ID: 923211602

View in Genome Browser
Species Human (GRCh38)
Location 1:231808654-231808676
Sequence CAGGTCAGACAACTAGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923211602_923211609 0 Left 923211602 1:231808654-231808676 CCAATGCCTAGTTGTCTGACCTG 0: 1
1: 0
2: 1
3: 20
4: 137
Right 923211609 1:231808677-231808699 TGACCAGGGGCTCCTCGCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 129
923211602_923211613 24 Left 923211602 1:231808654-231808676 CCAATGCCTAGTTGTCTGACCTG 0: 1
1: 0
2: 1
3: 20
4: 137
Right 923211613 1:231808701-231808723 AACTTGTTTATATGTCTTTGTGG 0: 1
1: 0
2: 1
3: 26
4: 408
923211602_923211608 -1 Left 923211602 1:231808654-231808676 CCAATGCCTAGTTGTCTGACCTG 0: 1
1: 0
2: 1
3: 20
4: 137
Right 923211608 1:231808676-231808698 GTGACCAGGGGCTCCTCGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923211602 Original CRISPR CAGGTCAGACAACTAGGCAT TGG (reversed) Intronic
902210952 1:14904133-14904155 CAGGCCATACAACTAGGAAGTGG - Intronic
902439627 1:16421082-16421104 CAGGTCAAAGAACTAGGAAGTGG + Intronic
903198650 1:21713929-21713951 CAGGCCACACAACTAGGAAGGGG - Intronic
905885422 1:41489270-41489292 CATGTCAGACAGCTAGGAAGTGG + Intergenic
908141130 1:61186239-61186261 CAGTTCATACAACTAGTCAATGG - Intronic
908777222 1:67651844-67651866 AAGGTCAGACAACTAGTAAATGG - Intergenic
915013489 1:152712077-152712099 AAGGTCACACATCTAGGAATTGG + Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
915937237 1:160096692-160096714 CAGGCCACACAGCTGGGCATGGG - Intronic
919985522 1:202671346-202671368 CAGGGCAGCCAACTGTGCATGGG + Intronic
920380708 1:205533136-205533158 CAGGTCAGACTCCCAGGCCTGGG - Intergenic
922796138 1:228340779-228340801 CAGGGCAGACACCACGGCATAGG - Exonic
923211602 1:231808654-231808676 CAGGTCAGACAACTAGGCATTGG - Intronic
1067476301 10:46569146-46569168 AAGGTCACACAACTAGAAATCGG - Intergenic
1067618436 10:47772634-47772656 AAGGTCACACAACTAGAAATCGG + Intergenic
1067791612 10:49292598-49292620 AAGGTCACAGAACTAGGCATAGG - Intergenic
1069718357 10:70534758-70534780 CAGGTCATGCAACTCGGCACAGG - Exonic
1070799469 10:79236675-79236697 CAGGTCAGAGACCTAGGCTCCGG + Intronic
1072951390 10:99849489-99849511 CAGGTCTGAAATCAAGGCATTGG - Intronic
1072973675 10:100039055-100039077 GAGGTCAGATAAAGAGGCATTGG - Intergenic
1073318178 10:102597474-102597496 CAGGAAACACAACTAGGAATGGG - Intronic
1074539201 10:114350888-114350910 CAGGCCAGACAAAGAGGCTTTGG + Intronic
1075384657 10:122046860-122046882 GCGGTCAGACAAGTAGGAATTGG + Intronic
1075650403 10:124124411-124124433 CAGGTCACACAGCTAGGCAGGGG + Intergenic
1079335546 11:19567508-19567530 CAGGTCACACAACTAGTAAGTGG + Intronic
1080408798 11:32004041-32004063 AAGGTCACACAGCTAGGCAGTGG - Intronic
1081254218 11:40872116-40872138 GAGATCTGACAACTAGGCATCGG + Intronic
1081608267 11:44541307-44541329 GAGGTCAGACAACTAGGCGGGGG + Intergenic
1083704327 11:64503520-64503542 CAGGACAGACAAAAAGGCTTGGG - Intergenic
1084433475 11:69124080-69124102 CAGGTCACACAGCAAGGCCTTGG - Intergenic
1084959539 11:72709324-72709346 CAGGTCACACAGCTAGTCAGTGG + Intronic
1085521688 11:77142849-77142871 CAGGTCTGACCCCAAGGCATGGG - Intronic
1085887310 11:80535801-80535823 AAGGTCACACAACTAGGAAGTGG + Intergenic
1086140913 11:83499085-83499107 CAGGAAAGCCATCTAGGCATGGG - Intronic
1088830790 11:113535014-113535036 CAGGTCATACAGCTAGTCCTTGG - Intergenic
1092791940 12:12077741-12077763 CAGGTCACAAAACTAGTCACTGG + Intronic
1096495891 12:52039050-52039072 AAGGTCACACAGCTAGGAATTGG - Intronic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1098357941 12:69628795-69628817 CAGATCAGCCAACTAGGAAGTGG - Intergenic
1103205306 12:119124316-119124338 GAGGCCAGAGAACTAGGCAAGGG + Intronic
1103961795 12:124613621-124613643 CAGGTCACACAGCTAGGGAGTGG + Intergenic
1104427885 12:128693079-128693101 TAGGTCAGGCAAATAGGGATGGG + Intronic
1104993568 12:132640507-132640529 CAGGCCAGACAGCTAGGCATTGG + Intronic
1105400734 13:20092685-20092707 AAGGTCACACAACTAGGAAGTGG + Intergenic
1106224489 13:27774701-27774723 CATGCCAGATAACTAGGCCTCGG + Intergenic
1112452943 13:99528295-99528317 CAAGTCACACAACTGAGCATCGG - Intronic
1117563586 14:56970292-56970314 GAGGTCAGAGAGCTAGGCAGGGG + Intergenic
1117787262 14:59299297-59299319 CAGGTCATACAACTAGTAAATGG - Intronic
1118909849 14:70052172-70052194 CAGCTCAGAGTATTAGGCATGGG + Intronic
1120504369 14:85336216-85336238 GAGGCCAGACAACTTGGCTTTGG - Intergenic
1123980897 15:25601680-25601702 TAGGTCAGACAAGTAGGAGTAGG - Intergenic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1127895660 15:63296525-63296547 AAGGACAGAAAAATAGGCATCGG + Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129598439 15:76982899-76982921 CTAGTCATAGAACTAGGCATTGG - Intergenic
1132625971 16:891682-891704 CAGGTCAGAAAAGTGGGCAGGGG - Intronic
1133500783 16:6364803-6364825 CAAGTCAGCCAACCAGGCAGAGG - Intronic
1137721059 16:50627732-50627754 CAGGGCAGACACGTAGGAATCGG - Intronic
1142294441 16:89211285-89211307 CAGGTTGGACAATGAGGCATTGG - Intergenic
1143303755 17:5929902-5929924 CGGGTCAGACAACTAGGCGCTGG - Intronic
1146626428 17:34438744-34438766 CAGGTCACACAGCAAGGAATGGG - Intergenic
1148590430 17:48812451-48812473 GAGTTCAGACAACTAGGAAGTGG - Intronic
1158781487 18:60657281-60657303 CAGGTCACACACATAGGCATCGG + Intergenic
1160356402 18:78230937-78230959 CAGGTGAGGCACCTAGGCCTGGG - Intergenic
1161100943 19:2421683-2421705 CAGGTCACACAGCCAGGCATGGG + Intronic
1161345866 19:3768486-3768508 CAGGGCACCCACCTAGGCATGGG - Intronic
1162726193 19:12690933-12690955 GAGGTCACACAGCTAGGCAGTGG + Intronic
1163438993 19:17312146-17312168 CAGGTCACACAACCAGGGACGGG + Intronic
1164550167 19:29204120-29204142 CAGGTCACACATCTAGGAAATGG + Intergenic
1166691637 19:44825001-44825023 CAAGTCAGACACTTAGGCATTGG - Intergenic
1168617718 19:57851903-57851925 CAGGTCAGACAACCAGCCTTAGG + Intronic
1168625534 19:57915122-57915144 CAGGTCAGACAACCAGCCGTAGG - Intronic
925415443 2:3667120-3667142 AAGGACAGACAACCAGGCAGGGG - Intronic
928139096 2:28712298-28712320 CAGCACAGAGTACTAGGCATAGG - Intergenic
929191068 2:39140434-39140456 CAGGTCACACAGCTAAGCAGTGG + Intergenic
930362835 2:50403304-50403326 CTGGTCAGACAACTAGCAACAGG - Intronic
932397601 2:71458879-71458901 CAGGTCACACCACTAGGAAAGGG + Intronic
935186646 2:100740214-100740236 CAGGTCAGGAATCTTGGCATGGG - Intergenic
936188562 2:110323001-110323023 CCGGGCAGACAACAAGGCACAGG - Intergenic
942253849 2:174071998-174072020 AAGGTCATACAACTAGGAAGTGG + Intergenic
945154407 2:206823465-206823487 CAGGCCAGAAAACTAGGCAGGGG + Intergenic
946577261 2:221089118-221089140 CAGCGCAGACAGCTATGCATTGG + Intergenic
1169155189 20:3323692-3323714 TAGGGCAGACACCTAGGCCTAGG + Intronic
1172023881 20:31934971-31934993 AAGGTTATACAACTAGGAATTGG - Intronic
1172564548 20:35918742-35918764 CAGATCAGACAACTAGACCAGGG - Intronic
1174437572 20:50521624-50521646 GAGGTTAGAAAACTAGGCAAAGG - Intronic
1174819564 20:53714718-53714740 CAGGTCACACAGCTAGGCAACGG - Intergenic
1175478513 20:59294403-59294425 AAGGTCACACAGCTAGGCAAGGG + Intergenic
1175557376 20:59876584-59876606 AAGGTCACACAACTAGGAAGTGG - Intronic
1180945219 22:19688846-19688868 CTGGCCAGAAAACCAGGCATGGG - Intergenic
1181944807 22:26508295-26508317 ATGGTCATACAACTAGGCAGAGG - Intronic
1181960527 22:26618920-26618942 CAGGTCAGATAACGTGGCCTGGG - Intergenic
1182259992 22:29067018-29067040 TGGCTCAGACAACTAGTCATGGG - Intergenic
1184087810 22:42275720-42275742 CAGGTCACACAGCTAGGAAGAGG + Intronic
950015396 3:9751422-9751444 TAGGTCACACAACCAGGAATGGG - Intronic
950882483 3:16334551-16334573 CAGCTCAGAGAACTGGGCAATGG + Intronic
950888975 3:16386470-16386492 AAGGTCAGACAACTAGTAAAGGG + Intronic
951445805 3:22779136-22779158 CAGTTCAGATAATTAGCCATGGG - Intergenic
953170774 3:40505582-40505604 CAGGTCACACAACTAGCAAGTGG + Intergenic
955353498 3:58211210-58211232 CAGCTCTGACATCTAGTCATCGG + Exonic
959301925 3:104613761-104613783 CAAGTCATACAGCTAGTCATTGG + Intergenic
960072232 3:113443729-113443751 AAGGTCACACAACTAGGGAGTGG - Exonic
960367037 3:116785422-116785444 AAGGTCACACAGTTAGGCATTGG - Intronic
964684163 3:159376569-159376591 CAGGTCTGATAACTAGGCTTTGG + Intronic
966328826 3:178788814-178788836 CAGGTCAGACAAGTGTGGATGGG - Intronic
969984074 4:11188922-11188944 CAGGTCAGACATCTATTTATTGG - Intergenic
976566855 4:86561070-86561092 CATGTCAGACCATCAGGCATTGG + Intronic
976657122 4:87500489-87500511 CAGGTCAGACTACCAGACTTAGG - Intronic
977153929 4:93549586-93549608 TAGGTCTGACCACTGGGCATTGG - Intronic
980133237 4:128835814-128835836 CAGGCCAGAAAACAAGGCAAAGG - Intronic
984495271 4:180488939-180488961 CAGGTCATTCAATTAAGCATTGG - Intergenic
987268706 5:16282432-16282454 CAGGTCACACAGCTAGTCACAGG + Intergenic
989709809 5:44384635-44384657 AAGGTCATTCAACTAGACATGGG - Intronic
990477003 5:56171200-56171222 CAGGTTAGACTGCTAGGCACTGG - Intronic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
993519701 5:88885131-88885153 CAGGAAATACAACTAGTCATTGG - Intronic
995777034 5:115734715-115734737 CAGGTCTGATACCCAGGCATAGG - Intergenic
996629399 5:125609147-125609169 GTGGTCAGCCAACTAGGCTTTGG + Intergenic
1000015947 5:157276683-157276705 AAGGTCACACAACTAGGTATTGG + Intronic
1004460409 6:15829857-15829879 CAGGTCACACAGCTAGGGACTGG - Intergenic
1007078633 6:39083600-39083622 CAGGTCACACAGCTCGGCAGTGG - Intronic
1007619236 6:43201811-43201833 CAGGCCAGAAAAGTAGGCAAAGG + Intronic
1012326823 6:97929532-97929554 CAAGGGGGACAACTAGGCATTGG + Intergenic
1015361263 6:132341918-132341940 CAGGTCACACAACTAGTAAGGGG - Intronic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1019115535 6:169758441-169758463 CACGTCAGACAGCTAGGAAGTGG + Intronic
1020284124 7:6667211-6667233 CAGGTCAGAAAAACACGCATTGG - Intergenic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1024586876 7:50849726-50849748 CAGCCCAAACCACTAGGCATTGG - Intergenic
1026298430 7:69076732-69076754 AAGGTCAGCAAACCAGGCATGGG + Intergenic
1026635819 7:72080740-72080762 TAGGTCAGAGAACTGGGCAGAGG + Intronic
1028639432 7:93026639-93026661 AAGGTCACACAGCTAGGAATTGG - Intergenic
1029574280 7:101392761-101392783 CATTTCAGACAACTAGGAATTGG - Intronic
1029999628 7:105045190-105045212 AAGATCTGAGAACTAGGCATGGG - Intronic
1031099485 7:117461855-117461877 AAGGTCAGAGAACTAGATATTGG + Intergenic
1031551026 7:123111844-123111866 CAGGGCAGAGAACAAAGCATGGG - Intergenic
1033589117 7:142796074-142796096 CAGGTCATATAACTAGGAAACGG + Intergenic
1038298967 8:26324486-26324508 CACGTCTGAAAACTAGGCAGAGG - Intronic
1041516121 8:58700603-58700625 CAGGTCACACTGCTAGGCAAAGG + Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1053121929 9:35553975-35553997 AAGGTCAAACAACTAGGAAGTGG - Intronic
1055633342 9:78247508-78247530 AAAGTCAGACAACTAGCCAGGGG + Intronic
1055768079 9:79686725-79686747 CAAGTCTGAAAACAAGGCATTGG - Intronic
1055841666 9:80512644-80512666 CAGGTTGGACATGTAGGCATTGG + Intergenic
1056773113 9:89493842-89493864 CAGGTCAGCCAACCAGCAATGGG + Intronic
1058555205 9:106159467-106159489 GAGGTCAGGAAACTAGGCAGGGG + Intergenic
1059703476 9:116798185-116798207 CAGGTCAGCCCAGGAGGCATAGG + Intronic
1187299991 X:18039000-18039022 TAAGTCATACAACTAGGCAGTGG - Intergenic
1188236613 X:27739507-27739529 AAGGTCTGAGAACTAGGCATTGG - Intronic
1189328976 X:40131131-40131153 CAGGTCAGACAACCTGGTTTGGG - Intronic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1191007962 X:55730860-55730882 CAGGTCAATCCACTAAGCATAGG - Intronic
1193473263 X:81932998-81933020 AAGGTCAAACAACTAGAAATCGG - Intergenic
1195389606 X:104347725-104347747 CAGGTCACACAACTAGAGATTGG + Intergenic
1196174683 X:112627774-112627796 CATGACAGCCAGCTAGGCATGGG + Intergenic
1196926927 X:120642577-120642599 CAGGTCACACAGCTAGGAAGTGG - Intergenic
1196995622 X:121380000-121380022 AAGGTCATACAACTAGTCAGTGG - Intergenic
1197262947 X:124336256-124336278 CAGGTGAGACAAATAAGCAGTGG + Intronic
1198323176 X:135540229-135540251 CAGGCCAGACAACTAGGAAATGG - Intronic