ID: 923209035

View in Genome Browser
Species Human (GRCh38)
Location 1:231786739-231786761
Sequence GGGACCTAGCCTGTATGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923209025_923209035 14 Left 923209025 1:231786702-231786724 CCTTGCACCTGTCCCACACCATG 0: 1
1: 0
2: 2
3: 27
4: 289
Right 923209035 1:231786739-231786761 GGGACCTAGCCTGTATGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 96
923209024_923209035 15 Left 923209024 1:231786701-231786723 CCCTTGCACCTGTCCCACACCAT 0: 1
1: 0
2: 2
3: 33
4: 393
Right 923209035 1:231786739-231786761 GGGACCTAGCCTGTATGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 96
923209034_923209035 -4 Left 923209034 1:231786720-231786742 CCATGGTAGGTTTTATATGGGGA 0: 1
1: 0
2: 1
3: 9
4: 116
Right 923209035 1:231786739-231786761 GGGACCTAGCCTGTATGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 96
923209029_923209035 2 Left 923209029 1:231786714-231786736 CCCACACCATGGTAGGTTTTATA 0: 1
1: 0
2: 0
3: 10
4: 120
Right 923209035 1:231786739-231786761 GGGACCTAGCCTGTATGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 96
923209023_923209035 19 Left 923209023 1:231786697-231786719 CCTACCCTTGCACCTGTCCCACA 0: 1
1: 0
2: 2
3: 32
4: 300
Right 923209035 1:231786739-231786761 GGGACCTAGCCTGTATGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 96
923209030_923209035 1 Left 923209030 1:231786715-231786737 CCACACCATGGTAGGTTTTATAT 0: 1
1: 0
2: 0
3: 28
4: 636
Right 923209035 1:231786739-231786761 GGGACCTAGCCTGTATGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 96
923209028_923209035 7 Left 923209028 1:231786709-231786731 CCTGTCCCACACCATGGTAGGTT 0: 1
1: 0
2: 0
3: 11
4: 90
Right 923209035 1:231786739-231786761 GGGACCTAGCCTGTATGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 96
923209022_923209035 28 Left 923209022 1:231786688-231786710 CCTTGTCTTCCTACCCTTGCACC 0: 1
1: 0
2: 1
3: 30
4: 351
Right 923209035 1:231786739-231786761 GGGACCTAGCCTGTATGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923209035 Original CRISPR GGGACCTAGCCTGTATGCCC AGG Intronic
900487961 1:2932443-2932465 GGTCCCTATCCTGTATCCCCTGG - Intergenic
903824016 1:26129377-26129399 GGGACTTAGGCTGTGTCCCCTGG - Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
907289296 1:53402599-53402621 GGGACCCATCCTGTCTGCCTAGG - Intergenic
911804958 1:102194499-102194521 GGGACCTTTCCTATATGCCTAGG - Intergenic
912687002 1:111775786-111775808 GGCACATAGCCTATATCCCCCGG + Intronic
918118023 1:181513770-181513792 GGGTCCTTGCCTGCATGTCCAGG + Intronic
923209035 1:231786739-231786761 GGGACCTAGCCTGTATGCCCAGG + Intronic
1063102302 10:2961366-2961388 GTGGCTTAGCCTGTATTCCCGGG + Intergenic
1064071008 10:12228124-12228146 GGGACCTAGCTTTGTTGCCCAGG + Intronic
1070921517 10:80189523-80189545 GGTACTCGGCCTGTATGCCCAGG - Intronic
1076426276 10:130369756-130369778 GAGACGTTGCCTGCATGCCCTGG - Intergenic
1076445339 10:130510238-130510260 GGGGCCATGCCTGGATGCCCCGG + Intergenic
1076693771 10:132237214-132237236 GGGGCCCAGCCTGTGAGCCCAGG - Intronic
1084998883 11:73011133-73011155 GGACCCTAGCCTGTGTGCTCTGG + Intronic
1085198640 11:74688012-74688034 GGGGCCTATCCTGATTGCCCAGG - Intergenic
1093458772 12:19389434-19389456 GACACCTAGCCGGTATGCGCTGG + Intergenic
1094496791 12:30993860-30993882 GGGGCCTTACCTGTCTGCCCTGG + Exonic
1094653500 12:32399706-32399728 GGGGCGTCGCCTGCATGCCCAGG - Intronic
1099917666 12:88915436-88915458 GGACCCTGGACTGTATGCCCTGG + Intergenic
1101735507 12:107459996-107460018 GGGAGCCAGCCTGTTTTCCCAGG - Intronic
1102388021 12:112527186-112527208 GTGACCTACCCTGGATGGCCTGG + Intergenic
1108961550 13:56238535-56238557 GGGACCCATCTTGTCTGCCCAGG + Intergenic
1109308434 13:60664444-60664466 GGGAGCAAGACTGTAAGCCCAGG + Intergenic
1121105707 14:91278126-91278148 GGGACCTGGCCACTTTGCCCCGG - Exonic
1126063220 15:44804096-44804118 GGGACCTAGCCTATGTGCAAAGG + Intergenic
1127589346 15:60408042-60408064 GGGATCTTGCCTTTTTGCCCAGG - Intergenic
1128760616 15:70213960-70213982 GGGACCTGGCCTCTATCCTCAGG - Intergenic
1132347796 15:101118912-101118934 GCTACCTGGCCTGGATGCCCCGG - Intergenic
1132358604 15:101193011-101193033 AGGACCTACCCTGTATGCACTGG + Intronic
1132737407 16:1393787-1393809 AGGACCCAGCTTGGATGCCCAGG + Intronic
1138349735 16:56340061-56340083 AGGAGCTAGCCAGGATGCCCTGG + Intronic
1139474868 16:67198150-67198172 GGGACCCAGACTGTCTGACCTGG + Exonic
1139751119 16:69109431-69109453 GGGCACCAGCCTGTTTGCCCTGG + Exonic
1141692907 16:85606646-85606668 AGGACCCAGCCTGGATGCCCTGG + Intergenic
1144693001 17:17281069-17281091 GGGAACTGGCCTGGATCCCCAGG - Intronic
1147703360 17:42409744-42409766 GGTGCCTGGCCTGTGTGCCCAGG - Intronic
1152911174 17:83005729-83005751 GGGTGCTGGCCTGGATGCCCGGG - Intronic
1156411141 18:36829072-36829094 GGGACCGAGCCTGCAGGCCGAGG + Intronic
1158950172 18:62487247-62487269 AGGACTTAACCTTTATGCCCAGG + Intergenic
1164423565 19:28119414-28119436 GGGACCTTCCCTGTTGGCCCCGG - Intergenic
1165482418 19:36072465-36072487 GGGACCTAACATGTAAGGCCTGG - Intronic
1166661530 19:44650331-44650353 GGTACCCAGACTGTCTGCCCTGG + Intronic
1168025041 19:53637770-53637792 TGGACCTGACCTATATGCCCAGG - Intergenic
926923106 2:17958930-17958952 GGTACCTAGCTTGAGTGCCCTGG + Intronic
927856898 2:26533398-26533420 GAGACCCAGCCTTTGTGCCCTGG - Intronic
930752774 2:54948688-54948710 GGGACCCAGCCTGAATTCACAGG - Intronic
933799967 2:85952965-85952987 GGGAGCTTCCCTGTCTGCCCTGG + Intergenic
938104477 2:128520651-128520673 GGGGCCTGGCCTTTAAGCCCAGG + Intergenic
945770414 2:214035338-214035360 GGGACCTGCCCCTTATGCCCAGG + Intronic
946849451 2:223891044-223891066 GGGATCAATCCTCTATGCCCTGG + Intronic
1170987511 20:21272095-21272117 GGGACCTAGCTGGTCTGCTCAGG - Intergenic
1175930924 20:62493392-62493414 GGGTCCTGGCGTGTGTGCCCGGG - Intergenic
1176046887 20:63097403-63097425 GGGTCCCAGCCTGGCTGCCCAGG - Intergenic
1176665095 21:9679022-9679044 GGCACCTAGCCTGGGTGCTCCGG + Intergenic
1182214410 22:28703822-28703844 GAGACCTAGCCTTCATTCCCAGG - Intronic
1184691271 22:46118390-46118412 GAGACAAAGCCTGGATGCCCAGG - Intergenic
1184846764 22:47092498-47092520 GGCACCTTGCATGCATGCCCTGG + Intronic
954709893 3:52500337-52500359 GGGCCCCAGCCAGGATGCCCTGG + Intronic
955063316 3:55513269-55513291 GGGGCCTCGCCAGTATGGCCAGG - Intronic
960885275 3:122387526-122387548 GGGACATAGCCAGTATCCCCTGG + Intronic
961237629 3:125381213-125381235 GGGTCTTACTCTGTATGCCCAGG - Intergenic
962756639 3:138469941-138469963 GGAACCTTACCTATATGCCCTGG - Intronic
962864919 3:139440509-139440531 GGCACCAAGCATGTATGCCATGG + Intergenic
964531713 3:157675081-157675103 GGGACCCAGCCTGGAAGCCTGGG - Intronic
964928266 3:161983111-161983133 GGGAACTATCTTGTCTGCCCAGG - Intergenic
967124762 3:186413639-186413661 GGGACTTATCCTGACTGCCCTGG + Intergenic
968350377 3:198047762-198047784 GGGACCTAGTCAGCATGGCCTGG - Intergenic
968659420 4:1793083-1793105 GGGGCCTAGCCCGCCTGCCCCGG + Intergenic
969924556 4:10574183-10574205 GGCACCTAGTCTGTATGACATGG - Intronic
980503070 4:133682125-133682147 GGCCCCTAGACTGTATGTCCTGG + Intergenic
988636940 5:32995008-32995030 GAGTCCTATCCTGTATGCCCAGG - Intergenic
991971665 5:72147553-72147575 GGGACCAAGCATCTATGCCAGGG - Intronic
992191041 5:74292161-74292183 AGTACCTAGCCTGGATGCCAGGG - Intergenic
994840935 5:104924100-104924122 GTGAGAAAGCCTGTATGCCCAGG + Intergenic
996690878 5:126338558-126338580 GGGGACTAGACTGCATGCCCTGG + Intergenic
999767354 5:154751350-154751372 AGGACCTAGCCTGTAGTGCCTGG + Intronic
1003448291 6:6205419-6205441 GGTATCTAGCCAGGATGCCCTGG - Intronic
1006661037 6:35644830-35644852 GGGTCCTGGACTGTATGCCTGGG + Intronic
1007786050 6:44279961-44279983 GGGACCCAGCCTTTGTGCCCAGG - Exonic
1008294683 6:49761222-49761244 GGGAGCTCACCTGTGTGCCCAGG - Intergenic
1009534903 6:64869359-64869381 GGGACTTTCCCTGTATCCCCTGG - Intronic
1011726645 6:90216393-90216415 GGGGCCTAGGCTGTCTGCTCAGG + Intronic
1015171744 6:130261839-130261861 GGGAACTGGTCTGGATGCCCGGG - Intronic
1015836283 6:137423683-137423705 GGCTCCCAGCCTGCATGCCCTGG + Intergenic
1022258592 7:28683070-28683092 GAGACCTAGCCTGTTGGCCGGGG + Intronic
1029488384 7:100856971-100856993 GGGAGCCGGCCTCTATGCCCGGG + Exonic
1034424350 7:151006829-151006851 TGGGCCTAGCCTGTATCCCCAGG + Intronic
1035313399 7:157983634-157983656 GGGACGCTGCCTGCATGCCCCGG + Intronic
1037810443 8:22083334-22083356 GGGGCCTAGCCTGAGTACCCTGG + Intergenic
1046780197 8:118206462-118206484 TGGACCATGCCTGTATTCCCAGG - Intronic
1047722106 8:127650583-127650605 GGGATCTTGCCAGTATGCCCAGG - Intergenic
1048055093 8:130855548-130855570 GGGAGCAAGCCTTGATGCCCTGG - Intronic
1050922314 9:11219610-11219632 GAGATCTAGCCAGTATGACCTGG + Intergenic
1051428665 9:16960274-16960296 GGCACATGGCCTGTAGGCCCTGG - Intergenic
1053365629 9:37520629-37520651 GGGATCAAGCCTGTAATCCCAGG - Intronic
1058593168 9:106586842-106586864 GGTACCTGGACTGTATGACCTGG + Intergenic
1059101260 9:111474033-111474055 GGGACCTAACTTGTAGGCCTCGG - Intronic
1060171936 9:121468990-121469012 GGGGCCTAGCTTGTAAACCCAGG - Intergenic
1062058726 9:134483121-134483143 GGCACCTTTCCTGTAGGCCCTGG - Intergenic
1203661006 Un_KI270753v1:42727-42749 GGCACCTAGCCTGGGTGCTCCGG - Intergenic
1195128446 X:101831746-101831768 GAGACTCAGCCTGTCTGCCCAGG - Intergenic
1200124954 X:153808839-153808861 GGGACCCAGCCTCTGTGCACTGG + Intronic
1200424880 Y:3009579-3009601 GGAACCAACCCTTTATGCCCAGG + Intergenic