Intergenic
1045546339 8:103132400-103132422 ACAGTCATATGACCAAATTCAGG - Intergenic
1046479786 8:114800846-114800868 AGAGCAAGCTCCCCAAAATCTGG + Intergenic
1047633045 8:126729126-126729148 AAAGTAATTTGGCCAAGATCAGG + Intergenic
1051751155 9:20342147-20342169 AGAGTCATTTGACCAAAGTTTGG - Exonic
1052396530 9:27945272-27945294 AGAGTAAAGTGACAAAAGTCAGG + Intergenic
1052519992 9:29534376-29534398 AGATTAATGTAACCAAAATTCGG + Intergenic
1053551096 9:39080139-39080161 AGAGTAGCCTGACCAACATCTGG - Intronic
1053815206 9:41900220-41900242 AGAGTAGCCTGACCAACATCTGG - Intronic
1054615390 9:67287221-67287243 AGAGTAGCCTGACCAACATCTGG + Intergenic
1055885750 9:81061644-81061666 ATAATAATCTGACCAAAATATGG - Intergenic
1058985413 9:110205388-110205410 AGAGTAAGGTGACAAAAATAAGG - Intronic
1062549159 9:137078046-137078068 AGAGAAATCTGACGGAAACCTGG - Exonic
1185666605 X:1770244-1770266 ATTGTAATCTCACCCAAATCGGG - Intergenic
1189176804 X:38965828-38965850 TGATTAATCTGATGAAAATCTGG - Intergenic
1189619770 X:42823291-42823313 AGAGTAATCTAACCAACCTGTGG + Intergenic
1192043407 X:67646408-67646430 AGGGTAAAATGACCAAATTCTGG + Intronic
1194712717 X:97254521-97254543 AGAGGAACCTGACTAAAATTTGG + Intronic
1197539691 X:127742767-127742789 AGAACAAACTTACCAAAATCGGG + Intergenic