ID: 923211227

View in Genome Browser
Species Human (GRCh38)
Location 1:231806280-231806302
Sequence CCCTTTTACTACAGGTACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923211227_923211235 18 Left 923211227 1:231806280-231806302 CCAGTGTACCTGTAGTAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 72
Right 923211235 1:231806321-231806343 CTCTTAATCCAAGGCAGCTTTGG 0: 1
1: 0
2: 0
3: 12
4: 112
923211227_923211232 9 Left 923211227 1:231806280-231806302 CCAGTGTACCTGTAGTAAAAGGG 0: 1
1: 0
2: 1
3: 7
4: 72
Right 923211232 1:231806312-231806334 CATCCATACCTCTTAATCCAAGG 0: 1
1: 0
2: 0
3: 13
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923211227 Original CRISPR CCCTTTTACTACAGGTACAC TGG (reversed) Intronic
901767583 1:11513308-11513330 CTCTTTTAGTACAAGTATACTGG + Intronic
907220281 1:52902279-52902301 GCCTTTTATTACAGCTACTCAGG - Intronic
908457061 1:64314134-64314156 GCCTGTGACTACAGTTACACTGG + Intergenic
908612636 1:65879706-65879728 TCCTTGTACTACAGCTATACAGG - Intronic
910698073 1:90042869-90042891 CCATTATGCCACAGGTACACTGG + Intergenic
918195770 1:182219661-182219683 CCCCTCTGCTACAGGTCCACTGG - Intergenic
921154604 1:212429397-212429419 CCCTTCTACTACAGAAACACAGG + Intergenic
923211227 1:231806280-231806302 CCCTTTTACTACAGGTACACTGG - Intronic
1084571019 11:69959866-69959888 CCCTCTTACTGCAGCCACACTGG + Intergenic
1090091595 11:123702960-123702982 TCCTTGTACTCCAGGTACACTGG - Intergenic
1092732121 12:11544813-11544835 GCCTTTTTCTCCAGGCACACTGG + Intergenic
1094080298 12:26527469-26527491 CCCTTTCAGTTCAGGTATACTGG + Intronic
1099214008 12:79831881-79831903 CTTTTTTACTACATGAACACTGG - Intronic
1099695206 12:86010738-86010760 ACCTTTTAATACTGTTACACTGG - Intronic
1106620023 13:31364013-31364035 CACATTTAGTACAGGGACACAGG + Intergenic
1107921645 13:45214997-45215019 CCCTTTTCCTATAGAAACACAGG + Intronic
1114446437 14:22792273-22792295 ACCTTTTACTCCAGGTGCAGTGG + Intronic
1119294522 14:73522263-73522285 CCCGTTTACTACAGGTATACTGG - Exonic
1119771622 14:77223781-77223803 CCCTTCCACTACAGGTGCACAGG - Intronic
1127330092 15:57930511-57930533 CCTTTTTACCAGAGGTACAAAGG - Intergenic
1132062159 15:98701246-98701268 TTCTTTTACTACAGGTCTACAGG - Intronic
1138662463 16:58530914-58530936 AAATTTTGCTACAGGTACACAGG - Intronic
1146470957 17:33124569-33124591 GCTTTTTACTACAGAGACACTGG - Intronic
1149515161 17:57275609-57275631 CCCTTTCACTTCATGTCCACTGG + Intronic
1155440850 18:25861189-25861211 CCCTTTTACTAGAGAAACAATGG + Intergenic
1156423623 18:36983916-36983938 GCCATTTACTACAGGAATACAGG + Intronic
1162391689 19:10393768-10393790 CCCTGTTCCTCCAGGTACGCAGG + Intronic
1163327939 19:16617274-16617296 CCATTTTCCTTCAGGTACACAGG + Intronic
1164321003 19:24146883-24146905 CCCTTTTACTTCAGGTTTGCTGG - Intergenic
1165639620 19:37373085-37373107 CCCTTTTACTACCAGTAAAGTGG + Intronic
1165690425 19:37858769-37858791 CCCCGTTACTCCAGGAACACTGG + Intergenic
926207003 2:10840934-10840956 CCCTCTTCCTACAAGGACACTGG - Intergenic
926245713 2:11121386-11121408 CCCTTTTCCAACAGGTATAATGG + Intergenic
930689134 2:54341210-54341232 ACCTTTTAATACAGTTACAATGG - Intronic
934098647 2:88630184-88630206 CCCTTTTCCTCCAGATACTCTGG - Intergenic
936025967 2:109031444-109031466 CCCTCTTACTACTGTTGCACCGG + Intergenic
936084662 2:109458812-109458834 CTCTTTTACTTAAGGTAAACTGG + Intronic
936119466 2:109728954-109728976 TCCTTTTACTACACATACAGTGG - Intergenic
943832354 2:192478768-192478790 CCCTTTTCTCACAGGTCCACTGG - Intergenic
945688333 2:213000563-213000585 CAGTTTTACTACAGGGACACAGG + Intronic
1177812586 21:25940315-25940337 CCGTATTTCTACAGATACACTGG - Intronic
1182082028 22:27536351-27536373 CCCTTTTTCTACAGGGACTTGGG + Intergenic
1182654329 22:31877805-31877827 CCCTTTTGCTATAGGTGTACTGG - Intronic
1184519065 22:44981717-44981739 CCCCTTAACAACAGCTACACGGG + Intronic
951110108 3:18793207-18793229 CCCTTTTACTACAGGTTTTCAGG - Intergenic
951882498 3:27492909-27492931 CCCTTTTACGACGGGCACAGTGG + Intergenic
954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG + Intronic
962709000 3:138070008-138070030 CTTTTTTACTACAGGAACAAAGG + Intronic
967387263 3:188923927-188923949 GTCTTTGATTACAGGTACACAGG + Intergenic
969905419 4:10389839-10389861 AGCTTTTCCTACAGGTAGACTGG + Intergenic
972548930 4:40109349-40109371 CCCTTTTACAAAGGGGACACTGG - Intronic
977428297 4:96898402-96898424 CCCTTTTAATACATGTTCAGTGG - Intergenic
983827984 4:172288058-172288080 CCACATTATTACAGGTACACTGG - Intronic
984510795 4:180676449-180676471 CCCTTGTCCTACAGTTCCACAGG - Intergenic
985687195 5:1288890-1288912 CCATTTTGCTACGGGGACACGGG - Intronic
985710856 5:1428851-1428873 CGTTTTTACTACAGGTCCTCAGG - Intronic
986185833 5:5436639-5436661 ACCTTTTGTTACAGGTTCACAGG + Intronic
990112605 5:52346468-52346490 TCTTTTTACTGCAGGTTCACTGG - Intergenic
992053645 5:72965178-72965200 CAATTTTTCTACAGGTATACGGG - Intronic
992775142 5:80082677-80082699 GCTTTTTACTTCTGGTACACAGG - Intronic
994122349 5:96130079-96130101 CCCTTTTTTCACAGGTACTCTGG - Intergenic
996697650 5:126416645-126416667 CCCTTATACTCCAGGCACATTGG + Intronic
1002347013 5:178555169-178555191 TCCTTTTATTACAGGGACAGCGG + Intronic
1005233448 6:23732834-23732856 CTCTTATATTACATGTACACGGG - Intergenic
1006145923 6:31959547-31959569 CACATGTACTGCAGGTACACTGG - Intronic
1006877555 6:37311733-37311755 CCCTTGTGCTACAGAGACACAGG - Intronic
1010159182 6:72831800-72831822 CCCTTTTACTAGGGTTAAACTGG + Intronic
1012355584 6:98310046-98310068 CCCTTTTGCTCCAGACACACTGG + Intergenic
1037005899 8:13779500-13779522 CGCTTTTACAACAGGAACAAAGG + Intergenic
1038709623 8:29930414-29930436 CCCTTTTAATGCAGGTTTACTGG - Intergenic
1041531272 8:58870415-58870437 CCCTTTTATTCCATGAACACAGG - Intronic
1048819484 8:138367563-138367585 CCTTTTTACCACAGCTACACAGG + Intronic
1056679907 9:88708165-88708187 CCCCATTTCTACAGGCACACAGG + Intergenic
1185447004 X:263702-263724 CTCTTTTATTTCAGGTATACAGG - Intergenic
1192577418 X:72254170-72254192 CCCTTTTTCTTCAGGCACATTGG + Intronic
1192922641 X:75723850-75723872 GCCTTTTACTGCAGGTTTACTGG + Intergenic
1194064521 X:89244953-89244975 ACCTTTTAATACTGTTACACTGG + Intergenic
1196866305 X:120074189-120074211 ACCTTTGACCACAGGTACATTGG - Intronic
1196876794 X:120162092-120162114 ACCTTTGACCACAGGTACATTGG + Intronic
1197535713 X:127687022-127687044 CACTTTTACTAGAGGAAGACAGG - Intergenic
1200718693 Y:6579035-6579057 ACCTTTTAATACTGTTACACTGG + Intergenic